Skip to main content An official website of the United States government Here's how you know Here's how you know Official websites use .gov A .gov website belongs to an official government organization in the United States. Secure .gov websites use HTTPS A lock ( Lock Locked padlock icon ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites. Search Log in Dashboard Publications Account settings Log out Search… Search NCBI Primary site navigation Search Logged in as: Dashboard Publications Account settings Log in Search PMC Full-Text Archive Search in PMC Journal List User Guide PERMALINK Copy As a library, NLM provides access to scientific literature. Inclusion in an NLM database does not imply endorsement of, or agreement with, the contents by NLM or the National Institutes of Health. Learn more: PMC Disclaimer | PMC Copyright Notice Plants (Basel) . 2026 Mar 30;15(7):1055. doi: 10.3390/plants15071055 Search in PMC Search in PubMed View in NLM Catalog Add to search Cloning and Functional Analysis of the SiMAPKKK17 Gene in Foxtail Millet ( Setaria italica ) Xinwei Xue Xinwei Xue 1 College of Agronomy, Iner Mongolia Agricultural University, Hohhot 010018, China; [email protected] 2 Chifeng Academy of Agricultural and Animal Husbandry Sciences, Chifeng 024031, China; [email protected] (A.M.); [email protected] (F.Y.); [email protected] (J.Z.); [email protected] (S.Z.); [email protected] (D.L.); [email protected] (L.H.); [email protected] (L.Z.); [email protected] (Y.Z.) Conceptualization, Software, Formal analysis, Investigation, Resources, Data curation, Writing – original draft Find articles by Xinwei Xue 1, 2 , Ankang Mu Ankang Mu 2 Chifeng Academy of Agricultural and Animal Husbandry Sciences, Chifeng 024031, China; [email protected] (A.M.); [email protected] (F.Y.); [email protected] (J.Z.); [email protected] (S.Z.); [email protected] (D.L.); [email protected] (L.H.); [email protected] (L.Z.); [email protected] (Y.Z.) Software, Visualization Find articles by Ankang Mu 2 , Fan Yang Fan Yang 2 Chifeng Academy of Agricultural and Animal Husbandry Sciences, Chifeng 024031, China; [email protected] (A.M.); [email protected] (F.Y.); [email protected] (J.Z.); [email protected] (S.Z.); [email protected] (D.L.); [email protected] (L.H.); [email protected] (L.Z.); [email protected] (Y.Z.) Methodology, Investigation, Data curation Find articles by Fan Yang 2 , Jialin Zhang Jialin Zhang 2 Chifeng Academy of Agricultural and Animal Husbandry Sciences, Chifeng 024031, China; [email protected] (A.M.); [email protected] (F.Y.); [email protected] (J.Z.); [email protected] (S.Z.); [email protected] (D.L.); [email protected] (L.H.); [email protected] (L.Z.); [email protected] (Y.Z.) Methodology, Data curation, Investigation Find articles by Jialin Zhang 2 , Shi Zhang Shi Zhang 2 Chifeng Academy of Agricultural and Animal Husbandry Sciences, Chifeng 024031, China; [email protected] (A.M.); [email protected] (F.Y.); [email protected] (J.Z.); [email protected] (S.Z.); [email protected] (D.L.); [email protected] (L.H.); [email protected] (L.Z.); [email protected] (Y.Z.) Visualization Find articles by Shi Zhang 2 , Dan Liu Dan Liu 2 Chifeng Academy of Agricultural and Animal Husbandry Sciences, Chifeng 024031, China; [email protected] (A.M.); [email protected] (F.Y.); [email protected] (J.Z.); [email protected] (S.Z.); [email protected] (D.L.); [email protected] (L.H.); [email protected] (L.Z.); [email protected] (Y.Z.) Investigation, Visualization Find articles by Dan Liu 2 , Lei He Lei He 2 Chifeng Academy of Agricultural and Animal Husbandry Sciences, Chifeng 024031, China; [email protected] (A.M.); [email protected] (F.Y.); [email protected] (J.Z.); [email protected] (S.Z.); [email protected] (D.L.); [email protected] (L.H.); [email protected] (L.Z.); [email protected] (Y.Z.) Data curation Find articles by Lei He 2 , Liyan Zhang Liyan Zhang 2 Chifeng Academy of Agricultural and Animal Husbandry Sciences, Chifeng 024031, China; [email protected] (A.M.); [email protected] (F.Y.); [email protected] (J.Z.); [email protected] (S.Z.); [email protected] (D.L.); [email protected] (L.H.); [email protected] (L.Z.); [email protected] (Y.Z.) Methodology Find articles by Liyan Zhang 2 , Yushan Zhao Yushan Zhao 2 Chifeng Academy of Agricultural and Animal Husbandry Sciences, Chifeng 024031, China; [email protected] (A.M.); [email protected] (F.Y.); [email protected] (J.Z.); [email protected] (S.Z.); [email protected] (D.L.); [email protected] (L.H.); [email protected] (L.Z.); [email protected] (Y.Z.) Project administration Find articles by Yushan Zhao 2 , Yongping Zhang Yongping Zhang 1 College of Agronomy, Iner Mongolia Agricultural University, Hohhot 010018, China; [email protected] Funding acquisition, Project administration, Supervision, Writing – review & editing Find articles by Yongping Zhang 1, * , Xianrui Wang Xianrui Wang 2 Chifeng Academy of Agricultural and Animal Husbandry Sciences, Chifeng 024031, China; [email protected] (A.M.); [email protected] (F.Y.); [email protected] (J.Z.); [email protected] (S.Z.); [email protected] (D.L.); [email protected] (L.H.); [email protected] (L.Z.); [email protected] (Y.Z.) Funding acquisition, Project administration, Resources Find articles by Xianrui Wang 2, * Editor: Igor G Loskutov Author information Article notes Copyright and License information 1 College of Agronomy, Iner Mongolia Agricultural University, Hohhot 010018, China; [email protected] 2 Chifeng Academy of Agricultural and Animal Husbandry Sciences, Chifeng 024031, China; [email protected] (A.M.); [email protected] (F.Y.); [email protected] (J.Z.); [email protected] (S.Z.); [email protected] (D.L.); [email protected] (L.H.); [email protected] (L.Z.); [email protected] (Y.Z.) * Correspondence: [email protected] (Y.Z.); [email protected] (X.W.) Roles Xinwei Xue : Conceptualization, Software, Formal analysis, Investigation, Resources, Data curation, Writing – original draft Ankang Mu : Software, Visualization Fan Yang : Methodology, Investigation, Data curation Jialin Zhang : Methodology, Data curation, Investigation Shi Zhang : Visualization Dan Liu : Investigation, Visualization Lei He : Data curation Liyan Zhang : Methodology Yushan Zhao : Project administration Yongping Zhang : Funding acquisition, Project administration, Supervision, Writing – review & editing Xianrui Wang : Funding acquisition, Project administration, Resources Igor G Loskutov : Academic Editor Received 2026 Feb 3; Revised 2026 Mar 18; Accepted 2026 Mar 18; Collection date 2026 Apr. © 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license . PMC Copyright notice PMCID: PMC13074924 PMID: 41977714 Abstract Mitogen-activated protein kinase kinase kinases (MAPKKKs) play important roles in plant responses to abiotic stresses; however, the function of SiMAPKKK17 in mediating drought tolerance in foxtail millet remains unclear. In this study, the expression pattern, subcellular localization, and biological function of SiMAPKKK17 were investigated to clarify its role in the drought stress response. Tissue expression analysis showed that SiMAPKKK17 was expressed across developmental stages and in multiple organs, with the highest transcript level observed at the booting stage and comparatively higher expression in vegetative tissues, including roots, stems, and leaves. Subcellular localization analysis demonstrated that SiMAPKKK17 was localized to both the plasma membrane and the nucleus, suggesting potential involvement in membrane-associated signal transduction and nuclear regulatory processes. To evaluate its function, foxtail millet lines overexpressing SiMAPKKK17 were generated and subjected to drought stress. Compared with wild-type plants, the overexpression lines exhibited enhanced drought tolerance, as indicated by greener and more upright upper leaves, higher aboveground fresh weight, greater plant height, and larger leaf area under drought conditions. Transcriptome analysis of OE4 and WT plants under drought stress identified 3919 upregulated genes and 2965 downregulated genes in OE4 compared with WT. These differentially expressed genes were mainly enriched in chloroplast-related cellular components, as well as biological processes and metabolic pathways related to cellular amide metabolism, ion transport, carbon metabolism, photosynthesis, carbon fixation, purine metabolism, and amino acid biosynthesis. Taken together, these results indicate that SiMAPKKK17 acts as a positive regulator of drought tolerance in foxtail millet, potentially through modulation of photosynthesis- and metabolism-related pathways. This study provides evidence for the molecular mechanisms underlying drought tolerance in foxtail millet and identifies SiMAPKKK17 as a promising candidate gene for the development of drought-resistant cultivars. Keywords: foxtail millet, SiMAPKKK17 , gene cloning, drought stress, functional analysis 1. Introduction Drought is one of the major abiotic stresses affecting crop production, characterized by widespread occurrence and prolonged duration [ 1 , 2 , 3 ]. It significantly limits plant growth, development, and yield. According to statistics, drought has caused over 40% of global crop yield reductions or complete crop losses, and the range and severity of its impact continue to intensify, making it one of the most urgent environmental challenges affecting global food security [ 4 , 5 ]. Foxtail millet, a traditional cereal crop originating in China, exhibits high water-use efficiency, strong drought tolerance, and a rich and balanced nutritional composition. It is widely cultivated in arid and semi-arid regions characterized by insufficient heat accumulation and limited water resources and is regarded as a key crop for improving dietary diversity and supporting sustainable dryland agriculture [ 6 , 7 , 8 ]. Moreover, foxtail millet is a C4 species with a homologous diploid genome, a short growth period, and a relatively small genome, as well as abundant drought-resistance-related genetic resources, making it an important model species for research within the Poaceae family [ 9 , 10 , 11 ]. In recent years, gene cloning and functional studies in foxtail millet have developed rapidly, leading to the identification of multiple drought-related genes. For example, overexpression of SiARDP [ 12 ], SiATG8a [ 13 ], and SiWLIM2b [ 14 ] has been shown to improve the drought tolerance of foxtail millet. SiNAC18 enhances seed germination and antioxidant capacity under drought conditions by regulating the expression of key genes involved in the abscisic acid (ABA) signaling pathway and oxidative stress responses [ 15 ]. Similarly, SiMYB56 enhances drought tolerance in foxtail millet by regulating lignin biosynthesis and the abscisic acid (ABA) signaling pathway [ 16 ]. These findings indicate that the identification and functional characterization of stress-responsive regulatory genes remains an effective strategy for improving drought tolerance in foxtail millet. Mitogen-activated protein kinases (MAPKs) constitute a conserved “MAPKKK → MAPKK → MAPK” three-tier signaling cascade that converts extracellular signals into intracellular responses through sequential phosphorylation, thereby amplifying and transmitting stress signals. MAPKs function as central signaling hubs in crop responses to abiotic stresses such as drought [ 17 , 18 , 19 ]. Functional studies of MAPK family members have demonstrated their importance in drought tolerance across crops. In rice, overexpression of OsMAPK5 increased drought survival by approximately 40% [ 20 ]. In wheat, TaMAPK3 was upregulated under drought stress, and transgenic plants exhibited a 30% increase in proline content and a 25% increase in superoxide dismutase (SOD) activity, thereby significantly enhancing drought tolerance [ 21 ]. In maize, overexpression of ZmMAPK7 reduced chlorophyll degradation under drought, decreasing yield loss by 15–20% [ 22 ]. In cotton, GhMPK7 enhances drought tolerance by promoting the phosphorylation-dependent degradation of the abscisic acid (ABA) signaling negative regulator GhSDIRIP1 [ 23 ]. As critical upstream components of the MAPK cascade, MAPKKKs directly influence signal initiation and specificity. MAPKKKs perceive extracellular cues and activate downstream MAPKKs through mechanisms such as interactions with upstream regulators, autophosphorylation, and conformational changes. They subsequently phosphorylate conserved sites on MAPKKs to trigger the three-tiered kinase cascade. Under drought stress, MAPKKKs participate in drought signaling through the abscisic acid (ABA)-regulated MAP3K17/18–MKK3–MPK1/2/7/14 cascade in Arabidopsis , while the MAP3K18–MKK3 module positively regulates drought tolerance through ABA-mediated stomatal closure [ 24 ]. In rice, overexpression of OsDSM1 , a MAPKKK protein, enhances the activities of the peroxidases POX22.3 and POX8.1 , thereby maintaining reactive oxygen species (ROS) homeostasis and positively regulating drought tolerance [ 25 ]. In cotton, the GhMAP3K15–GhMKK4–GhMPK6 signaling cascade participates in drought-response signaling pathways and enhances drought tolerance by phosphorylating and activating the downstream GhWRKY59–GhDREB2 regulatory module via an abscisic acid (ABA)-independent pathway [ 26 ]. There have been no reports on the role of the foxtail millet MAPKKK gene SiMAPKKK17 in drought tolerance, and its regulatory mechanisms remain unclear. Based on previous transcriptome analyses of foxtail millet germplasm with different levels of drought tolerance, SiMAPKKK17 , a mitogen-activated protein kinase kinase kinase (MAPKKK) gene, was identified as a key candidate involved in the drought stress response. In this study, we cloned the SiMAPKKK17 gene encoding a protein kinase; analyzed its protein sequence, structural characteristics, and evolutionary relationships; and generated foxtail millet plants overexpressing SiMAPKKK17 via Agrobacterium-mediated transformation. The role of SiMAPKKK17 in the drought stress response was further elucidated through analysis of transgenic plants subjected to drought conditions, thereby providing a theoretical basis for the improvement and development of drought-resistant foxtail millet varieties. 2. Results 2.1. Cloning and Sequence Analysis of the SiMAPKKK17 Gene Sequence analysis revealed that SiMAPKKK17 is a typical MAPKKK protein with a highly conserved kinase domain compared with its homologs from representative Poaceae species ( Figure 1 A). Multiple sequence alignment showed that the ATP-binding site and catalytic motifs were highly conserved among these proteins, indicating strong evolutionary conservation of kinase activity ( Figure 1 A). Three-dimensional structure prediction further suggested that SiMAPKKK17 adopts the canonical bilobal structure characteristic of protein kinases, with a compact kinase core and a relatively extended variable region ( Figure 1 B). To further examine its evolutionary conservation, synteny analysis was performed at both the genome-wide and local genomic locus levels. The overview comparison revealed extensive collinearity between foxtail millet and other representative plant species, including maize, rice, and Arabidopsis ( Figure 1 C, left). More importantly, local synteny analysis focusing on the genomic region surrounding SiMAPKKK17 revealed conserved collinear relationships between the SiMAPKKK17 locus on foxtail millet chromosome 5 and the corresponding syntenic regions on maize chromosome 3 and rice chromosome 1 ( Figure 1 C, right), indicating that the genomic context of SiMAPKKK17 is conserved among species of the Poaceae family. Conserved domain analysis showed that SiMAPKKK17 contains a typical STKc_MAPKKK kinase domain and a coiled-coil region, consistent with the structural characteristics of MAPKKK family proteins ( Figure 1 D). Phylogenetic analysis demonstrated that SiMAPKKK17 clusters with homologous proteins from closely related Poaceae species, particularly maize and sorghum, with strong bootstrap support, indicating that SiMAPKKK17 is evolutionarily conserved within the Poaceae family ( Figure 1 D). 2.2. Expression of SiMAPKKK17 Gene in Different Organs of Foxtail Millet Tissue expression analysis revealed that SiMAPKKK17 exhibits distinct spatiotemporal expression patterns in foxtail millet, with detectable expression across multiple developmental stages and organs. As shown in Figure 2 , transcript levels were lowest during the germination and seedling stages, peaked at the booting stage, and subsequently declined during the flowering and maturation stages. Among different organs, SiMAPKKK17 transcript levels were significantly higher in vegetative tissues (roots, stems, and leaves) than in reproductive organs. Figure 1. Open in a new tab Sequence, structural, syntenic, and phylogenetic analyses of SiMAPKKK17 . ( A ) Multiple sequence alignment and conserved motif analysis of SiMAPKKK17 and homologous proteins from representative Poaceae species. Sequences were aligned using MAFFT and visualized using ESPript 3. ( B ) Predicted three-dimensional structure of the SiMAPKKK17 protein generated by SWISS-MODEL. ( C ) Synteny analysis of SiMAPKKK17 and related genomic regions. The left panel shows an overview of collinear relationships between the foxtail millet genome and the genomes of maize, rice, and Arabidopsis . The right panels show local synteny analysis of the genomic region containing SiMAPKKK17 in foxtail millet with the corresponding syntenic regions in maize and rice. Red lines indicate the collinear gene pair corresponding to SiMAPKKK17 , and gray lines indicate other homologous gene pairs in the surrounding regions. ( D ) Phylogenetic relationships and conserved domain organization of SiMAPKKK17 and related homologs. The phylogenetic tree was constructed using IQ-TREE 3 and visualized using iTOL. Conserved domains were identified using NCBI-CDD and visualized using TBtools(v2.400). Numbers at the nodes indicate branch support values. Figure 2. Open in a new tab Tissue-specific expression patterns of SiMAPKKK17 in foxtail millet at different developmental stages and in different organs, determined by qRT-PCR. Relative expression levels were normalized to the internal reference gene and are shown as mean. 2.3. Subcellular Localization of SiMAPKKK17 Protein The subcellular localization of SiMAPKKK17 in foxtail millet was initially predicted using the Plant-mPLoc web tool, which suggested that SiMAPKKK17 is predominantly localized in the nucleus. To validate this prediction, a pCAMBIA2300-GFP- SiMAPKKK17 fusion construct was generated and transiently expressed in N. benthamiana leaves, with the empty pCAMBIA2300-GFP vector serving as the control. As shown in Figure 3 , the GFP signal from the empty vector was distributed throughout the cell, whereas the fluorescence signal of SiMAPKKK17-GFP was enriched at the cell periphery and also detectable in the nucleus. Combined with plasmolysis assays, these results indicate that SiMAPKKK17 is localized to both the plasma membrane and the nucleus, suggesting its potential involvement in membrane-associated signal transduction and nuclear regulatory processes. Figure 3. Open in a new tab Subcellular localization of SiMAPKKK17 in Nicotiana benthamiana leaves. The pCAMBIA2300-GFP -SiMAPKKK17 fusion construct and the empty pCAMBIA2300-GFP vector were transiently expressed in N. benthamiana leaves by Agrobacterium-mediated infiltration. Fluorescence signals were observed 36–48 h after infiltration using confocal laser scanning microscopy (LSM 980, Carl Zeiss, Jena, Germany). GFP and mCherry signals were detected using the 488 nm and 561 nm channels, respectively. PIP2A-mCherry was used as the plasma membrane marker. For plasmolysis analysis, leaf tissues were treated with 1 M mannitol for approximately 10 min before imaging. Compared with the empty vector control, the SiMAPKKK17 -GFP signal was enriched at the cell periphery and also detected in the nucleus, indicating localization in the plasma membrane-associated region and nucleus. 2.4. Verification and Characterization of SiMAPKKK17 Overexpression Transgenic Lines The foxtail millet cultivar Ci846 was genetically transformed using an Agrobacterium-mediated callus infection method. The infected calli were screened on MS medium supplemented with hygromycin, and the transformation procedure is shown in Figure 4 A. Primers specific to the hygromycin resistance gene on the vector were designed, and PCR amplification followed by sequencing was performed using genomic DNA from resistant foxtail millet seedlings as the template. As shown in Figure 4 B, a 471 bp hygromycin resistance gene fragment was successfully amplified in both the positive control (plasmid) and the transgenic plants, whereas no amplification was detected in the wild type. In total, 14 hygromycin-resistant foxtail millet seedlings were obtained, indicating that the SiMAPKKK17 overexpression construct had been successfully introduced into foxtail millet plants. These results confirmed the successful generation of transgenic foxtail millet plants carrying the SiMAPKKK17 overexpression construct. The obtained transgenic lines were subsequently used for expression analysis and drought tolerance evaluation. Figure 4. Open in a new tab Construction of the SiMAPKKK17 Overexpression Vector and Genetic Transformation. ( A ) Transformation process of SiMAPKKK17 expression in millet. ( B ) PCR identification of transgenic foxtail millet plants using hygromycin resistance gene-specific primers. A specific 417 bp fragment was detected in positive transgenic plants and the plasmid positive control, but not in the wild type or water control. M, DNA marker; WT, wild type; H, water control; P, plasmid positive control; 1–14, transgenic foxtail millet lines. 2.5. Expression Verification and Phenotypic Analysis of SiMAPKKK17 Overexpression Lines Under Drought Stress To assess SiMAPKKK17 overexpression in transgenic foxtail millet, RT-PCR analysis was performed on wild-type (WT) foxtail millet cv. Ci846 and three transgenic lines (OE-3, OE-4, and OE-5). The results showed that SiMAPKKK17 transcript levels were lowest in WT, whereas all three overexpression lines exhibited markedly higher expression, with OE-5 displaying the highest transcript abundance ( Figure 5 ). Figure 5. Open in a new tab Relative expression levels of SiMAPKKK17 in wild-type and overexpression lines. Data are presented as mean ± SE ( n = 3 pots). Error bars indicate standard errors. Statistical significance was analyzed using IBM SPSS Statistics 26.0 by one-way ANOVA. Asterisks indicate significant differences compared with WT (** p < 0.01). Based on these results, WT and the overexpression lines were subjected to drought stress. Under normal conditions, no significant differences in growth were observed between the SiMAPKKK17 overexpression lines and wild-type (WT) foxtail millet plants. Under drought conditions, the upper leaves of WT plants showed severe wilting and necrosis, whereas the top three leaves of the overexpression lines remained green and upright ( Figure 6 A). Compared with WT, the above-ground fresh weight of OE-3, OE-4, and OE-5 increased by approximately 12.6%, 3.0%, and 23.0%, respectively ( Figure 6 B). Plant height increased by approximately 32.8%, 19.0%, and 74.5%, respectively ( Figure 6 C), and green leaf area increased by approximately 19.2%, 12.7%, and 33.4%, respectively ( Figure 6 D). Figure 6. Open in a new tab Phenotypic comparison of WT and SiMAPKKK17 overexpression lines under normal and drought conditions. ( A ) Phenotypic performance of WT and overexpression lines after drought treatment. ( B ) Above-ground fresh weight. ( C ) Plant height. ( D ) Green leaf area. Data are presented as mean ± SE ( n = 3 pots). Error bars indicate standard errors. Statistical significance was analyzed using IBM SPSS Statistics 26.0 by one-way ANOVA. Asterisks indicate significant differences compared with WT (* p < 0.05). 2.6. Transcriptome Analysis of Overexpressing Transgenic Seedling Leaves Under Drought Stress As shown in Figure 7 A, a volcano plot was used to visualize the distribution of differentially expressed genes (DEGs) between WT and OE4 under drought stress. Using |log 2 FC| ≥ 1 and an adjusted p -value < 0.05 as screening criteria, a total of 3919 upregulated and 2965 downregulated DEGs were identified in OE4 compared with WT. Hierarchical clustering analysis further revealed that WT and OE4 exhibited clearly distinct and opposite expression patterns, while biological replicates within each group showed high consistency ( Figure 7 B). Moreover, transcriptome analysis confirmed that the relative expression level of SiMAPKKK17 was significantly higher in the OE4 transgenic line than in WT ( Figure 7 C), validating the successful overexpression of SiMAPKKK17 and supporting its positive association with drought tolerance. Figure 7. Open in a new tab Differential Gene Expression and GO/KEGG Enrichment Analysis of SiMAPKKK17 Transgenic Lines and Wild-type Under Drought Stress. ( A ) Volcano Plot of Differentially Expressed Genes. ( B ) Heatmap of Differentially Expressed Genes. ( C ) The expression level of the MAPKKK gene calculated by FPKM ( n = 3, * p < 0.05). ( D ) GO Enrichment Plot of Differentially Expressed Genes. ( E ) KEGG Enrichment Plot of Differentially Expressed Genes. GO enrichment analysis indicated that the DEGs were primarily associated with cellular component terms related to chloroplast structures, including plastid stroma, chloroplast stroma, thylakoid, plastid thylakoid membrane, chloroplast thylakoid membrane, photosynthetic membrane, and chloroplast envelope. Regarding biological processes and molecular functions, the DEGs were mainly enriched in purine ribonucleotide biosynthetic processes, cellular amide metabolism, organophosphate metabolism, ion transport, nucleoside phosphate metabolism, and ion transmembrane transporter activity ( Figure 7 D). KEGG pathway enrichment analysis revealed that the DEGs were significantly enriched in pathways related to carbon metabolism, carbon fixation in photosynthetic organisms, ribosome, glycolate and dicarboxylate metabolism, fructose and mannose metabolism, purine metabolism, the pentose phosphate pathway, photosynthesis, glycerophospholipid metabolism, ether lipid metabolism, amino acid biosynthesis, pyruvate metabolism, one-carbon pool by folate, inositol phosphate metabolism, nucleotide metabolism, galactose metabolism, propanoate metabolism, glycolysis/gluconeogenesis, biosynthesis of nucleotide sugars, and arginine biosynthesis ( Figure 7 E). These results suggest that overexpression of SiMAPKKK17 may enhance drought tolerance by regulating genes involved in photosynthesis, carbon metabolism, nucleotide metabolism, and transport-related processes. 2.7. GSEA Was Conducted to Profile Shifts in GO and KEGG Pathways Associated with SiMAPKKK17 Overexpression To elucidate the molecular mechanisms underlying SiMAPKKK17 -mediated drought tolerance, Gene Set Enrichment Analysis (GSEA) was performed on GO terms and KEGG pathways. GO-based GSEA ( Figure 8 A) revealed that SiMAPKKK17 overexpression upregulated gene sets associated with ADP binding, cellulose biosynthetic processes, and signal recognition particle binding, indicating enhanced nucleotide binding activity and cell wall biosynthesis/reinforcement, which may confer structural resilience under water-deficit conditions. Conversely, gene sets related to response to water deprivation and DNA repair were downregulated, suggesting a modulation of canonical water-stress perception and damage-response pathways. KEGG-based GSEA ( Figure 8 B) showed upregulation of ribosome, one-carbon pool by folate, and DNA replication pathways, reflecting active protein synthesis, one-carbon metabolism, and cell proliferation essential for sustained growth under stress. Meanwhile, photosynthesis–antenna proteins and proteasome pathways were suppressed, implying a strategic resource reallocation from light harvesting toward stress-adaptive processes. Collectively, these results demonstrate that SiMAPKKK17 overexpression orchestrates broad transcriptional reprogramming—coordinating cell wall integrity, metabolic activity, and stress signaling—to enhance drought tolerance. Figure 8. Open in a new tab Gene Set Enrichment Analysis (GSEA) of SiMAPKKK17 -overexpressing plants. ( A ) GSEA of GO terms. ( B ) GSEA of KEGG pathways. NES > 1, normalized enrichment score; p < 0.05. 3. Discussion The MAPKKK family is a crucial upstream component of the MAPK signaling pathway, responsible for perceiving extracellular signals and activating downstream MAPKKs, thereby transmitting signals into the cell [ 27 , 28 , 29 ]. The plant MAPKKK family comprises numerous members and can be classified into three subfamilies—MEKK-like, RAF-like, and ZIK—based on kinase domain sequences and activation mechanisms. Among these, the RAF-like subfamily is commonly activated by second messengers (e.g., Ca 2+ and ROS) and hormones such as ABA and is critically involved in drought responses. Some RAF-like members can directly phosphorylate core ABA signaling components, such as SnRK2s [ 30 , 31 , 32 ]. Several studies have demonstrated the involvement of RAF-like MAPKKKs in abiotic stress responses. Collectively, these studies indicate that RAF-like MAPKKKs often function as upstream “signal relays” that convert ABA or second-messenger cues into downstream kinase activation, providing a mechanistic context for interpreting our SiMAPKKK17 results. For example, in wheat, TaHT1 (a RAF subfamily kinase) regulates drought tolerance through interaction with SnRK2.10 [ 33 ]. Similarly, drought- and ABA-responsive RAF-like MAPKKKs have been reported in crops such as cassava and maize, and overexpression of certain RAF-like kinases (e.g., MdRaf5) enhances drought tolerance in heterologous systems [ 34 , 35 , 36 ]. Together, these findings suggest that stress-induced expression and/or altered kinase signaling of RAF-like MAPKKKs is frequently associated with drought adaptation; however, the specific downstream outputs may differ across species and therefore require direct validation in foxtail millet. This study provides a systematic analysis of the sequence characteristics, evolutionary relationships, and protein structure of SiMAPKKK17 in foxtail millet. The protein consists of 486 amino acids, while its homologs range from 377 to 546 amino acids, indicating overall structural conservation with potential divergence in non-core regions. Domain analysis revealed that SiMAPKKK17 contains a conserved STKc_MAPKKK kinase domain enriched in ATP-binding and substrate phosphorylation sites, forming the catalytic core of the protein. Phylogenetic analysis clustered SiMAPKKK17 with MAPKKK17 homologs from Poaceae species (sorghum, maize, rice, and wheat) in Clade A, with high bootstrap support (0.773–0.935). The closest relationship was observed with sorghum SbMAPKKK17, consistent with their classification within the Panicoideae subfamily. Subcellular localization analysis demonstrated that SiMAPKKK17 is distributed in both the plasma membrane and nucleus. This dual localization supports a role in early stress- or ABA-associated signal relay at the membrane and subsequent regulation of nuclear outputs. Considering the established roles of RAF-like MAPKKKs in ABA and abiotic stress signaling, SiMAPKKK17 may function as a signaling bridge that transmits stress cues from the plasma membrane to the nucleus. Notably, the localization result does not by itself prove direct transcriptional control; rather, it supports a model in which SiMAPKKK17 could modulate nuclear gene expression via phosphorylation-dependent signaling, consistent with the transcriptional reprogramming observed in our overexpression lines. Based on these findings, we speculate that SiMAPKKK17 acts as a regulatory bridge in ABA- or drought-related pathways. While the kinase domain is conserved, variation in non-core regions may contribute to species-specific interactions and downstream outputs, underscoring the need for direct genetic and biochemical validation. MAPK cascades (MAPKKK → MAPKK → MAPK) function as central signal amplification modules that transmit drought signals to downstream transcriptional networks, thereby inducing stress-responsive gene expression and enhancing drought tolerance [ 37 , 38 , 39 ]. Recent studies indicate that MAPKKK17 and MAPKKK18 play conserved roles in drought responses, although the degree of functional conservation varies among species. Across diverse plants, genetic and network-based evidence supports MAPKKK17/18-related modules in drought- and ABA-responsive pathways, including MAPKKK18–MAPKK3 signaling in Arabidopsis , MAPKKK17 as a drought-network hub in rice, AIMK1-mediated regulation in pepper, and downstream MKK contributions to ABA accumulation and drought resistance in cotton [ 25 , 26 , 40 , 41 ]. These findings suggest that MAPKKK17/18 may function as upstream amplification nodes in drought signaling pathways. Combined with our phylogenetic placement of SiMAPKKK17 within Poaceae MAPKKK17 homologs, the literature supports—but does not guarantee—that SiMAPKKK17 could operate in a similar drought-associated signaling module in foxtail millet. Accordingly, the key question addressed by our overexpression analysis is whether elevating SiMAPKKK17 expression is sufficient to shift physiological and transcriptional drought responses toward enhanced stress tolerance. To validate its function, SiMAPKKK17 overexpression lines were generated in foxtail millet. Under drought conditions, WT plants exhibited severe wilting and necrosis of upper leaves, whereas OE-3, OE-4, and OE-5 maintained greener and more upright foliage. Compared with WT, the overexpression lines displayed increases of 12.86% in fresh weight, 42.08% in plant height, and 21.77% in green leaf area, indicating improved growth maintenance under stress. These phenotypes suggest that SiMAPKKK17 promotes drought tolerance primarily by sustaining growth and leaf greenness rather than solely activating damage-response pathways. Transcriptome analysis of OE-4 versus WT identified 4580 upregulated and 3299 downregulated genes. GO enrichment revealed that many DEGs were associated with chloroplast-related structures and ion transmembrane transport activity. KEGG pathway analysis indicated significant enrichment in photosynthesis, carbon fixation, carbon metabolism, the pentose phosphate pathway, ribosome, purine metabolism, and amino acid biosynthesis. The convergence of these pathways provides a mechanistic explanation for the greener-leaf phenotype, consistent with improved biomass retention and reduced stress-induced senescence. Notably, the “Plant MAPK signaling pathway” was not significantly enriched in KEGG analysis, likely reflecting that MAPK regulation is predominantly phosphorylation-driven and may not be fully captured by DEG-based enrichment, or that only a subset of MAPK components exhibits transcriptional changes under the tested conditions. RT-qPCR further confirmed higher SiMAPKKK17 expression in the overexpression lines, along with enhanced induction of MAPK-related and stress-responsive genes under drought. Together, the transcriptomic and RT-qPCR results support a model in which SiMAPKKK17 modulates drought responses by reshaping downstream transcriptional programs—particularly those linked to photosynthesis, metabolism, and ion transport—while the canonical MAPK cascade may be regulated primarily at the post-translational level. In summary, SiMAPKKK17 overexpression improves drought-associated growth maintenance in foxtail millet and induces broad transcriptional reprogramming of genes involved in photosynthesis, metabolism, and ion transport. However, the current evidence is largely based on overexpression and transcriptional outputs, so causality at the kinase-cascade level remains to be demonstrated. Additionally, some transcriptome changes may be secondary to improved growth status; thus, tracking early phosphorylation events will be essential to distinguish primary SiMAPKKK17 -dependent signaling from downstream physiological effects. Whether SiMAPKKK17 directly activates the canonical MAPK cascade through phosphorylation and its specific downstream targets requires further genetic and biochemical validation. Based on the phenotypic improvement and consistent transcriptomic shifts observed here, we conclude that SiMAPKKK17 functions as a positive regulator of drought tolerance in foxtail millet, likely acting upstream to coordinate stress-responsive signaling and downstream metabolic and physiological maintenance. Future studies employing loss-of-function mutants, MAPK activation assays, and identification of direct substrates and interacting partners will be critical to resolve the precise molecular mechanisms. 4. Materials and Methods 4.1. Plant Materials The drought-tolerant foxtail millet germplasm “JMK10” was used for cloning SiMAPKKK17 and is maintained in our laboratory. Foxtail millet germplasm Ci846 was employed for genetic transformation and drought tolerance evaluation and was kindly provided by Dr. Xianmin Diao’s research group at the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences. Nicotiana benthamiana was used for subcellular localization assays. Unless otherwise specified, plants used for comparative experiments were grown under identical controlled conditions and sampled at the same developmental stage. 4.2. Strains and Plasmids Escherichia coli DH5α was used for plasmid propagation. Agrobacterium tumefaciens EHA105 was employed for both transient expression in Nicotiana benthamiana and stable transformation of foxtail millet. The overexpression vector backbone pBWA(V)HU and the subcellular localization vector pCAMBIA2300-GFP were used in this study. For Agrobacterium selection, LB plates were supplemented with kanamycin (50 mg/L) and rifampicin (20 mg/L) and incubated at 28 °C for 48 h in the dark. 4.3. Cloning of SiMAPKKK17 Based on the published sequence of SiMAPKKK17 ( Seita.5G284400 ), gene-specific primers were designed ( Table 1 ). Total RNA was extracted from young leaves of JMK10 and reverse-transcribed into cDNA, which served as the template for PCR amplification of the SiMAPKKK17 coding sequence. The amplified fragment was verified by Sanger sequencing and subsequently used for vector construction. Table 1. Primer Sequences Used in This Study. Primer Name Sequence Application SiMAPKKK17 -F CAGTGGTCTCACAACATGGTGATGATGAAGCAGCTCCGG Gene cloning SiMAPKKK17 -R CAGTGGTCTCATACACTACCTTGCTAACGATGGTACGGC pBWA(V)HU- SiMAPKKK17 -F CCTGCCTTCATACGCTATTTATTTGCTTGG Vector construction pBWA(V)HU- SiMAPKKK17 -R GTACCCGATCCGGTGGACC Seita.5G284400 -F GCCATTAGCCAGGCCAGTTA RT-qPCR Seita.5G284400 -R GTTCCTGTTACAAGCACCGC Actin- F AAGGAGATCACTGCCCTTGC Actin -R TCCTGTGGACAATTGCTGGG Open in a new tab 4.4. Bioinformatics Analyses of SiMAPKKK17 The SiMAPKKK17 protein sequence was retrieved from Setaria-DB . Homologous proteins from representative Poaceae species were identified using NCBI BLASTP(2.15.0). Multiple sequence alignment was performed with MAFFT. Phylogenetic analysis was conducted using IQ-TREE 3(3.1.0) with automatic model selection, and branch support was estimated using 1000 ultrafast bootstrap replicates and 1000 SH-aLRT replicates. The resulting phylogenetic tree was visualized with iTOL(v6.x). The three-dimensional structure of SiMAPKKK17 was predicted using SWISS-MODEL server. Conserved domains were identified using NCBI-CDD and visualized with TBtools(v2.400), while conserved residues were displayed using ESPript 3. Collinearity analysis was performed using JCVI v1.6.4. 4.5. In Silico Tissue Expression Analysis Expression data for SiMAPKKK17 across different foxtail millet tissues and developmental stages were retrieved from Setaria-DB . Tissue-specific expression patterns were analyzed using the available database resources. 4.6. Subcellular Localization of SiMAPKKK17 Protein in N. benthamiana The coding sequence of SiMAPKKK17 was cloned into pCAMBIA2300-GFP to generate the fusion construct pCAMBIA2300-GFP-SiMAPKKK17, which was introduced into Agrobacterium tumefaciens EHA105 and confirmed by PCR and sequencing. For transient expression, Nicotiana benthamiana plants were grown for 4–5 weeks under a 16 h light/8 h dark photoperiod at 28 °C. Agrobacterium cultures harboring pCAMBIA2300-GFP- SiMAPKKK17 or the empty pCAMBIA2300-GFP vector were resuspended in infiltration buffer and adjusted to OD600 = 1.4. Acetosyringone was added to a final concentration of 150 μM, and the suspensions were incubated for 1–1.5 h prior to infiltration. Fully expanded leaves were infiltrated from the abaxial side using a needleless syringe. Fluorescence signals were observed 36–48 h post-infiltration using a Carl Zeiss LSM 980 confocal laser scanning microscope (Carl Zeiss, Germany). GFP was excited at 488 nm and detected at 495–523 nm, whereas mCherry was excited at 561 nm. PIP2A-mCherry was used as the plasma membrane marker. For plasmolysis analysis, infiltrated leaf tissues were treated with 1 M mannitol for approximately 10 min prior to imaging. 4.7. Construction of the Overexpression Vector pBWA(V)HU-SiMAPKKK17 The SiMAPKKK17 coding sequence was cloned into the pBWA(V)HU vector using Golden Gate cloning. Positive recombinant clones were identified by colony PCR and confirmed by sequencing. The verified construct was introduced into Agrobacterium tumefaciens EHA105 for foxtail millet transformation. Briefly, 1 µL of plasmid DNA was added to 50 µL of competent EHA105 cells, mixed thoroughly, and transferred to an electroporation cuvette. Following electroporation, 1 mL of LB medium was added, mixed, and transferred to a 1.5 mL microcentrifuge tube for recovery at 30 °C with shaking at 180 rpm for 30 min. Subsequently, 50 µL of the recovered culture was spread evenly onto LB solid medium containing 50 mg/L kanamycin and 20 mg/L rifampicin and incubated in the dark at 28 °C for 48 h to select positive Agrobacterium colonies ( Figure 9 ). The resulting transformants were used for Agrobacterium-mediated foxtail millet transformation. Figure 9. Open in a new tab (V)HU- SiMAPKKK17 overexpression vector map. 4.8. Transformation of Agrobacterium and Generation of Transgenic Foxtail Millet The verified pBWA(V)HU- SiMAPKKK17 construct was introduced into Agrobacterium tumefaciens EHA105 and used for foxtail millet transformation. Agrobacterium-mediated transformation of foxtail millet (Ci846 background) was performed by Wuhan Boyuan Biotechnology Co., Ltd. (Wuhan, China) using an established protocol. Embryogenic calli derived from Ci846 were used as explants for transformation. The calli were infected with A. tumefaciens harboring the overexpression construct at an OD 600 of 0.1 for 10 min. Both the infection and co-cultivation media were supplemented with 0.02% ( w / v ) acetosyringone, and explants were co-cultivated for 3 d at 22 °C in the dark. Transformed tissues were selected using hygromycin (30 mg/L), and bacterial overgrowth was suppressed with cefotaxime (200 mg/L). Regeneration and rooting were carried out on appropriate media for approximately 20 d, after which regenerated plantlets were transferred to soil and grown to maturity. In this study, T 0 plants refer to the primary regenerated transformants, whereas T 1 plants represent the progeny grown from self-pollinated seeds of T 0 plants. The zygosity of T 1 plants was not determined. 4.9. Molecular Identification of Transgenic Plants Genomic DNA was extracted from foxtail millet leaves using the CTAB method. Transgenic plants were identified by PCR amplification of the hygromycin resistance gene ( hpt ) using the primers F: 5′-AAATCCGCGTGCACGAGGT-3′ and R: 5′-TCGTTATGTTTATCGGCACTTTGCA-3′. The pBWA(V)HU- SiMAPKKK17 plasmid served as the positive control, while WT Ci846 and ddH 2 O were used as negative controls. 4.10. Drought Tolerance Evaluation of Transgenic Foxtail Millet Plants Drought stress experiments were conducted using WT Ci846 and three SiMAPKKK17 overexpression lines (OE-3, OE-4, and OE-5). Seeds were surface-sterilized with 0.5% NaClO, rinsed three times with sterile water, and sown in 25-cm-diameter pots containing a 1:1 ( v / v ) mixture of nutrient soil and vermiculite. Plants were grown in a controlled chamber under a 10 h light/14 h dark photoperiod at 30 °C/26 °C. Drought treatment was initiated at the six-leaf stage. For each genotype, well-watered control and drought treatment groups were established. Control plants were maintained at 70% ± 10% soil moisture, whereas drought-treated plants received no additional watering after the final full irrigation. Soil relative moisture content was monitored daily by weighing. Leaf samples were collected 5 days after drought initiation, immediately frozen in liquid nitrogen, and stored at −80 °C. 4.10.1. Phenotypic Changes Above-ground fresh weight, plant height, and green leaf area were measured with three biological replicates per treatment. Plant height was determined using a ruler, and above-ground fresh weight was recorded after removal of roots. Green leaf area was estimated using the formula leaf length × leaf width × 0.75, with leaves retaining more than half of their area as green counted as green leaves. 4.10.2. Transcriptomic Measurement and Data Analysis Leaf samples from WT and the SiMAPKKK17 overexpression line OE-4 under drought treatment were subjected to RNA sequencing. RNA quality was assessed using Qubit 4.0 (Thermo Fisher Scientific, Waltham, MA, USA), NanoDrop (Thermo Fisher Scientific, Waltham, MA, USA), and an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Sequencing libraries were generated and sequenced on the DNBSEQ-T7 platform (MGI Tech Co., Ltd., Shenzhen, China). Raw reads were filtered with fastp(v0.21.0) and aligned to the foxtail millet reference genome using HISAT2(v2.1.0), and read counts were obtained using featureCounts(v2.0.8). Differential expression analysis was performed with DESeq2(v1.30.1), with differentially expressed genes (DEGs) defined as padj < 0.05 and |log 2 FC| ≥ 1. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were conducted using clusterProfiler(v3.8.1). 4.10.3. qRT-PCR Quantitative real-time PCR (qRT-PCR) was performed to validate the expression of SiMAPKKK17 . Total RNA extraction and reverse transcription were conducted as described above. Gene-specific primers are listed in Table S1 . qPCR was carried out using AceQ qPCR SYBR Green Master Mix (Vazyme Biotech Co., Ltd., Nanjing, China) on a CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA). Relative expression levels were normalized to the foxtail millet Actin gene ( Seita.9G269800 ) and calculated using the 2 −ΔΔCt method. Three biological replicates were analyzed, each with three technical replicates. 4.11. Statistical Analysis Data are presented as mean ± standard deviation (SD). Statistical analyses were performed using GraphPad Prism 10.1.2. Comparisons between two groups were conducted using Student’s t -test, while multiple-group comparisons were analyzed by one-way ANOVA followed by Tukey’s multiple-comparison test. Differences were considered statistically significant at p < 0.05. 5. Conclusions In this study, SiMAPKKK17 was identified as a positive regulator of drought tolerance in foxtail millet. Subcellular localization analysis revealed that the protein is distributed in both the plasma membrane and the nucleus. Functional characterization demonstrated that overexpression of SiMAPKKK17 significantly enhanced drought tolerance, with transgenic lines exhibiting improved growth maintenance under drought stress. Transcriptome and qRT-PCR analyses further indicated that SiMAPKKK17 overexpression is associated with altered expression of genes involved in ion transport, chloroplast function, and metabolic homeostasis. Collectively, these findings provide new evidence for the role of SiMAPKKK17 in drought adaptation in foxtail millet. Nevertheless, the precise downstream mechanisms through which SiMAPKKK17 regulates drought responses remain to be elucidated. Supplementary Materials The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/plants15071055/s1 . plants-15-01055-s001.zip (92.2KB, zip) Author Contributions Conceptualization, X.X.; methodology, F.Y., J.Z. and L.Z.; software, X.X. and A.M.; formal analysis, X.X.; investigation, X.X., F.Y., J.Z. and D.L.; resources, X.X. and X.W.; data curation, X.X., F.Y., J.Z. and L.H.; writing—original draft preparation, X.X.; writing—review and editing, Y.Z. (Yongping Zhang); visualization, A.M., D.L. and S.Z.; supervision, Y.Z. (Yongping Zhang); project administration, Y.Z. (Yongping Zhang), Y.Z. (Yushan Zhao) and X.W.; funding acquisition, Y.Z. (Yongping Zhang) and X.W. All authors have read and agreed to the published version of the manuscript. Data Availability Statement The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors. Conflicts of Interest The authors declare no conflicts of interest. Funding Statement This study was supported by Inner Mongolia Natural Science Fund (2025QN03146), National Millet Crops Research and Development System (CARS-06-14.5-A6), Minor Grain Crops Research and Development System of Inner Mongolia Province (2023–2027) and Inner Mongolia Autonomous Region Breeding Joint Research Project (YZ2023007). Footnotes Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. References 1. Huang J., Yu H., Dai A., Wei Y., Kang L. Drylands face potential threat under 2 °C global warming target. Nat. Clim. Change. 2017;7:417–422. doi: 10.1038/nclimate3275. [ DOI ] [ Google Scholar ] 2. Toulotte J.M., Pantazopoulou C.K., Sanclemente M.A., Voesenek L.A.C.J., Sasidharan R. Water stress resilient cereal crops: Lessons from wild relatives. J. Integr. Plant Biol. 2022;64:412–430. doi: 10.1111/jipb.13222. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 3. Shi W., Wang M., Liu Y. Crop yield and production responses to climate disasters in China. Sci. Total Environ. 2021;750:141147. doi: 10.1016/j.scitotenv.2020.141147. [ DOI ] [ PubMed ] [ Google Scholar ] 4. Liu Y., Wang F., Zhang Z.T., Huang C.F., Chen X., Li N. Comprehensive assessment of “climate change-crop yield-economic impact” in seven sub-regions of China. Clim. Change Res. 2021;17:455–465. doi: 10.12006/j.issn.1673-1719.2020.222. [ DOI ] [ Google Scholar ] 5. Chen S., Zhao W.W., Han Y. Spatio-temporal variation of vegetation precipitation use efficiency and influencing factors in arid and semi-arid areas of China. Acta Ecol. Sin. 2023;43:10295–10307. doi: 10.20103/j.stxb.202306141271. [ DOI ] [ Google Scholar ] 6. He Q., Tang S., Zhi H., Chen J., Zhang J., Liang H., Alam O., Li H., Zhang H., Xing L., et al. A graph-based genome and pan-genome variation of the model plant Setaria. Nat. Genet. 2023;55:1232–1242. doi: 10.1038/s41588-023-01423-w. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 7. Diao X.M. Basic Research Promoting Scientific Innovation for Traditional Chinese Cereals, Foxtail Millet and Common Millet. Sci. Agric. Sin. 2016;49:3260–3262. doi: 10.3864/j.issn.0578-1752.2016.17.001. [ DOI ] [ Google Scholar ] 8. Guo S., Xia X.Y., Cui J.H., Liu M., Xiao N.Y., Lu Y.W., Liu H.S., Zhao W.Q., Li S.G. Correlation Analysis and Evaluation of the Production Performance and Nutritional Value of Different Summer Planted Forage Millet Varieties. Chin. J. Grassl. 2021;43:60–70. doi: 10.16742/j.zgcdxb.20210087. [ DOI ] [ Google Scholar ] 9. Jia G.Q., Diao X.M. Current Status and Perspectives of Innovation Studies Related to Foxtail Millet Seed Industry in China. Sci. Agric. Sin. 2022;55:653–665. doi: 10.3864/j.issn.0578-1752.2022.04.003. [ DOI ] [ Google Scholar ] 10. Yang Z., Zhang H., Li X., Shen H., Gao J., Hou S., Zhang B., Mayes S., Bennett M., Ma J., et al. A mini foxtail millet with an Arabidopsis-like life cycle as a C4 model system. Nat. Plants. 2020;6:1167–1178. doi: 10.1038/s41477-020-0747-7. [ DOI ] [ PubMed ] [ Google Scholar ] 11. Diao X.M. Progresses in Stress Tolerance and Field Cultivation Studies of Orphan Cereals in China. Sci. Agric. Sin. 2019;52:3943–3949. [ Google Scholar ] 12. Li C., Yue J., Wu X., Xu C., Yu J. An ABA-responsive DRE-binding protein gene from Setaria italica, SiARDP, the target gene of SiAREB, plays a critical role under drought stress. J. Exp. Bot. 2014;65:5415–5427. doi: 10.1093/jxb/eru302. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 13. Li W., Chen M., Zhong L., Liu J., Xu Z., Li L., Zhou Y.-B., Guo C.-H., Ma Y.-Z. Overexpression of the autophagy-related gene SiATG8a from foxtail millet (Setaria italica L.) confers tolerance to both nitrogen starvation and drought stress in Arabidopsis. Biochem. Biophys. Res. Commun. 2015;468:800–806. doi: 10.1016/j.bbrc.2015.11.035. [ DOI ] [ PubMed ] [ Google Scholar ] 14. Yang R., Chen M., Sun J.-C., Yu Y., Min D.-H., Chen J., Xu Z.-S., Zhou Y.-B., Ma Y.-Z., Zhang X.-H. Genome-wide analysis of LIM family genes in foxtail millet (Setaria italica L.) and characterization of the role of SiWLIM2b in drought tolerance. Int. J. Mol. Sci. 2019;20:1303. doi: 10.3390/ijms20061303. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 15. Dou H.N., Qin Y.H., Min D.H., Zhang X.H., Wang E.H., Diao X.M., Jia G.Q., Xu Z.S., Li L.C., Ma Y.Z., et al. Transcription Factor SiNAC18 Positively Regulates Seed Germination Under Drought Stress Through ABA Signaling Pathway in Foxtail Millet (Setaria italic L.) Sci. Agric. Sin. 2017;50:3071–3081. doi: 10.3864/j.issn.0578-1752.2017.16.002. [ DOI ] [ Google Scholar ] 16. Xu W., Tang W., Wang C., Ge L., Sun J., Qi X., He Z., Zhou Y., Chen J., Xu Z., et al. SiMYB56 confers drought stress tolerance in transgenic rice by regulating lignin biosynthesis and ABA signaling pathway. Front. Plant Sci. 2020;11:785. doi: 10.3389/fpls.2020.00785. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 17. Wu M., Wang S., Ma P., Li B., Hu H., Wang Z., Qiu Q., Qiao Y., Niu D., Lukowitz W., et al. Dual roles of the MPK3 and MPK6 mitogen-activated protein kinases in regulating Arabidopsis stomatal development. Plant Cell. 2024;36:4576–4593. doi: 10.1093/plcell/koae225. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 18. Tang D., Pei D., Zhang M., Hu X., Lu M., Li Z., Wang Y., Wang Y., Yang S., Gong Z. Phosphorylation-dependent activation of MAP4K1/2 by OST1 mediates ABA-induced stomatal closure in Arabidopsis. J. Integr. Plant Biol. 2025;67:2912–2928. doi: 10.1111/jipb.70030. [ DOI ] [ PubMed ] [ Google Scholar ] 19. Zhu Q., Shao Y., Ge S., Zhang M., Zhang T., Hu X., Liu Y., Walker J., Zhang S., Xu J. A MAPK cascade downstream of IDA–HAE/HSL2 ligand–receptor pair in lateral root emergence. Nat. Plants. 2019;5:414–423. doi: 10.1038/s41477-019-0396-x. [ DOI ] [ PubMed ] [ Google Scholar ] 20. Ye T., Wang H., Zhang L., Li X., Tu H., Guo Z., Gao T., Zhang Y., Ye Y., Li B., et al. A novel OsCRK14–OsRLCK57–MAPK signaling module activates OsbZIP66 to confer drought resistance in rice. Mol. Plant. 2025;18:1390–1408. doi: 10.1016/j.molp.2025.07.011. [ DOI ] [ PubMed ] [ Google Scholar ] 21. Jung W.J., Yoon J.S., Seo Y.W. TaMAPK3 phosphorylates TaCBF and TaICE and plays a negative role in wheat freezing tolerance. J. Plant Physiol. 2024;296:154233. doi: 10.1016/j.jplph.2024.154233. [ DOI ] [ PubMed ] [ Google Scholar ] 22. Tian M.-Z., Wang H.-F., Tian Y., Hao J., Guo H.-L., Chen L.-M., Wei Y.-K., Zhan S.-H., Yu H.-T., Chen Y.-F. ZmPHR1 contributes to drought resistance by modulating phosphate homeostasis in maize. Plant Biotechnol. J. 2024;22:3085–3098. doi: 10.1111/pbi.14431. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 23. Gao Z., Gao Y., Jia H., Wang W., Xue B., Su Y., Guo X., Wang C. The GhMPK7–GhSDIRIP1 module enhances drought tolerance in cotton by regulating ABA signaling. New Phytol. 2025;248:1351–1367. doi: 10.1111/nph.70497. [ DOI ] [ PubMed ] [ Google Scholar ] 24. Danquah A., De Zélicourt A., Boudsocq M., Neubauer J., Frei Dit Frey N., Leonhardt N., Pateyron S., Gwinner F., Tamby J.-P., Ortiz-Masia D., et al. Identification and characterization of an ABA-activated MAP kinase cascade in Arabidopsis thaliana. Plant J. 2015;82:232–244. doi: 10.1111/tpj.12808. [ DOI ] [ PubMed ] [ Google Scholar ] 25. Cui L., Song Y., Zhao Y., Gao R., Wang Y., Lin Q., Jiang J., Xie H., Cai Q., Zhu Y., et al. Nei 6 You 7075, a hybrid rice cultivar, exhibits enhanced disease resistance and drought tolerance traits. BMC Plant Biol. 2024;24:1252. doi: 10.1186/s12870-024-05998-2. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 26. Chen L., Zhang B., Xia L., Yue D., Han B., Sun W., Wang F., Lindsey K., Zhang X., Yang X. The GhMAP3K62–GhMKK16–GhMPK32 kinase cascade regulates drought tolerance by activating GhEDT1-mediated ABA accumulation in cotton. J. Adv. Res. 2023;51:13–25. doi: 10.1016/j.jare.2022.11.002. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 27. Kong Q., Qu N., Gao M., Zhang Z., Ding X., Yang F., Li Y., Dong O.X., Chen S., Li X., et al. The MEKK1–MKK1/MKK2–MPK4 kinase cascade negatively regulates immunity mediated by a mitogen-activated protein kinase kinase kinase in Arabidopsis. Plant Cell. 2012;24:2225–2236. doi: 10.1105/tpc.112.097253. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 28. Zhang M., Su J., Zhang Y., Xu J., Zhang S. Conveying endogenous and exogenous signals: MAPK cascades in plant growth and defense. Curr. Opin. Plant Biol. 2018;45:1–10. doi: 10.1016/j.pbi.2018.04.012. [ DOI ] [ PubMed ] [ Google Scholar ] 29. Wu J., Cao X., Sun X., Chen Y., Zhang P., Li Y., Ma C., Wu L., Liang X., Fu Q., et al. OsEL2 regulates rice cold tolerance by MAPK signaling pathway and ethylene signaling pathway. Int. J. Mol. Sci. 2025;26:1633. doi: 10.3390/ijms26041633. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 30. Sun Y., Wang C., Yang B., Wu F., Hao X., Liang W., Niu F., Yan J., Zhang H., Wang B., et al. Identification and functional analysis of mitogen-activated protein kinase kinase kinase (MAPKKK) genes in canola (Brassica napus L.) J. Exp. Bot. 2014;65:2171–2188. doi: 10.1093/jxb/eru092. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 31. Lin Z., Li Y., Zhang Z., Liu X., Hsu C.-C., Du Y., Sang T., Zhu C., Wang Y., Satheesh V., et al. A RAF-SnRK2 kinase cascade mediates early osmotic stress signaling in higher plants. Nat. Commun. 2020;11:613. doi: 10.1038/s41467-020-14477-9. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 32. Wang H., Wang Y., Sang T., Lin Z., Li R., Ren W., Shen X., Zhao B., Wang X., Zhang X., et al. Cell type-specific proteomics uncovers a RAF15-SnRK2.6/OST1 kinase cascade in guard cells. J. Integr. Plant Biol. 2023;65:2122–2137. doi: 10.1111/jipb.13536. [ DOI ] [ PubMed ] [ Google Scholar ] 33. Wang M., Li C., Wang J., Li Y., Zhang Y., Yang L., Zhang Y., Zhang J., Zhang Z., Yan W., et al. A Raf-like MAPKKK gene TaHT1 controls drought tolerance and primary root length in wheat. Plant Cell Environ. 2025;48:6524–6536. doi: 10.1111/pce.15624. [ DOI ] [ PubMed ] [ Google Scholar ] 34. Ye J., Yang H., Shi H., Wei Y., Tie W., Ding Z., Yan Y., Luo Y., Xia Z., Wang W., et al. The MAPKKK gene family in cassava: Genome-wide identification and expression analysis against drought stress. Sci. Rep. 2017;7:14939. doi: 10.1038/s41598-017-13988-8. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 35. Sun M., Xu Y., Huang J., Jiang Z., Shu H., Wang H., Zhang S. Global identification, classification, and expression analysis of MAPKKK genes: Functional characterization of MdRaf5 reveals evolution and drought-responsive profile in apple. Sci. Rep. 2017;7:13511. doi: 10.1038/s41598-017-13627-2. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 36. Liu Y., Zhou M., Gao Z., Ren W., Yang F., He H., Zhao J. RNA-seq analysis reveals MAPKKK family members related to drought tolerance in maize. PLoS ONE. 2015;10:e0143128. doi: 10.1371/journal.pone.0143128. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 37. Fujita Y. Abscisic acid and stress tolerance in plants. JIRCAS Newsl. Int. Collab. 2014;71:9. [ Google Scholar ] 38. Danquah A., De Zelicourt A., Colcombet J., Hirt H. The role of ABA and MAPK signaling pathways in plant abiotic stress responses. Biotechnol. Adv. 2014;32:40–52. doi: 10.1016/j.biotechadv.2013.09.006. [ DOI ] [ PubMed ] [ Google Scholar ] 39. Duan Y., Sun W., Wang Q., Cao L., Wang H., Hao J., Han Y., Liu C. Integrated transcriptomics and proteomics revealed that exogenous spermidine modulated signal transduction and carbohydrate metabolic pathways to enhance heat tolerance of lettuce. BMC Plant Biol. 2025;25:754. doi: 10.1186/s12870-025-06781-7. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 40. Kong X., Pan J., Zhang M., Xing X., Zhou Y., Liu Y., Li D., Li D. ZmMKK4, a novel group C mitogen-activated protein kinase kinase in maize (Zea mays), confers salt and cold tolerance in transgenic Arabidopsis. Plant Cell Environ. 2011;34:1291–1303. doi: 10.1111/j.1365-3040.2011.02329.x. [ DOI ] [ PubMed ] [ Google Scholar ] 41. Jeong S., Lim C.W., Lee S.C. The pepper MAP kinase CaAIMK1 positively regulates ABA and drought stress responses. Front. Plant Sci. 2020;11:720. doi: 10.3389/fpls.2020.00720. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Associated Data This section collects any data citations, data availability statements, or supplementary materials included in this article. Supplementary Materials plants-15-01055-s001.zip (92.2KB, zip) Data Availability Statement The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors. Articles from Plants are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI) ACTIONS View on publisher site PDF (7.8 MB) Cite Collections Permalink PERMALINK Copy RESOURCES Similar articles Cited by other articles Links to NCBI Databases Cite Copy Download .nbib .nbib Format: AMA APA MLA NLM Add to Collections Create a new collection Add to an existing collection Name your collection * Choose a collection Unable to load your collection due to an error Please try again Add Cancel Follow NCBI NCBI on X (formerly known as Twitter) NCBI on Facebook NCBI on LinkedIn NCBI on GitHub NCBI RSS feed Connect with NLM NLM on X (formerly known as Twitter) NLM on Facebook NLM on YouTube National Library of Medicine 8600 Rockville Pike Bethesda, MD 20894 Web Policies FOIA HHS Vulnerability Disclosure Help Accessibility Careers NLM NIH HHS USA.gov Back to Top