Skip to main content An official website of the United States government Here's how you know Here's how you know Official websites use .gov A .gov website belongs to an official government organization in the United States. Secure .gov websites use HTTPS A lock ( Lock Locked padlock icon ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites. Search Log in Dashboard Publications Account settings Log out Search… Search NCBI Primary site navigation Search Logged in as: Dashboard Publications Account settings Log in Search PMC Full-Text Archive Search in PMC Journal List User Guide PERMALINK Copy As a library, NLM provides access to scientific literature. Inclusion in an NLM database does not imply endorsement of, or agreement with, the contents by NLM or the National Institutes of Health. Learn more: PMC Disclaimer | PMC Copyright Notice Biology (Basel) . 2026 Apr 7;15(7):590. doi: 10.3390/biology15070590 Search in PMC Search in PubMed View in NLM Catalog Add to search Characterization and Phylogenetic Analysis of the Chloroplast Genome of Elaeagnus oxycarpa Schltdl Kaidiriye Yusupu Kaidiriye Yusupu 1 Key Laboratory of Biological Resources and Ecology of Pamirs Plateau in Xinjiang Uygur Autonomous Region, College of Life and Geographic Sciences, Kashi University, Kashi 844000, China Conceptualization, Writing – original draft Find articles by Kaidiriye Yusupu 1, † , Qiyu Gu Qiyu Gu 2 Key Laboratory of Pesticide and Chemical Biology of Ministry of Education, Hubei Key Laboratory of Genetic Regulation and Integrative Biology, School of Life Sciences, Central China Normal University, Wuhan 430079, China Writing – original draft Find articles by Qiyu Gu 2, † , Boqiang Wei Boqiang Wei 2 Key Laboratory of Pesticide and Chemical Biology of Ministry of Education, Hubei Key Laboratory of Genetic Regulation and Integrative Biology, School of Life Sciences, Central China Normal University, Wuhan 430079, China Writing – review & editing, Data curation Find articles by Boqiang Wei 2 , Hui Geng Hui Geng 2 Key Laboratory of Pesticide and Chemical Biology of Ministry of Education, Hubei Key Laboratory of Genetic Regulation and Integrative Biology, School of Life Sciences, Central China Normal University, Wuhan 430079, China Writing – review & editing, Data curation Find articles by Hui Geng 2 , Li Xiong Li Xiong 2 Key Laboratory of Pesticide and Chemical Biology of Ministry of Education, Hubei Key Laboratory of Genetic Regulation and Integrative Biology, School of Life Sciences, Central China Normal University, Wuhan 430079, China Conceptualization Find articles by Li Xiong 2, * Editors: Wenqiang Li , Miki Daisuke Author information Article notes Copyright and License information 1 Key Laboratory of Biological Resources and Ecology of Pamirs Plateau in Xinjiang Uygur Autonomous Region, College of Life and Geographic Sciences, Kashi University, Kashi 844000, China 2 Key Laboratory of Pesticide and Chemical Biology of Ministry of Education, Hubei Key Laboratory of Genetic Regulation and Integrative Biology, School of Life Sciences, Central China Normal University, Wuhan 430079, China * Correspondence: to [email protected] † These authors contributed equally to this work. Roles Kaidiriye Yusupu : Conceptualization, Writing – original draft Qiyu Gu : Writing – original draft Boqiang Wei : Writing – review & editing, Data curation Hui Geng : Writing – review & editing, Data curation Li Xiong : Conceptualization Wenqiang Li : Academic Editor Miki Daisuke : Academic Editor Received 2026 Mar 17; Revised 2026 Mar 27; Accepted 2026 Apr 1; Collection date 2026 Apr. © 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license . PMC Copyright notice PMCID: PMC13072164 PMID: 41972593 Simple Summary Elaeagnus oxycarpa is a key tree species for combating desertification in the arid regions of China, holding great ecological and economic value. However, as its complete chloroplast (cp) genome has not been investigated, in this study, we decoded its full cp genome. The genome is circular, 150,567 base pairs in length, and contains 132 functional genes. We analyzed its genetic code usage, which shows a preference for A/U nucleotides, and identified 77 simple sequence repeats. The genome structure is highly conserved compared to other related species. A family tree based on genome data strongly supports the notion that E. oxycarpa is most closely related to Elaeagnus angustifolia . This research provides the first complete chloroplast genome resource for E. oxycarpa , which will prove valuable in future studies investigating its conservation, species identification, and adaptation to harsh environments. Keywords: Elaeagnus oxycarpa , chloroplast genome, genomic structure, codon usage bias, simple sequence repeats (SSRs), comparative genomics, phylogenetic analysis Abstract Background: Elaeagnus oxycarpa Schltdl. (Elaeagnaceae) is a vital sand-fixing tree species in the arid, semi-arid, and desert regions of China, holding significant ecological and economic value. However, its chloroplast (cp) genome has not been previously characterized. Results: In this study, we sequenced the complete cp genome of Elaeagnus oxycarpa using Illumina high-throughput sequencing technology. We performed de novo assembly, annotation, and comparative genomic and phylogenetic analyses with six other Elaeagnaceae species. The results revealed a typical quadripartite structure for the E. oxycarpa cp genome, with a total length of 150,567 bp and a GC content of 36.90%. Annotation identified 132 genes, comprising 86 protein-coding genes (PCGs), 38 tRNA genes, and 8 rRNA genes. Codon usage bias analysis indicated a preference for A/U endings, with leucine codons being the most frequent (9.5%). Additionally, 77 simple sequence repeat (SSR) loci were detected, predominantly mononucleotide repeats (71.4%). Comparative genomic analysis demonstrated high sequence conservation among the seven Elaeagnus species, with nucleotide variations primarily concentrated in non-coding regions and intergenic spacers of genes such as rps 16, ycf 1, and trn C-GCA. These variable regions and SSR loci represent valuable molecular markers for future population genetics and species identification studies on Elaeagnus . Phylogenetic analysis strongly supported the notion that E. oxycarpa and Elaeagnus angustifolia form a sister clade, indicating their close genetic relationship. Conclusions: Our findings provide crucial genomic resources and a theoretical foundation for the species identification and elucidation of the evolutionary history of Elaeagnaceae. 1. Introduction The genus Elaeagnus (Elaeagnaceae) comprises plants renowned for their dual ecological and economic importance. With over 90 species distributed across temperate and subtropical regions of Asia, Europe, and North America, approximately 50 species are native to China, predominantly found in the Southwest, Northwest, and North of the country [ 1 , 2 ]. Species within this genus are primarily deciduous or evergreen trees and shrubs, characterized by exceptional adaptability to environmental stresses such as drought, salinity, alkalinity, and wind erosion [ 3 ]. These traits make them keystone species in fragile ecosystems, where they play a critical role in combating desertification, stabilizing sand dunes, and maintaining regional ecological balance. Economically, their fruits are rich in vitamins, fructose, and amino acids, whether consumed fresh or processed into jams and dried foods. Additionally, leaves and bark of some species contain bioactive compounds with medicinal properties, traditionally used to alleviate cough and diarrhea, indicating considerable pharmaceutical potential [ 4 , 5 , 6 , 7 , 8 ]. To date, several chloroplast genomes within the genus Elaeagnus have been sequenced and analyzed, including E. angustifolia [ 1 ], E. mollis [ 2 ], E. oldhamii [ 3 ], and others [ 4 , 5 ], providing insights into the genomic structure and phylogenetic relationships of the genus. Elaeagnus oxycarpa Schltdl., a deciduous tree within the genus, is a cornerstone species for afforestation and sand fixation in the arid, semi-arid, and desert regions of northwestern China [ 9 ]. Its exceptional ability to thrive in nutrient-poor sandy soils and withstand severe wind erosion makes it an invaluable natural barrier against desert expansion. Beyond its paramount ecological role in soil conservation, E. oxycarpa also offers significant economic benefits through its nutritious and medicinally promising fruits [ 10 , 11 , 12 ]. To date, most research on E. oxycarpa has focused on its biological characteristics, ecological functions, and preliminary phytochemical analyses [ 10 , 11 , 12 ]. However, in-depth genomic studies, particularly on its chloroplast genome, are lacking for this specific species, with no cp genome data available in the NCBI database prior to this study. Chloroplasts—essential organelles for photosynthesis—possess semi-autonomous genomes characterized by a stable structure, high copy number, and moderate evolutionary rate. These features make them ideal molecular markers for phylogenetic studies across various taxonomic levels [ 13 , 14 , 15 , 16 ]. The cp genomes of higher plants are typically double-stranded, circular DNA molecules that range from 120 to 160 kb, exhibiting a characteristic quadripartite structure comprising a large single-copy (LSC) region, a small single-copy (SSC) region, and a pair of inverted repeat (IRa/IRb) regions [ 15 ]. Understanding the cp genome is therefore crucial not only for elucidating evolutionary relationships but also for uncovering potential genetic adaptations to environmental stresses. The absence of cp genome data for E. oxycarpa has hindered a precise determination of its evolutionary position within the genus, thereby limiting a comprehensive understanding of Elaeagnus classification and evolutionary mechanisms. This study aimed to sequence, assemble, and annotate the complete cp genome of E. oxycarpa to characterize its structural features, gene composition, codon usage bias, SSR loci, and sequence divergence. Through comparative genomic and phylogenetic analyses with other Elaeagnaceae species, we sought to clarify the phylogenetic relationship of E. oxycarpa . Our findings fill a critical knowledge gap in the chloroplast genomics of this ecologically vital species and provide fundamental genetic resources for future studies on its genetic diversity, population evolution, and molecular breeding, and, importantly, these resources help understand the genomic basis of this species’ remarkable ecological adaptations. 2. Materials and Methods 2.1. Plant Material and Data Acquisition Fresh leaves of E. oxycarpa were collected from Altay County, Xinjiang Uygur Autonomous Region by researchers from the Molecular Biology Experiment Center, Germplasm Bank of Wild Species in Southwest China, and the National Wild Plant Germplasm Resource Center, Kunming Institute of Botany, Chinese Academy of Sciences (cstr.cn/31121.02.GBOWS). The plant material of Elaeagnus oxycarpa used in this study was formally identified by Prof. Cheng Liu, Kunming Institute of Botany, Chinese Academy of Sciences. Voucher specimens (No. 16CS12328) were deposited at the same institute. 2.2. DNA Extraction, Genome Sequencing, Assembly, and Annotation Total genomic DNA was extracted from flash-frozen leaf samples using a Plant Genomic DNA Kit (Tiangen Biotech, Beijing, China) according to the manufacturer’s instructions. DNA quality was assessed via 1% agarose gel electrophoresis and spectrophotometry. Additionally, complete cp genome sequences of 12 related species were downloaded from the NCBI database for comparative analysis (see Table S1 for accession numbers). Paired-end sequencing libraries were constructed and sequenced on an Illumina HiSeq 2500 platform at Guangzhou Genedenovo Biotechnology Co., Ltd., Guangzhou, China, generating approximately 5.2 Gb of raw data. Raw reads were quality-trimmed using Trimmomatic v.0.39 [ 17 ], resulting in 5 Gb of clean data. The cp genome was assembled de novo using GetOrganelle v.1.7.5 [ 18 ], with parameters -R 30 -k 21,45,65,85,105,127 -F embplant_pt. The assembly’s structural integrity was verified using Bandage v.0.8.1 [ 19 ]. Genome annotation was performed using the online tool GeSeq ( https://chlorobox.mpimp-golm.mpg.de/geseq.html , accessed on 31 March 2026) [ 20 ], followed by manual correction of gene boundaries, introns/exons, and stop codons in Geneious Prime v.2022.1.1 [ 21 ]. The annotated genome map was visualized and optimized using OGDRAW v.1.3 [ 20 ]. 2.3. Codon Usage Bias and SSR Analysis Codon usage bias was analyzed using CodonW v.1.4.2 [ 18 ] which calculated the Relative Synonymous Codon Usage (RSCU) values. RSCU >1 indicates positive codon usage bias, RSCU <1 indicates negative bias, and RSCU = 1 indicates no bias. Simple sequence repeats (SSRs) were identified using MISA v.2.1 [ 22 ], with minimum repeat thresholds set to 10 (mono-), 5 (di-), 4 (tri-), and 3 (tetra-, penta-, and hexa-nucleotide). 2.4. IR Boundary Shifts and Comparative Genomic Analysis The IRscope online tool [ 23 ] was used to analyze the contraction/expansion of IR boundaries and the distribution of adjacent genes, comparing E. oxycarpa with six congeneric species. Whole-genome alignment and sequence divergence analysis were performed using Shuffle-LAGAN mode in mVISTA [ 24 ], with the E. oxycarpa cp genome serving as the reference. 2.5. Phylogenetic Analysis Thirteen complete cp genome sequences, including E. oxycarpa and twelve related species (with Rosa cymosa as the outgroup), were aligned using MAFFT v.7 [ 25 ]. Poorly aligned regions were removed using Gblocks v.0.91b [ 26 ]. The optimal nucleotide substitution model (GTR+F+R4) was selected by ModelFinder [ 27 ] based on the Akaike Information Criterion (AIC). A maximum likelihood (ML) phylogenetic tree was constructed using IQ-TREE v.2.1.4 [ 28 ], with branch support assessed by 1000 ultrafast bootstrap replicates [ 29 ]. The tree was visualized using FigTree v.1.4.3. 3. Results 3.1. General Features of the Chloroplast Genome The complete cp genome of E. oxycarpa is a circular DNA molecule of 150,567 bp, exhibiting the typical quadripartite structure: a large single-copy region (LSC: 81,133 bp), a small single-copy region (SSC: 18,446 bp), and two inverted repeat regions (IR: 25,494 bp each) ( Figure 1 , Table 1 ). The overall GC content was 36.90%, with the IR regions exhibiting the highest GC content (42.70%), followed by the LSC (34.90%) and SSC (30.20%) regions ( Table 1 ). Annotation identified 132 unique genes, including 86 PCGs, 38 tRNAs, and 8 rRNAs ( Table 2 ). Figure 1. Open in a new tab Chloroplast genome ring map of Elaeagnus oxycarpa . Table 1. Base composition of chloroplast genome of Elaeagnus oxycarpa . Area A /% C /% G /% T/U /% Length/bp GC /% LSC 31.70 17.90 17.00 33.40 81,133 34.90 SSC 34.90 15.60 14.60 34.90 18,446 30.20 IRa 28.46 22.22 20.46 28.86 25,494 42.70 IRb 28.86 20.46 22.22 28.46 25,494 42.70 Total 31.10 18.80 18.20 32.00 150,567 36.90 Open in a new tab Note: 1. SSC, small single copy; 2. LSC, large single copy; 3. IRa/IRb, inverted repeat. Table 2. Chloroplast genome annotation information of Elaeagnus oxycarpa . Category of Genes Grouping of Genes Name of Gene Genes for Photosynthesis Subunits of photosystem I psaB , psaA , psaI , psaC , psaJ Subunits of photosystem II psbA , psbD , psbN , psbE , psbH , psbI , psbC , psbF , psbJ , psbK , psbL , psbB , psbM , psbT , psbZ Subunit of cytochrome b/f complex petL , petB *, petD *, PetA , petG , petN Subunits of ATP synthase atpA , atpF *, atpB , atpH , atpI , atpE Subunits of NADH dehydrogenase ndhA *, ndhC , ndhI , ndhB * # , ndhE , ndhF , ndhH , ndhD , ndhJ , ndhG , ndhK Large subunit of Rubisco rbcL ATP-dependent protease subunit P clpP ** Self-replicating genes DNA dependent RNA polymerase rpoB , rpoA , rpoC1 *, rpoC2 Small subunit of ribosome rps2 , rps3 , rps18 , rps7 *, rps11 , rps12 * # , rps14 , rps4 , rps15 , rps16 , rps8 , rps19 Large subunit of ribosome rpl2 * # , rpl33 , rpl16 *, rpl20 , rpl23 # , rpl32 , rpl14 , rpl22 , rpl36 Ribosomal RNAs rrn4.5(x2) , rrn5(x2) , rrn16(x2) , rrn23(x2) Transfer RNAs trnA-UGC(x2) , trnC-GCA , trnD-GUC , trnE-UUC , trnF-GAA , trnfM-CAU , trnG-GCC , trnG-UCC , trnH-GUG , trnI-CAU(x2) , trnI-GAU(x2) , trnK-UUU , trnL-CAA(x2) , trnL-UAA , trnL-UAG , trnM-CAU , trnN-GUU(x2) , trnP-UGG , trnQ-UUG , trnR-ACG(x2) , trnR-UCU , trnS-GCU , trnS-GGA , trnS-UGA , trnT-GGU , trnT-UGU , trnV-GAC(x2) , trnV-UAC , trnW-CCA , trnY-GUA Other Genes Maturase K matK Envelope membrane protein cemA Acetyl-CoA carboxylase subunit accD C-type cytochrome synthesis gene ccsA Genes of Unknown Function Conserved open reading frames ycf1(x2) , ycf2(x2) , ycf3 *, ycf4 Open in a new tab Note: Genes containing introns are marked with one (*) for one intron or two (**) for two introns, ( # ) indicates a trans-spliced gene and ( x2 ) indicates genes duplicated in the IR regions. 3.2. Codon Usage Bias Analysis of 50,189 codons revealed that leucine (Leu; 9.5%) was the most abundant amino acid. RSCU analysis identified 35 codons with RSCU > 1, indicating a strong preference for A/U endings at the third codon position ( Figure 2 ). For instance, the alanine codons GCA (RSCU = 1.20) and GCU (RSCU = 1.21) and the asparagine codon AAU (RSCU = 1.40) were preferentially used. Figure 2. Open in a new tab RSCU (Relative Synonymous Codon Usage) analysis of amino acids of Elaeagnus oxycarpa . 3.3. SSR Loci Analysis Seventy-seven SSR loci were identified ( Table 3 ), predominantly mononucleotide repeats (55, 71.43%), consisting mainly of A/T repeats. Dinucleotide (11), trinucleotide (6), tetranucleotide (2), pentanucleotide (2), and hexanucleotide (1) repeats were also detected. Most SSRs were located in intergenic spacer (IGS) regions, and a few were within genes like trn K-UUU, clp P, and ycf 1 ( Table 4 ). Table 3. Types of simple sequence repeats (SSRs) in the chloroplast genome of Elaeagnus oxycarpa . Repeat Unit Type Number Largest Repeat 1 A 19 16 T 36 18 2 AT 5 5 TA 6 5 3 TCT 1 4 TAT 1 4 AAT 2 4 CTT 1 4 AAG 1 4 4 TTTA 1 3 TCTT 1 3 5 TATTA 1 3 TAATA 1 3 6 ATCTAT 1 3 Total 14 77 - Open in a new tab Table 4. Simple repeat sequence (SSR) information of the chloroplast genome of Elaeagnus oxycarpa . NO. SSR Type SSR Size Start End Location 1 p1 (T)13 13 1307 1319 IGS 2 p1 (A)14 14 1427 1440 trnK-UUU * 3 p3 (TCT)4 12 1813 1824 trnK-UUU *-matK 4 p1 (T)11 11 1949 1959 trnK-UUU *-matK 5 p6 (ATCTAT)3 18 5730 5747 IGS 6 c (AT)5agagagagaataaatctatatctatctaacagactatggattctattatttcatagaatatctaatagaatctaaatag(AT)5 99 5864 5962 IGS 7 p1 (A)16 16 6965 6980 IGS 8 c (TA)5aaaaaagaaaaaacc(T)13atttgtccccagggactctttcatttccacggcttggcctgggcaggcccagccgggcttcttttgttctaacaaatcgtaataa(T)11catattttttttattattttattgctattctatttaccgatattttactgaaaaagataaagaaagatagagttcattttggatttttggacaatg(T)10 240 7193 7432 IGS 9 p1 (T)10 10 8234 8243 trnG-UCC * 10 p1 (T)10 10 12,894 12,903 IGS 11 p1 (A)11 11 13,828 13,838 IGS 12 p1 (T)10 10 14,761 14,770 IGS 13 p1 (A)11 11 14,982 14,992 IGS 14 p2 (TA)5 10 18,406 18,415 rpoC2 15 p1 (T)11 11 19,457 19,467 rpoC1 * 16 p1 (T)10 10 24,703 24,712 rpoB 17 p1 (A)11 11 26,199 26,209 IGS 18 p2 (TA)5 10 29,988 29,997 IGS 19 p1 (T)11 11 30,477 30,487 IGS 20 c (A)10tagggatcacttgtttcttgaacagttctt(A)12 52 30,914 30,965 IGS 21 p1 (T)11 11 33,774 33,784 IGS 22 p1 (A)10 10 34,121 34,130 IGS 23 p1 (T)10 10 34,624 34,633 IGS 24 p1 (A)12 12 41,002 41,013 IGS 25 p4 (TTTA)3 12 41,732 41,743 ycf3 * 26 p1 (T)12 12 43,703 43,714 IGS 27 p2 (TA)5 10 45,009 45,018 IGS 28 p2 (AT)5 10 45,546 45,555 IGS 29 p1 (T)10 10 45,681 45,690 IGS 30 c (AT)5taatatgtatatctatacatattgaatttcggatacagaaatgataaaatcttttatgattgggcaaaatatgaatttccgatag(A)10 105 45,931 46,035 IGS 31 c (T)10attgatatgaaaaatgaaaaaattgttgtgaatcgattcacatctg(A)11 67 46,556 46,622 trnL-UAA * 32 p2 (AT)5 10 50,054 50,063 IGS 33 p1 (T)10 10 51,090 51,099 IGS 34 p1 (T)11 11 53,033 53,043 atpB 35 p1 (A)13 13 53,622 53,634 IGS 36 p3 (TAT)4 12 57,648 57,659 IGS 37 p1 (A)11 11 58,148 58,158 IGS 38 p1 (T)11 11 63,899 63,909 IGS 39 p2 (TA)5 10 64,027 64,036 IGS 40 p1 (T)11 11 64,325 64,335 IGS 41 P3 (AAT)4 12 64,449 64,460 IGS 42 p1 (T)13 13 66,140 66,152 IGS 43 c (T)18gaaaaat(A)11ttctcatatcgaattcgaagtgccatgctattattactcaatattcatatagcgcgaaggcatagtcctctttttgtctctcaaat(A)13 135 67,610 67,744 clpP * 44 p1 (A)11 11 68,122 68,132 clpP * 45 c (T)10aggtttatgctctactccgagtaaagatccgcccgatttggatttgcacatatagaacaaatgccccaataccactttcatacgactttcccc(T)10 113 68,381 68,493 clpP * 46 p1 (A)13 13 76,591 76,603 IGS 47 c (TCTT)3tta(T)11 26 76,904 76,929 IGS 48 p1 (T)10 10 77,320 77,329 rps8 49 p1 (T)17 17 77,439 77,455 IGS 50 c (T)10atctg(T)14 29 77,907 77,935 IGS 51 p1 (A)11 11 78,537 78,547 rpl16 * 52 p1 (T)11 11 80,690 80,700 rpl22 53 p1 (T)10 10 81,127 81,136 IGS 54 p3 (CTT)4 12 87,545 87,556 ycf2 55 p5 (TATTA)3 15 96,041 96,055 IGS 56 p1 (T)10 10 109,257 109,266 IGS 57 c (T)10atttgataaaaaaaagtttttttgaagtgtggcaatgttacaattatgataatgctacaaaaatgtttac(TA)5 90 110,536 110,625 IGS 58 p1 (A)12 12 120,095 120,106 IGS 59 p3 (AAT)4 12 120,448 120,459 IGS 60 p1 (T)12 12 121,888 121,899 ycf1 61 p1 (T)12 12 123,050 123,061 ycf1 62 p1 (T)14 14 123,219 123,232 ycf1 63 p5 (TAATA)3 15 135,646 135,660 IGS 64 p3 (AAG)4 12 144,145 144,156 ycf2 Open in a new tab Note: The number in p1/p2 indicates the number of bases constituting the motif, and p represents a single SSR type; IGS represents the intergenic region; c represents the compound SSR type; * represents an intron. 3.4. IR Boundary Analysis IR boundary analysis among seven Elaeagnu s species revealed highly conserved structures and gene compositions ( Figure 3 ). Genome lengths varied from 150,546 bp ( E. angustifolia ) to 152,283 bp ( E. oldhamii ), with corresponding IR lengths ranging from 25,479 bp to 25,899 bp. The rps 19 gene was absent at the LSC/IRb junction only in E. henryi . The ycf 1 gene spanned the IRb/SSC and IRa/SSC junctions, with fragment lengths varying due to IR expansion/contraction. Figure 3. Open in a new tab IR boundary diagram of chloroplast genome of seven species of Elaeagnus . 3.5. Comparative Genomics Whole-genome comparison revealed high sequence identity among the seven Elaeagnus species ( Figure 4 ). Highly divergent regions were primarily located in non-coding sequences and within specific genes like rps 16, trn C-GCA, and ycf 1. Figure 4. Open in a new tab Chloroplast genome comparison of Elaeagnus oxycarpa and six other species of the Elaeagnus genus. Note: UTRs represent untranslated regions; CNS stands for non-coding sequence. 3.6. Phylogenetic Relationships Phylogenetic analysis yielded a well-supported phylogenetic tree ( Figure 5 ) that clearly separates Elaeagnus and Hippophae species, with Rosa cymosa as the outgroup. Within Elaeagnus , E. oxycarpa and E. angustifolia formed a strongly supported sister clade, with E. mollis as their closest relative. Figure 5. Open in a new tab Phylogenetic tree constructed via the ML method based on the whole chloroplast genome of 13 species. 4. Discussion This study presents the first complete cp genome sequence of Elaeagnus oxycarpa . Its quadripartite structure is consistent with typical angiosperm cp genomes and previously reported Elaeagnaceae species [ 28 , 29 , 30 , 31 ], which underscores the structural conservation of cp genomes driven by functional constraints on essential genes involved in photosynthesis and energy metabolism [ 15 ]. However, interspecific divergence was evident in our analysis. The GC content (36.90%) was lower than that of Hippophae species (37.8–38.2%) and slightly lower than E. angustifolia [ 30 ]. This lower GC content might result from synergistic effects of evolutionary forces. Genetic drift in small, fragmented wild populations of E. oxycarpa could favor the fixation of GC→AT mutations. Additionally, natural selection might favor lower GC content in arid high-temperature habitats, as it reduces DNA melting temperature, which potentially facilitates rapid gene transcription under stress [ 31 ], aligning with E. oxycarpa ’s adaptation to Northwestern China’s arid regions. However, we note that this correlation, while intriguing, requires further population-level and functional studies to establish a causal link. Comparative analysis with other arid-adapted Elaeagnus species (e.g., E. angustifolia from similar habitats) would help clarify if this genomic feature is a common adaptive trait or species-specific. The gene repertoire (132 genes) is typical of higher plant cp genomes [ 5 , 15 ]. The pronounced A/U bias in codon usage (68.3% at the third position), which is also observed in other Elaeagnus species such as E. angustifolia [ 30 ] and E. oldhamii [ 3 ], though slightly more pronounced in E. oxycarpa , may enhance translational efficiency by matching abundant tRNAs, which is crucial for the rapid synthesis of photosynthetic proteins (e.g., Rubisco) in variable environments [ 13 , 32 ]. Mutational pressure and high expression levels of photosynthetic genes likely contribute to this bias [ 33 ]. The 77 identified SSR loci, mostly mononucleotide repeats, represent valuable molecular markers for assessing genetic diversity, population structure, gene flow, cultivar identification, and molecular breeding in E. oxycarpa [ 34 , 35 ]. Comparative analysis of these loci across Elaeagnaceae can further clarify phylogenetic relationships [ 36 ]. The robust phylogenetic tree confirms the close relationship between E. oxycarpa and E. angustifolia , consistent with morphological and ecological similarities, thereby supporting the current taxonomic framework [ 37 ]. This provides a solid basis for future studies on Elaeagnaceae evolution, including divergence time estimation using molecular clocks. It is noteworthy that E. oxycarpa Schltdl. has sometimes been treated as a synonym or a variant of E. angustifolia L. in some taxonomic treatments (e.g., Plants of the World Online). Our phylogenetic results, showing them as sister species with strong support, are consistent with a very close relationship, supporting either a distinct species status or a very recent divergence within the E. angustifolia complex. The genomic resources provided here will aid in resolving this taxonomic nuance through more extensive population-level studies. 5. Conclusions We successfully sequenced, assembled, and annotated the complete chloroplast genome of Elaeagnus oxycarpa . The genome exhibits a typical structure but features a lower GC content and a strong A/U codon usage bias, potentially linked to its adaptation to arid environments. The identified SSRs and highly variable regions (e.g., rps 16, trn C-GCA, and ycf 1) provide powerful tools for species identification and population genetics. Phylogenetic analysis firmly establishes E. oxycarpa and E. angustifolia as sister species. This study provides essential genomic resources for future research on the conservation, molecular breeding, and adaptive evolution of this ecologically crucial species. Acknowledgments The authors thank the Molecular Biology Experiment Center, Germplasm Bank of Wild Species in Southwest China and National Wild Plant Germplasm Resource Center, Kunming Institute of Botany, Chinese Academy of Sciences (cstr.cn/31121.02.GBOWS) for supplying the specimens. Abbreviations The following abbreviations are used in this manuscript: AIC Akaike Information Criterion ATP Adenosine Triphosphate CNS Conserved Non-coding Sequence cp Chloroplast IGS Intergenic Spacer IR Inverted Repeat Leu Leucine LSC Large Single-Copy ML Maximum Likelihood NADH Nicotinamide Adenine Dinucleotide Hydrogen PCGs Protein-Coding Genes RSCU Relative Synonymous Codon Usage SSC Small Single-Copy SSR Simple Sequence Repeat UTRs Untranslated Regions Open in a new tab Supplementary Materials The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/biology15070590/s1 . Table S1: NCBI accession numbers for 12 species. biology-15-00590-s001.zip (66.4KB, zip) Author Contributions Conceptualization, K.Y. and L.X.; methodology, K.Y. and L.X.; software, B.W.; validation, B.W. and H.G.; formal analysis, B.W. and H.G.; investigation, K.Y. and Q.G.; resources, L.X.; data curation, B.W. and H.G.; writing—original draft preparation, K.Y. and Q.G.; writing—review and editing, K.Y. and Q.G.; visualization, B.W. and H.G.; supervision, L.X.; project administration, L.X.; funding acquisition, L.X. All authors have read and agreed to the published version of the manuscript. Institutional Review Board Statement Not applicable. Informed Consent Statement Not applicable. Data Availability Statement All data generated or analyzed during this study are included in this published article and its Supplementary Information Files . Conflicts of Interest The authors declare no conflicts of interest. Funding Statement This work was supported by the National Natural Science Foundation of China (32360926). Footnotes Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. References 1. Zhang X., Li G., Du S. Simulating the potential distribution of Elaeagnus angustifolia L. based on climatic constraints in China. Ecol. Eng. 2018;113:27–34. doi: 10.1016/j.ecoleng.2018.01.009. [ DOI ] [ Google Scholar ] 2. Li B., Zheng Y. Dynamic evolution and phylogenomic analysis of the chloroplast genome in Schisandraceae. Sci. Rep. 2018;8:9285. doi: 10.1038/s41598-018-27453-7. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 3. Borsukevych L.M., Iemelianova S.M., Kolomiychuk V.P. Plant communities with the dominant Elaeagnus angustifolia in Ukraine: Classification and distribution. Biologia. 2023;78:1269–1314. doi: 10.1007/s11756-023-01370-1. [ DOI ] [ Google Scholar ] 4. Gamba G., Donno D., Mellano M.G., Riondato I., De Biaggi M., Randriamampionona D., Beccaro G.L. Phytochemical Characterization and Bioactivity Evaluation of Autumn Olive (Elaeagnus umbellata Thunb.) Pseudodrupes as Potential Sources of Health-Promoting Compounds. Appl. Sci. 2020;10:4354. doi: 10.3390/app10124354. [ DOI ] [ Google Scholar ] 5. Nazir N., Zahoor M., Nisar M. A review on traditional uses and pharmacological importance of genus Elaeagnus species. Bot. Rev. 2020;86:247–280. doi: 10.1007/s12229-020-09226-y. [ DOI ] [ Google Scholar ] 6. Kharlyngdoh E., Langstieh L.B., Shukla J.K., Bhardwaj P.K., Mukherjee P.K. High-Value Plants. Apple Academic Press; Oakville, ON, Canada: 2024. Elaeagnus latifolia L. (Elaeagnaceae): A Promising and Emerging High-Value Bioresource with Nutraceutical and Pharmaceutical Prospects; pp. 23–50. [ Google Scholar ] 7. Banerjee S., Islam S., Kar P., Sarkar I., Chattopadhyay A., Sen A. Phytochemical and metagenomic insights into the antioxidant and anticancer properties of Elaeagnus pyriformis wine. Food Saf. Health. 2024;3:100–114. doi: 10.1002/fsh3.12072. [ DOI ] [ Google Scholar ] 8. Bisi H., Bonnard M., Simon L., Morille M., Bégu S., Parrot I. Antioxidant capacity of an ethanolic extract of Elaeagnus x submacrophylla Servett. leaves. Heliyon. 2024;10:e28067. doi: 10.1016/j.heliyon.2024.e28067. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 9. Gao R., Hou J., Zhao R., Yang X., Hou X., Huo L., Hidayati S.N., Walck J.L. Seed dormancy and germination of a critically endangered plant, Elaeagnus mollis, on the Loess Plateau of China. Eur. J. For. Res. 2021;140:451–461. doi: 10.1007/s10342-020-01342-z. [ DOI ] [ Google Scholar ] 10. Qi Y., Li J., Chen C., Li L., Zheng X., Liu J., Zhu T., Pang C., Wang B., Chen M. Adaptive growth response of exotic Elaeagnus angustifolia L. to indigenous saline soil and its beneficial effects on the soil system in the Yellow River Delta, China. Trees. 2018;32:1723–1735. doi: 10.1007/s00468-018-1746-4. [ DOI ] [ Google Scholar ] 11. Farzaei M.H., Bahramsoltani R., Abbasabadi Z., Rahimi R. A comprehensive review on phytochemical and pharmacological aspects of Elaeagnus angustifolia L. J. Pharm. Pharmacol. 2015;67:1467–1480. doi: 10.1111/jphp.12442. [ DOI ] [ PubMed ] [ Google Scholar ] 12. Maimaiti A., Yunus Q., Iwanaga F., Mori N., Tanaka K., Yamanaka N. Effects of salinity on growth, photosynthesis, inorganic and organic osmolyte accumulation in Elaeagnus oxycarpa seedlings. Acta Physiol. Plant. 2014;36:881–892. doi: 10.1007/s11738-013-1466-8. [ DOI ] [ Google Scholar ] 13. Daniell H., Lin C.S., Yu M., Chang W.-J. Chloroplast genomes: Diversity, evolution, and applications in genetic engineering. Genome Biol. 2016;17:134. doi: 10.1186/s13059-016-1004-2. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 14. Zhang Y., Tian L., Lu C. Chloroplast gene expression: Recent advances and perspectives. Plant Commun. 2023;4:100611. doi: 10.1016/j.xplc.2023.100611. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 15. Dobrogojski J., Adamiec M., Luciński R. The chloroplast genome: A review. Acta Physiol. Plant. 2020;42:98. doi: 10.1007/s11738-020-03089-x. [ DOI ] [ Google Scholar ] 16. Duan L., Harris A.J., Su C., Zhang Z.-R., Arslan E., Ertuğrul K., Loc P.K., Hayashi H., Wen J., Chen H.-F. Chloroplast phylogenomics reveals the intercontinental biogeographic history of the Liquorice genus (Leguminosae: Glycyrrhiza) Front. Plant Sci. 2020;11:793. doi: 10.3389/fpls.2020.00793. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 17. Bolger A.M., Lohse M., Usadel B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30:2114–2120. doi: 10.1093/bioinformatics/btu170. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 18. Jin J., Yu W., Yang J., Song Y., Depamphilis C.W., Yi T.-S., Li D.-Z. GetOrganelle: A fast and versatile toolkit for accurate de novo assembly of organelle genomes. Genome Biol. 2020;21:241. doi: 10.1186/s13059-020-02154-5. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 19. Wick R.R., Schultz M.B., Zobel J., Holt K.E. Bandage: Interactive visualization of de novo genome assemblies. Bioinformatics. 2015;31:3350–3352. doi: 10.1093/bioinformatics/btv383. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 20. Tillich M., Lehwark P., Pellizzer T., Ulbricht-Jones E.S., Fischer A., Bock R., Greiner S. GeSeq–versatile and accurate annotation of organelle genomes. Nucleic Acids Res. 2017;45:W6–W11. doi: 10.1093/nar/gkx391. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 21. Kearse M., Moir R., Wilson A., Stones-Havas S., Cheung M., Sturrock S., Buxton S., Cooper A., Markowitz S., Duran C., et al. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 2012;28:1647–1649. doi: 10.1093/bioinformatics/bts199. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 22. Frazer K.A., Pachter L., Poliakov A., Rubin E.M., Dubchak I. VISTA: Computational tools for comparative genomics. Nucleic Acids Res. 2004;32:273–279. doi: 10.1093/nar/gkh458. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 23. Katoh K., Standley D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013;30:772–780. doi: 10.1093/molbev/mst010. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 24. Talavera G., Castresana J. Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Syst. Biol. 2007;56:564–577. doi: 10.1080/10635150701472164. [ DOI ] [ PubMed ] [ Google Scholar ] 25. Posada D., Crandall K.A. Evaluation of methods for detecting recombination from DNA sequences: Computer simulations. Proc. Natl. Acad. Sci. USA. 2001;98:13757–13762. doi: 10.1073/pnas.241370698. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 26. Minh B.Q., Schmidt H.A., Chernomor O., Schrempf D., Woodhams M.D., Von Haeseler A., Lanfear R. IQ-TREE 2: New models and efficient methods for phylogenetic inference in the genomic era. Mol. Biol. Evol. 2020;37:1530–1534. doi: 10.1093/molbev/msaa015. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 27. Hoang D.T., Chernomor O., Von Haeseler A., Minh B.Q., Vinh L.S. UFBoot2: Improving the ultrafast bootstrap approximation. Mol. Biol. Evol. 2018;35:518–522. doi: 10.1093/molbev/msx281. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 28. Wang R., Wang X., Liu Z., Han Y., Xie Q. Comparative chloroplast genome analysis of four Hippophae rhamnoides subspecies and its phylogenetic analysis. Genet. Resour. Crop Evol. 2024;71:2557–2571. doi: 10.1007/s10722-023-01788-1. [ DOI ] [ Google Scholar ] 29. Zhou W., Dong Q., Wang H., Hu N. Characterization of the complete chloroplast genome of Hippophae tibetana. Mitochondrial DNA Part B. 2020;5:593–594. doi: 10.1080/23802359.2019.1710595. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 30. Wang L., Wang J., He C., Zhang J., Zeng Y. Characterization and comparison of chloroplast genomes from two sympatric Hippophae species (Elaeagnaceae) J. For. Res. 2021;32:307–318. doi: 10.1007/s11676-019-01079-5. [ DOI ] [ Google Scholar ] 31. Šmarda P., Bureš P., Horová L., Leitch I.J., Mucina L., Pacini E., Tichý L., Grulich V., Rotreklová O. Ecological and evolutionary significance of genomic GC content diversity in monocots. Proc. Natl. Acad. Sci. USA. 2014;111:E4096–E4102. doi: 10.1073/pnas.1321152111. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 32. Liere K., Weihe A., Börner T. The transcription machineries of plant mitochondria and chloroplasts: Composition, function, and regulation. J. Plant Physiol. 2011;168:1345–1360. doi: 10.1016/j.jplph.2011.01.005. [ DOI ] [ PubMed ] [ Google Scholar ] 33. Ling Q., Huang W., Baldwin A., Jarvis P. Chloroplast biogenesis is regulated by direct action of the ubiquitin–proteasome system. Science. 2012;338:655–659. doi: 10.1126/science.1225053. [ DOI ] [ PubMed ] [ Google Scholar ] 34. Yan Z., Zhu S., Wang C., Feng Y., Lei Z., Liu X., Zheng F., Jiang W. Development of EST-SSR Markers and Population Genetic Analysis of Hemsleya zhejiangensis, an Endangered Species Endemic to Eastern China. Plant Mol. Biol. Rep. 2024;42:550–556. doi: 10.1007/s11105-024-01431-y. [ DOI ] [ Google Scholar ] 35. Ahmad A., Wang J.D., Pan Y.B., Sharif R., Gao S.J. Development and use of simple sequence repeats (SSRs) markers for sugarcane breeding and genetic studies. Agronomy. 2018;8:260. doi: 10.3390/agronomy8110260. [ DOI ] [ Google Scholar ] 36. Ma W., Wang P., Huang J., Zhang D., Yang W., Pan B., Shi W. The taxonomic relationship between Elaeagnus moorcroftii and E. angustifolia (Elaeagnaceae) based on morphological similarities and simple-sequence repeat markers. Nord. J. Bot. 2021;39:e03011. doi: 10.1111/njb.03011. [ DOI ] [ Google Scholar ] 37. Chen Y., Zheng Y., Shi G., Zhang D., Yang W., Pan B., Shi W. The complete chloroplast genome and phylogenetic analysis of Elaeagnus oldhamii (Elaeagnaceae) from Fujian, southeastern China. Mitochondrial DNA Part B. 2024;9:109–113. doi: 10.1080/23802359.2024.2305399. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Associated Data This section collects any data citations, data availability statements, or supplementary materials included in this article. Supplementary Materials biology-15-00590-s001.zip (66.4KB, zip) Data Availability Statement All data generated or analyzed during this study are included in this published article and its Supplementary Information Files . Articles from Biology are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI) ACTIONS View on publisher site PDF (6.3 MB) Cite Collections Permalink PERMALINK Copy RESOURCES Similar articles Cited by other articles Links to NCBI Databases Cite Copy Download .nbib .nbib Format: AMA APA MLA NLM Add to Collections Create a new collection Add to an existing collection Name your collection * Choose a collection Unable to load your collection due to an error Please try again Add Cancel Follow NCBI NCBI on X (formerly known as Twitter) NCBI on Facebook NCBI on LinkedIn NCBI on GitHub NCBI RSS feed Connect with NLM NLM on X (formerly known as Twitter) NLM on Facebook NLM on YouTube National Library of Medicine 8600 Rockville Pike Bethesda, MD 20894 Web Policies FOIA HHS Vulnerability Disclosure Help Accessibility Careers NLM NIH HHS USA.gov Back to Top