DRP1/DMNL-1-mediated mitochondrial fission augments Rickettsia parkeri replication in macrophages.

DRP1/DMNL-1-mediated mitochondrial fission augments Rickettsia parkeri replication in macrophages - PMC Skip to main content An official website of the United States government Here's how you know Here's how you know Official websites use .gov A .gov website belongs to an official government organization in the United States. Secure .gov websites use HTTPS A lock ( Lock Locked padlock icon ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites. Search Log in Dashboard Publications Account settings Log out Search… Search NCBI Primary site navigation Search Logged in as: Dashboard Publications Account settings Log in Search PMC Full-Text Archive Search in PMC Journal List User Guide PERMALINK Copy As a library, NLM provides access to scientific literature. Inclusion in an NLM database does not imply endorsement of, or agreement with, the contents by NLM or the National Institutes of Health. Learn more: PMC Disclaimer | PMC Copyright Notice Infect Immun . 2026 Mar 9;94(4):e00086-26. doi: 10.1128/iai.00086-26 Search in PMC Search in PubMed View in NLM Catalog Add to search DRP1/DMNL-1-mediated mitochondrial fission augments Rickettsia parkeri replication in macrophages Elliott Collins Elliott Collins 1 Vector-Borne Diseases Laboratory, Department of Pathobiological Sciences, Louisiana State University School of Veterinary Medicine, Baton Rouge, Louisiana, USA Data curation, Formal analysis, Investigation, Methodology Find articles by Elliott Collins 1, # , Natasha Kelly Natasha Kelly 1 Vector-Borne Diseases Laboratory, Department of Pathobiological Sciences, Louisiana State University School of Veterinary Medicine, Baton Rouge, Louisiana, USA Data curation, Formal analysis, Investigation, Validation Find articles by Natasha Kelly 1, # , Heather Green Heather Green 1 Vector-Borne Diseases Laboratory, Department of Pathobiological Sciences, Louisiana State University School of Veterinary Medicine, Baton Rouge, Louisiana, USA Data curation, Formal analysis, Investigation, Validation Find articles by Heather Green 1 , William Beavers William Beavers 2 Department of Pathobiological Sciences, Louisiana State University School of Veterinary Medicine, Baton Rouge, Louisiana, USA Formal analysis, Resources, Supervision, Validation Find articles by William Beavers 2 , Basel Abuaita Basel Abuaita 2 Department of Pathobiological Sciences, Louisiana State University School of Veterinary Medicine, Baton Rouge, Louisiana, USA Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Project administration, Supervision Find articles by Basel Abuaita 2 , Juan J Martinez Juan J Martinez 1 Vector-Borne Diseases Laboratory, Department of Pathobiological Sciences, Louisiana State University School of Veterinary Medicine, Baton Rouge, Louisiana, USA Data curation, Formal analysis, Investigation, Methodology, Project administration, Supervision, Validation Find articles by Juan J Martinez 1, ✉ Editor: Sunny Shin 3 Author information Article notes Copyright and License information 1 Vector-Borne Diseases Laboratory, Department of Pathobiological Sciences, Louisiana State University School of Veterinary Medicine, Baton Rouge, Louisiana, USA 2 Department of Pathobiological Sciences, Louisiana State University School of Veterinary Medicine, Baton Rouge, Louisiana, USA 3 University of Pennsylvania Perelman School of Medicine, Philadelphia, Pennsylvania, USA ✉ Address correspondence to Juan J. Martinez, [email protected] # Elliott Collins and Natasha Kelly contributed equally to this article. Author order was determined alphabetically. The authors declare no conflict of interest. # Contributed equally. Roles Elliott Collins : Data curation, Formal analysis, Investigation, Methodology Natasha Kelly : Data curation, Formal analysis, Investigation, Validation Heather Green : Data curation, Formal analysis, Investigation, Validation William Beavers : Formal analysis, Resources, Supervision, Validation Basel Abuaita : Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Project administration, Supervision Juan J Martinez : Data curation, Formal analysis, Investigation, Methodology, Project administration, Supervision, Validation Sunny Shin : Editor Received 2026 Feb 2; Accepted 2026 Feb 5; Collection date 2026 Apr. Copyright © 2026 Collins et al. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International license . PMC Copyright notice PMCID: PMC13081717  PMID: 41801000 Previous version available: This article is based on a previously available preprint posted on bioRxiv on June 25, 2025: " DRP1/DMNL-1-mediated mitochondrial fission augments Rickettsia parkeri replication in macrophages ". ABSTRACT Pathogenic Spotted Fever Group (SFG) Rickettsia species, including Rickettsia parkeri, replicate in endothelial cells and macrophages in vitro and during infections in murine models of disease. We demonstrated that infection of human macrophage-like cells with a related SFG Rickettsia , R. conorii , resulted in a significant increase in mitochondria-associated proteins. However, the role of mitochondrial functions in Rickettsia pathogenesis is unknown. Here, we found that R. parkeri exploits mitochondrial dynamics to promote intracellular replication in mouse and human macrophages by activating the mitochondrial fission regulator, the dynamin-related protein 1 (DRP1). R. parkeri proliferated in macrophages, which coincided with a significant increase in mitochondria fission, mitochondria content, and host cell ATP production, primarily due to mitochondrial respiration compared to uninfected cells. In addition, R. parkeri infection also led to a temporal increase in DRP1 serine phosphorylation that was dependent on rickettsial de novo protein synthesis. Importantly, R. parkeri growth was significantly impacted in DRP1-deficient macrophages. These results suggest that the modulation of mitochondrial fission, content, and function is important for replication and survival of pathogenic SFG Rickettsia species in macrophages. Our data highlight that hijacking mitochondrial dynamics and function is essential for intracellular replication of Rickettsia species and may be a shared mechanism utilized by related obligate intracellular pathogens for growth. KEYWORDS: mitochondria, DRP1, Rickettsia INTRODUCTION Rickettsia parkeri is a Spotted Fever Group (SFG) obligate intracellular Gram-negative human pathogen that is transmitted to humans through tick salivary contents during a blood meal. R. parkeri rickettsiosis is found primarily in the southeastern United States and is characterized as a less severe, but important form of rickettsiosis in humans compared to Rocky Mountain spotted fever (RMSF) caused by Rickettsia rickettsii ( 1 ). In addition, a related SFG Rickettsi a species, R. conorii , is the agent of Mediterranean spotted fever (MSF), which is endemic to Southern Europe, North Africa, and India ( 2 ). Early indications of SFG Rickettsia infections in humans are unremarkable and include headache, fever, and malaise. Soon after the tick bite, localized replication of rickettsiae at the inoculation site and ensuing tissue damage may give rise to a necrotic lesion, or eschar. Once established in the host, SFG Rickettsia were thought to primarily infect the endothelial lining of the vasculature and cause injury to the vascular endothelium and infiltration of perivascular mononuclear cells leading to vasodilation, an increase in fluid leakage into the interstitial space, and a characteristic dermal rash ( 3 , 4 ). However, recent data from our group and others have clearly demonstrated that other cell types including monocytes, macrophages, neutrophils, lymphocytes, and hepatocytes are heavily colonized during fatal infections in mammals ( 5 – 13 ). Dissemination of the bacteria in the mammalian host is associated with pulmonary edema, interstitial pneumonia, acute renal failure, liver failure, neurological manifestations, and other multi-organ disorders ( 14 ). Broad-spectrum antibiotics such as doxycycline can be used to clinically manage these infections; however, the window of efficacy for these therapies is narrow necessitating the need for the development of more efficacious anti-rickettsial therapies. Therefore, new therapeutic innovations are urgently needed, including host-based approaches to control rickettsial infections. R. parkeri infects recognized target cells such as endothelial cells and can infect circulating monocytes in the peripheral blood and in resident macrophages during infections in murine models of disease ( 6 , 7 , 15 ). PMA-differentiated THP-1 cells have been extensively utilized as model human macrophage cell line for previous studies involving intracellular pathogens such as Legionella pneumophila ( 16 ), Coxiella burnetii ( 17 ), Mycobacterium tuberculosis ( 18 ), and Chlamydia trachomatis ( 19 ). Using PMA-differentiated THP-1 cells as a model macrophage-like cell, we previously demonstrated that several mammalian pathogenic members of the SFG Rickettsia including R. conorii ( 20 ), R. rickettsii , R. parkeri , R. akari, and R. africae are capable of surviving and proliferating within these cells ( 21 ). Species that are not associated with disease in mammals, including R. bellii and R. montanensis, do not replicate in phagocytic cells and are rapidly killed in intracellular compartments containing lysosomal markers ( 20 , 21 ). These studies further supported the notion that pathogenic Rickettsia are not restricted to infecting the vascular endothelium and that other Rickettsia -host cell interactions are likely important in pathogenesis. To initially elucidate host cell pathways that are stimulated by Rickettsia species during infection of macrophages, we performed global transcriptome and proteome analyses of R. conorii -infected THP-1 macrophages over different time points of infection. These studies revealed that pathways predicted to be involved in establishing a hospitable intracellular environment for growth and survival are modulated to benefit rickettsial growth and survival. Overall, R. conorii infection drives the programming of macrophages toward an environment that permits the establishment of a replicative intracellular niche that is characterized, in part, by an accumulation of several enzymes of the tricarboxylic acid (TCA) cycle, oxidative phosphorylation (OXPHOS) fatty acid β-oxidation as well as several inner and outer membrane mitochondrial transporters. Increases in these mitochondrial proteins suggested that pathogenic SFG Rickettsia species may induce a stimulation of de novo mitochondrial biogenesis (mitogenesis), an increase in the oxidative capacity of mitochondria, and an increase in the β-oxidation of synthesized host cell fatty acids ( 22 , 23 ). To further support this hypothesis, we previously demonstrated that pharmacological inhibition of host cell de novo fatty acid synthesis and reduced expression of mammalian fatty acid synthase (FASN) greatly inhibited rickettsial growth within macrophages. In addition, pharmacological inhibition studies targeting key mammalian cell enzymes and pathways involved in lipid metabolism including triglyceride lipases (inhibited by Orlistat) and fatty acid β-oxidation (inhibited by Etomoxir) revealed that rickettsial growth was significantly diminished in these cells. Taken together, these studies suggested that the modulation of mitochondrial function to potentially provide ATP through OXPHOS and other important mitochondria-derived metabolites are critical events involved in the growth and survival of pathogenic Rickettsia species in mammalian phagocytic cells ( 22 – 25 ). While the important role(s) of modulating mitochondria function in macrophages by several intracellular pathogens including C. trachomatis , S. typhimurium , B. abortus , L. pneumophila, and L. monocytogenes has been well established ( 26 ), very little is known regarding the impact of these processes to the growth and survival of Rickettsia species and other obligate intracellular bacteria in macrophages. Murine immortalized bone marrow-derived macrophages (iBMDMs) exhibit characteristics of freshly isolated bone marrow-derived macrophages (BMDMs) in vitro , can be propagated indefinitely using the appropriate growth media, and have been successfully utilized to study pathogen-macrophage interactions for several intracellular bacterial pathogens ( 27 ). Using iBMDMs as a macrophage model and primary human monocyte-derived macrophages, we showed that R. parkeri can efficiently proliferate within these cells. R. parkeri infection of iBMDMs and primary human macrophages results in a significant disruption of mitochondrial networks, resembling mitochondrial fission. In addition, R. parkeri infection of macrophages results in significant increases in mitochondria content and stimulation of ATP production primarily through mitochondrial respiration. Furthermore, R. parkeri infection of iBMDMs leads to the hyper serine phosphorylation of a key regulator of mitochondrial dynamics (DRP1/DNM1L) that is dependent on rickettsial de novo protein synthesis suggesting that DRP1-mediated activation of mitochondrial fission may be an important event in the infection process. Indeed, inhibition of drp1 expression in iBMDMs diminishes the ability of R. parkeri to efficiently proliferate within these cells. Together, these results strongly indicate that initiation of DRP1-mediated mitochondrial dynamics plays an important role in the proliferation of R. parkeri during infection of mammalian macrophages. MATERIALS AND METHODS Cell lines, Rickettsia growth and purification African green monkey kidney epithelial cells (Vero) and L929 fibroblast cells were grown at 37°C/5%CO 2 in Dulbecco’s modified Eagle’s medium (DMEM; Corning) supplemented with 10% heat-inactivated fetal bovine serum (hiFBS, Biowest), 1× non-essential amino acids (Corning), and 0.5 mM sodium pyruvate (Corning). Murine immortalized bone marrow- derived macrophages (iBMDM) were grown in macrophage media (DMEM supplemented with 20% hiFBS and 30% filtered L929 supernatant) as previously described ( 27 ). Lentiviral knockdown of drp1 expression in iBMDMs and isolation of cell clones has been previously described ( 27 ). Rickettsia parkeri isolate Portsmouth was obtained from Dr. Christopher Paddock (US Center for Disease Control) ( 28 ), propagated in Vero cells in a humidified 5% CO 2 incubator at 34°C and purified as previously described ( 5 , 29 , 30 ). R. parkeri was used between passage 2 and passage 4 after being received in our laboratories at the LSU School of Veterinary Medicine. Differentiation of human primary macrophages Human blood samples were obtained from healthy volunteers from the clinical laboratory of Pennington Biomedical Research Center (LSU System, Baton Rouge, LA). The mononuclear cells (PBMCs) fraction was isolated by centrifuging the blood onto a Ficoll-Paque plus density gradient medium (Millipore Sigma, Cat# 17-1440-02). PBMCs were incubated at 37°C in 5% CO 2 and non-adherent cells were removed by extensive washing with PBS. Adherent cells were used to differentiate monocytes into macrophages by culturing the cells in purified human recombinant M-CSF (50 ng/mL, Biolegend, Cat# 574816) in DMEM supplemented with 20% heat-inactivated fetal bovine serum (FBS) for 6 days. Differentiated macrophages were used at 80% confluency, which was estimated to be 10 5 cells/well in 24 well plates. Antibodies and pharmacological inhibitors Anti-Rc PFA is a rabbit polyclonal antibody that recognizes multiple species of SFG rickettsiae, including R. parkeri , and was previously generated and described ( 5 , 31 ). Anti-Drp1 rabbit monoclonal antibody (cloneD6C7) was purchased from Cell Signaling Technologies. Anti-Drp1 Ser616 rabbit polyclonal antibody and anti-Complex I mouse monoclonal antibody (clone 18G12BC2) were purchased from Invitrogen. Alexa Fluor 488-conjugated goat anti-rabbit IgG, Alexa Fluor 546-conjugated goat anti-rabbit IgG, Alexa Fluor 546-conjugated goat anti-mouse IgG, Alexa Fluor 647-conjugated goat anti-mouse IgG, Alexa Fluor 546-phalloidin, Alexa Fluor 488 phalloidin, and DAPI (4′,6′-diamidino-2-phenylindole) were purchased from Thermo Scientific. Alendronate, a nitrogen-containing bisphosphonate (NBP), was purchased from Matrix Scientific (Columbia, SC). Analysis of R. parkeri growth dynamics Quantitative PCR Analysis of R. parkeri growth in macrophages was performed as previously described with slight modifications ( 20 ). Briefly, wild-type iBMDMs, drp1 -silenced iBMDMs, or primary human macrophages were seeded into 24-well plates in triplicate at a density of 5 × 10 5 per well. On the day of the experiment, cells were washed once in 1× Dulbecco’s modified phosphate-buffered saline (DPBS) and infected with R. parkeri at a multiplicity of infection (MOI) of 5 in prewarmed macrophage media. Plates were centrifuged at 300 × g for 5 min at room temperature to induce contact between rickettsiae and host cells and then incubated at 34°C in the presence of 5% CO 2 for the indicated time points. Cells were harvested by scraping into 1.0 mL of PBS and centrifuged to pellet cells at 900 × g for 5 min at room temperature. Total genomic DNA extractions were performed using the PureLink Genomic DNA Mini Kit (Thermo Fisher Scientific) following the manufacturer’s instructions. The growth of R. parkeri species determined via a quantitative PCR (qPCR) assay using a LightCycler 480 II (Roche) utilizing the PerfeCTa FastMixII system (QuantaBio) and the following parameters: 10 min at 95°C; 50 cycles of 95°C for 10 s, 58°C for 1 min, and 72°C for 1 s. This was followed by a cool-down cycle lasting 30 s at 40°C. Growth was assessed following the amplification of the rickettsial sca1 gene and the mammalian actin gene by calculating the ratio of sca1 to actin in each well as previously described ( 20 ). All experiments were performed using triplicate samples per condition and at least three independent biological experiments. Immunofluorescence microscopy Immunofluorescence microscopy analysis was also used to verify rickettsial growth within mammalian cells as previously described ( 20 ). Briefly, control iBMDMs, drp1 knockdown iBMDMs, or primary human macrophage cells were seeded at a density of 5 × 10 5 cells on sterilized glass coverslips in 24-well plates. Cells were infected with R. parkeri as described above, washed with 1× PBS, and subsequently fixed with 4% PFA in PBS for 20 min. In some experiments, iBMDMs were preincubated with alendronate (5 µM) for 1 h prior to infection, and the drug was maintained on the cells during the experiment as described ( 32 ). R. parkeri cells within macrophages were visualized by incubation in antibody incubation buffer (PBS/2% bovine serum albumin [BSA]) containing anti-Rc PFA (1 µg/mL), followed by incubation with either Alexa Fluor 488-conjugated goat anti-rabbit IgG (1:1,000) or Alexa Fluor 546-conjugated goat anti-rabbit IgG (1:1,000). Nuclei and the actin cytoskeleton were visualized by further incubation with DAPI (1:1,000) and Alexa Fluor 488-conjugated phalloidin (1:250) or Alexa Fluor 546 phalloidin (1:250), respectively. All coverslips were then washed in 1× PBS and then mounted onto glass slides using Mowiol mounting medium. Cells were then viewed and imaged using an Olympus Fluoview FV10i confocal microscope with a 40× oil immersion objective. Images were further processed using the Olympus cellSens Dimension software package and the NIH Image J software package and are presented as separate and merged channel images from the “maximum projection” function in the cellSens Dimension software suite. Flow cytometry Primary human macrophages, wild-type iBMDMs, and drp1 knockdown iBMDMs were seeded on 6-well plates at a density of 1 × 10 6 cells/well and incubated for 24 h at 37°C/5% CO 2. Triplicate wells were left un-infected or infected with R. parkeri at a MOI of 5 for 4, 24, and 48 h. In some experiments, iBMDMs were preincubated with alendronate (5 µM) or vehicle control (ddH 2 O) as described above. After each time point, cells were washed in 1× PBS, and each well was scraped into 1.0 mL of 1× PBS. Cells were pelleted by centrifugation at 900 × g at room temperature and then incubated in 250 µL of CytoFix/CytoPerm (BD Biosciences) at 4°C for 20 min to fix cells. After fixation, cells were washed twice in 1× Perm/Wash buffer (BD Biosciences) and stored in buffer at 4°C until processing for flow cytometry analysis. To detect R. parkeri in infected cells, control uninfected and R. parkeri -infected cells were incubated with 1 µg/mL of Anti-Rc PFA antibody for 1 h at room temperature in 1× Perm/Wash buffer. Cells were washed 3× in 1× Perm/Wash buffer and then incubated for an additional hour at room temperature in 1× Wash/Perm buffer containing Alexa Fluor 488-conjugated goat anti-rabbit IgG (1:1,000). Cells were washed in 1× Perm/Wash buffer and analyzed on a BD LSR Fortessa X-20 cytometer equipped with BD FACS DIVA analysis software. At least 10,000 cells were analyzed per sample, and the experiment was performed at least two independent times. Confocal microscopy and quantification of mitochondria fragmentation Primary human macrophages and iBMDMs were seeded at 5 × 10 5 cells per well in 24-well plates on sterile glass cover slips, allowed to adhere for 24 h at 37°C/5% CO 2 , and then infected with R. parkeri at a MOI of 5. Uninfected control cells and R. parkeri -infected cells were centrifuged at 300 × g for 5 min at room temperature to induce Rickettsia -host cell contact and incubated for 24 h at 34°C/5% CO 2 . Mammalian cells were washed with 1× PBS and then fixed in 4% paraformaldehyde (PFA) for 20 min prior to staining. Cells were permeabilized with PBS/0.05% Triton X-100 for 5 min at room temperature and incubated with the primary antibodies rabbit anti-Rc PFA (1 µg/mL) and mouse anti-Complex I (1 µg/mL) followed by the secondary antibodies Alexa Fluor 488-conjugated goat anti-rabbit IgG (1:1,000) and Alexa Fluor 546-conjugated goat anti-mouse IgG (1:1,000) and DAPI. The coverslips were mounted onto slides using Mowiol mounting medium, and images were obtained with the use of an Olympus Fluoview FV10i confocal microscope with a 40× or 100× oil immersion objective. Images were further processed using the Olympus cellSens Dimension software package and the NIH Image J software package. Mitochondrial fragmentation was quantified using ImageJ software based on similar criteria as previously described ( 27 ). Briefly, Complex I immunofluorescence images were converted to binary images, and then objects were outlined. Individual cells were manually selected based on DAPI and Complex I immunofluorescence stains. Mitochondrial objects were categorized as fragmented based on object size between 0.1 and 1 μm 2 . The numbers of fragmented mitochondria from each condition were enumerated per cell from at least 100 cells from three independent experiments. DRP1 immunoprecipitation and Western immunoblotting For immunoprecipitation experiments, R. parkeri infections were carried out as described above at an MOI of 5 for the indicated time points with minor modifications. R. parkeri cells were pre-incubated with vehicle control or 20 µg/mL chloramphenicol in macrophage media for 1 h at 34°C/5%CO 2 and then washed in PBS prior to infection of cells as described ( 25 ). Infected cells were washed in ice-cold 1× PBS, and 1% NP-40 detergent soluble lysates were generated from uninfected and infected cells as previously described ( 33 ). Detergent- soluble proteins were quantified by BCA assay, normalized for protein content, and immunoprecipitated using 2 µg/mL rabbit anti-DRP1 (clone D6C7) and 25 µL of 50% Protein A/G agarose. Immunoprecipitation reactions were washed in 1% NP-40 buffer and boiled in 25 µL of 2× SDS-PAGE sample buffer. Proteins were resolved on 4%–20% mini protein TGX gradient gels (BioRad), transferred to nitrocellulose membranes, and then blocked with 1× Tris-buffered saline (TBST) 2% BSA before incubation with anti-DRP1 ser616 (2 µg/mL) and anti-rabbit IgG-HRP conjugate (1:25,000). Proteins were revealed by incubation of membranes with SuperSignal West Pico chemiluminescence horseradish peroxidase substrate (Thermo Scientific) and exposure to film. Membranes were stripped with Restore stripping buffer, blocked again in 1× TBST/2%BSA, and reprobed with anti-DRP1 (clone D6C7, 2 µg/mL) and anti-rabbit IgG-HRP conjugate (1:25,000) to ensure equal protein content in each immunoprecipitation reaction. As a further control, generated detergent-soluble lysates were resolved on 4%–20% mini protein TGX gradient gels, transferred to nitrocellulose, and immunoblotted with anti-DRP1 (clone D6C7, 2 µg/mL) and anti-rabbit IgG-HRP conjugate as described above. Depicted western blots are representative of at least two independent biological experiments. Seahorse analysis The rate of ATP production from glycolysis (glycoATP) and mitochondrial respiration (mitoATP) was measured by Seahorse XF Real-Time ATP Rate Assay (Agilent, Cat# 103677-100) as previously described ( 27 ). NT-control and Drp1 KD macrophages were seeded onto Seahorse XF96 cell culture microplates at a density of 4 × 10 4 per well and cultured at 37℃ for 24 h. Media was replaced, and macrophages were left untreated (Mock) or infected with R. parkeri for 6, 24, and 48 h. As a control, macrophages were incubated with lipopolysaccharide (LPS; 500 ng/mL) for 6 h to stimulate glycolytic pathways. During the last hour of the experiment, macrophages were washed with the assay culture media and placed in a non-CO 2 incubator at 37℃ for 45 min. Media were further exchanged with fresh and warmed assay media. Oxygen consumption and extracellular acidification were monitored using the Seahorse XFe96 Analyzer. Data were analyzed by using the XF Real-Time ATP Rate Assay Report Generator to quantify the rate of ATP. Mitochondrial DNA quantification Macrophages were left uninfected or infected with R. parkeri for the indicated time points, were harvested by scraping, and resuspended into 200 μL of phosphate saline buffer. Total DNA was isolated using the DNeasy Blood and Tissue Kit (Qiagen). Nuclear and mitochondrial DNA in the samples were quantified by real-time PCR using the following primers: 18S forward (5′- TAGAGGGACAAGTGGCGTTC -3′); 18S reverse (5′- CGCTGAGCCAGTCAGTGT -3′); Cytochrome c oxidase 1 (MT-CO1) forward (5′- GCCCCAGATATAGCATTCCC -3′); MT-CO1 reverse (5′- GTTCATCCTGTTCCTGCTCC -3′). The abundance of mitochondrial DNA (MT-CO1) levels was normalized relative to untreated (Mock) macrophages and presented as a ratio. The Ct value of MT-CO1 was divided by the Ct value of 18S for each sample. Then, the relative abundance of mitochondrial DNA (MT-CO1) levels was calculated relative to the average ratio of MT-CO1/Nuclear of uninfected samples. RESULTS R. parkeri proliferates within murine and primary human macrophages We have previously demonstrated that SFG Rickettsia species, including R. conorii , R. prowazekii , and R. parkeri strain “Portsmouth” can efficiently invade into and proliferate within THP1-differentiated cells as a model for mammalian macrophages ( 21 ). However, the differentiation of THP-1 cells into macrophage-like cells requires stimulation with Phorbol Myristate Acetate (PMA), which may activate the cells and alter Rickettsia replication. Thus, we investigated whether murine immortalized bone marrow-derived macrophages (iBMDMs) can be used as an alternative macrophage model to study Rickettsia pathogenesis. These iBMDMs are an established model mammalian macrophage and have been previously utilized for the study of microbial pathogenesis and host defenses ( 27 ). We first sought to determine whether R. parkeri could invade into and replicate within the iBMDMs. The cells were infected with R. parkeri, and bacterial burden was measured by flow cytometry-based assay using anti- R . parkeri antibody. R. parkeri infection leads to a significant increase in the percent of infected macrophages and the mean fluorescence intensity over the time course of the experiment, indicating that the bacteria invade and replicate within these cells ( Fig. 1A and B ). We commonly use the quantitative PCR (qPCR)-based assay that directly measures R. parkeri DNA relative to host genomic DNA as indicative of intracellular bacterial loads ( 34 , 35 ). To establish whether the increase in fluorescence signals using the anti- R . parkeri antibody correlates with an increase in rickettsial loads, we utilized the qPCR-based growth assay to confirm R. parkeri growth within these macrophages ( Fig. 1C ). Similar to the flow cytometry data, we observed an increase in R. parkeri DNA over time, indicating that R. parkeri is replicating within the iBMDMs. We next visualized the infected cells by confocal microscopy and observed an increase in bacterial loads, especially at 48 h post-infection ( Fig. 1D ). Using the flow cytometry and fluorescence microscopy-based assays, we also confirmed that R. parkeri efficiently proliferates within primary human macrophages and that growth was not restricted to macrophages of murine origin ( Fig. 2 ). Taken together, these results confirm that the iBMDMs can be utilized as a model for the study of Rickettsia -macrophage interactions and that R. parkeri can efficiently proliferate within the mouse and human macrophages. Fig 1. Open in a new tab R. parkeri strain Portsmouth proliferates in immortalized murine bone marrow-derived macrophages (iBMDMs). Flow cytometry analyses demonstrate an increase in the percentage of cells infected and a corresponding increase in the mean fluorescence intensity (MFI) of R. parkeri infected cells over time ( A and B ). Q-PCR analysis confirms an increase in R. parkeri growth as a ratio of rickettsial genomic content ( sca1 ) over mammalian cell content ( actin ) ( C ). R. parkeri infected iBMDMs at 48 h post-infection reveal intact bacteria within iBMDMs. Actin (green), Rickettsia (red), nuclei (blue) ( D ). Statistically significant changes were determined using a one-way analysis of variance (ANOVA) with Bonferroni’s comparison post hoc test. n.s. = not significant, *** P < 0.0001. Scale bar = 5 µm in D. Fig 2. Open in a new tab R. parkeri proliferates within primary human monocyte-derived macrophages. ( A and B ) Flow cytometry analysis of R. parkeri growth in human primary macrophage demonstrates an increase in the percent of infected cells in the population ( A ) and Rickettsia specific fluorescence (mean fluorescence intensity, MFI) ( B ). Fluorescence microscopy analysis of R. parkeri infected human primary macrophages at 48 h post-infection ( C ). DAPI (blue), R. parkeri (red), actin (green). Scale bar = 5 µm. Statistically significant changes were determined via a Mann-Whitney test. ** P < 0.001. R. parkeri stimulates changes to macrophage mitochondrial architecture Infection of differentiated THP-1 macrophage-like cells with a related SFG Rickettsia species, R. conorii , led to a significant increase in several enzymes involved in the tricarboxylic acid (TCA) cycle, oxidative phosphorylation (OXPHOS), fatty acid β-oxidation, and glutaminolysis, as well as proteins involved in mitochondrial function ( 23 ). However, the beneficial consequences of altering these processes to R. parkeri replications remained unclear. Several intracellular bacterial pathogens, including L. pneumophila (vacuolar pathogen) and L. monocytogenes (cytoplasmic pathogen), manipulate the infected host cell mitochondrial network to promote intracellular replication. The function of mitochondria is influenced by changes in organelle morphology, quantity, and often localization. To determine if pathogenic Rickettsia species can also stimulate changes to mitochondrial morphology, we infected murine and primary human macrophages with R. parkeri for 48 h and assessed mitochondrial dynamics by immunofluorescence microscopy using anti-complex I antibody. R. parkeri infected mouse macrophages exhibited an increase in mitochondria fragmentation (fission) that had been previously observed for L. pneumophila in macrophages ( 36 ). Similar results were also observed in primary human macrophages infected with R. parkeri for 48 h ( Fig. 3C and D ). These results suggest that the modulation of mitochondria morphology may play an important role during infection of SFG Rickettsia species in mammalian macrophages. Fig 3. Open in a new tab R. parkeri induced mitochondrial dynamics in mammalian macrophages. Infection of iBMDMs and primary human macrophages drives significant changes in mitochondria morphology at 48 h post infection. ( A ) Representative confocal microscopy images of iBMDM ( B ) and primary human macrophages ( C ) when left uninfected (upper panels) or infected with R. parkeri (lower panels) for 48 h. Cells were stained with anti-RcPFA antibody (green), anti-Complex I antibody (red), and DAPI (gray) to label the DNA. Scale bar in ( A ) = 5 µm while the scale bar in C = 10 µm. Quantification of mitochondrial fragmentation in iBMDMs ( B ) and primary human macrophages ( D ) was performed on Complex I immunofluorescence images by using ImageJ software. The number of mitochondrial objects with a size between 0.1 and 1 μm² was enumerated per cell. A graph is presented as a box and whisker plot, showing the minimum and maximum number of mitochondrial objects per cell from at least 100 cells across n ≥ 3 independent experiments. Statistical significance was calculated using the Mann-Whitney test. **** P < 0.0001. R. parkeri drives increases in mitochondria content and mitochondria respiration in infected macrophages Infection of THP-1 macrophages with R. conorii led to a significant increase in the abundance of mitochondrial transporters including voltage-dependent ion channels 1–3 (VDAC1–3), solute carrier family 25 members 1, 3, 5, and 6 (SLC25A1, 3, 5, 6), translocase of outer mitochondrial membrane 22 and 40 (TOMM22 and TOMM44) along with an increase in proteins from Complex I (NDUFB8), Complex II (SDHB), Complex III (UQCRC2), and Complex IV (CoxII) ( 23 ). Increases in these mitochondrial proteins suggested that infection of phagocytic cells with a pathogenic SFG Rickettsia species would result in a stimulation of de novo mitochondrial biosynthesis (mitogenesis) and a corresponding increase in the oxidative capacity of mitochondria in infected cells. To determine if the previously observed changes in mitochondria-associated protein levels induced by SFG Rickettsia infection correspond to an increase in mitochondria content, we infected macrophages with R. parkeri and measured the levels of mitochondrial DNA at 24 and 72 h. Mitochondrial DNA in uninfected and infected cells was quantified by RT-qPCR relative to nuclear DNA as previously described ( 37 ). As shown in Fig. 4A , R. parkeri infection in iBMDMs leads to a significant increase in mitochondrial DNA abundance relative to uninfected cells at 24 and 72 h post infection, suggesting that mitochondrial contents increase during R. parkeri infection. Fig 4. Open in a new tab R. parkeri infection drives de novo mitochondrial biosynthesis and stimulates increases in ATP production via mitochondrial respiration and DRP1 serine phosphorylation. ( A ) qPCR analysis of uninfected (mock) or R. parkeri infected cells at 24 h (Rp 24 h) and 72 h (Rp 72 h) reveals a significant increase in mitochondrial DNA. Statistical significance was determined via a one-way ANOVA analysis with Bonferroni’s comparison post-hoc test, * P = 0.0286, *** P = 0.0001, and **** P < 0.0001. ( B ) Seahorse analysis of ATP production revealed significant changes in both glycolysis (blue) and mitochondrial respiration (red) at indicated times post-infection. LPS drives maximal ATP production via glycolysis and is used as a control. Statistical significance was established using a two-way ANOVA and Holm-Sidaks multiple comparison test. Only significant differences are indicated, * P = 0.0386, ### P = 0.0002, **** P < 0.0001. ( C ) Macrophages were infected for the indicated time points with R. parkeri left untreated ( R. parkeri -Cm) or pre-treated with chloramphenicol ( R. parkeri +Cm) at an moi = 5. Detergent-soluble protein lysates were generated, and equal amounts of total proteins were immunoprecipitated with an anti-DRP1 antibody (IP:Drp1). Transferred proteins were probed with an anti-DRP1 pSer616 antibody and re-probed with an anti-DRP1 antibody. To control for protein loading, generated lysates were probed with anti-DRP1 antibody (input). We further hypothesized that infection of mammalian macrophages by pathogenic Rickettsia species will result in significant and dynamic changes in ATP production to potentially fulfill metabolic requirements of this class of obligate intracellular pathogens. To test the hypothesis, we monitored ATP levels produced by the mitochondria and glycolysis during infection using the Seahorse Real-Time ATP Rate Assay. The assay calculates mitochondrial ATP (mitoATP) and glycolytic ATP (glycoATP) by measuring oxygen consumption rate and extracellular acidification rate of live cells. Macrophages were infected with R. parkeri, and ATP production was quantified at 6, 24, and 48 hpi ( Fig. 4B ). As a control, macrophages were stimulated with lipopolysaccharide (LPS) to induce immunometabolism shift from mitochondria to glycolysis ATP production. R. parkeri induced a modest but statistically significant ATP production via glycolysis when compared to uninfected (mock) cells, indicating R. parkeri increases glycolysis. Interestingly, significant mitoATP was also increased as early as 6 hpi and remained elevated at 24 and 48 h. This was different than the LPS-stimulated macrophages where mitoATP levels slightly decreased relative to uninfected cells. These results suggest that R. parkeri infection in macrophages leads to a significant increase in mitochondrial metabolism that may play a role in the establishment of a niche suitable for replication. R. parkeri infection results in DRP1 serine phosphorylation Activity of DRP1/DNM1L is regulated by phosphorylation of serine residues including Ser616, which can be assayed by western immunoblotting ( 36 ). To initially determine if R. parkeri can also stimulate DRP1 activation, we infected iBMDMs for the indicated time points, solubilized mammalian proteins, and analyzed the DRP1 phosphorylation state using immunoprecipitation and western immunoblotting with commercially available DRP1-antibodies and DRP1-phosphospecific antibodies. As shown in Fig. 4C , infection of iBMDMs with R. parkeri cells leads to a rapid increase in DRP1-Ser616 phosphorylation at 4 h post-infection that is maintained up to 48 h post-infection. Interestingly, L. pneumophila utilizes its type IV secretion machinery to secrete the effector proteins (MitF/LegA), inducing DRP1 serine phosphorylation, mitochondrial fragmentation, and ultimately aiding in the formation of a replicative intracellular niche ( 36 ). To determine whether de novo rickettsial protein synthesis is involved in DRP1 activation, we pre-incubated R. parkeri cells with chloramphenicol or vehicle control ( 25 ) infected iBMDMs for the indicated time points and processed the isolated soluble protein samples for immunoprecipitation and western immunoblotting analysis. As shown in Fig. 4C , chloramphenicol treatment inhibits R. parkeri induced DRP1 serine phosphorylation after 4 h. These results demonstrate that R. parkeri can stimulate DRP1 activity during infections of macrophages and that this activation is dependent on R. parkeri protein synthesis. Silencing DRP1 expression results in decreased R. parkeri growth in macrophages Our previous study demonstrated that silencing DRP1 reduces mitochondrial fragmentation in LPS-stimulated macrophages, suggesting that DRP1 is essential for altering mitochondrial dynamics during infection ( 38 ). In addition, interfering with expression and activity of DRP1 reduces intracellular replication of L. pneumophila and L. monocytogenes ( 36 ) ( 39 ), suggesting that mitochondrial fragmentation/fission can favor bacterial replication. Thus, we hypothesized that the observed dynamic changes to mitochondria and DRP1 Ser616 phosphorylation in R. parkeri -infected macrophages would also favor the establishment of a replicative intracellular niche. To determine whether DRP1 activity plays a role in R. parkeri replication in macrophages, we infected control and DRP1-knockdown iBMDMs with R. parkeri and analyzed bacterial loads at 4, 24, and 48 h. As shown in Fig. 5 , R. parkeri growth was significantly reduced in DRP1 knockdown cells compared to control transfected cells, suggesting that DRP1 is required for R. parkeri replication. A recent study implicated key enzymes in the mevalonate pathway as playing key roles in directly influencing mitochondrial dynamics. Nitrogen-containing bisphosphonates (NBPs such as alendronate and zolendronate) inhibit farnesyl diphosphate synthase (FPP) and result in the inhibition of the biosynthesis of cholesterol, isoprenoids, heme, and ubiquinones ( 40 ). In addition, pharmacological inhibition of an enzyme, HMG-CoA reductase, upstream of FPP activity reduced R. conorii ( 34 ) and R. parkeri ( 41 ) growth with infected mammalian cells. Interestingly, targeting of FPP by NBPs led to a decrease in mitochondrial fission markers in mammalian endothelial cells ( 32 ). To determine whether NBPs could potentially inhibit rickettsial growth in macrophages, we pre-incubated iBMDMs with alendronate (5 µM), infected these cells with R. parkeri, and determined growth using flow cytometry and immunofluorescence microscopy. Alendronate does not significantly impact the growth of R. parkeri in macrophages suggesting that FPP-dependent pathways may not be directly involved in rickettsial growth in phagocytic cells ( Fig. S1 ). Taken together, our results demonstrate that R. parkeri induces DRP1 phosphorylation, which is required for efficient R. parkeri proliferation independent of NBPs within infected mammalian macrophages. Fig 5. Open in a new tab Inhibition of DRP1 expression in iBMDMs diminishes R. parkeri proliferation. ( A and B ) Flow cytometry analysis of wild type (WT) and drp1 knockdown (DRP1) infected cells and the mean fluorescence intensity (MFI) of R. parkeri indicated time points. ( C ) Quantitative PCR (qPCR) analysis of WT and DRP1 iBMDMs infected with R. parkeri presented as a ratio of Rickettsia genomic DNA content ( sca1 ) vs mammalian genomic DNA content ( actin ). ( D and E ) Immunofluorescence microscopy analysis of R. parkeri WT-infected iBMDMs ( D ) and DRP1-infected iBMDMs ( E ) demonstrates a significant growth inhibition in DRP1 knockdown cells. Scale bar in D and E = 5 µm. Statistical significance was determined using a one-way ANOVA with Bonferroni’s comparison test. n.s = not significant, ** P < 0.0001 in A and B, ** P = 0.0007 in C. DISCUSSION As obligate intracellular pathogens, several Rickettsia species have evolved strategies to infect different mammalian cell types including endothelial cells, monocytes, and macrophages and to sequester nutrients within these infected cells required to establish productive replicative niches. Genomic and bioinformatic analysis of different Rickettsia species demonstrated that this class of obligate intracellular bacteria lacks a full arsenal of genes encoding enzymes that are vital to synthesize certain fatty acids and to efficiently produce ATP ( 42 , 43 ), strongly suggesting that Rickettsia species must exploit host cell pathways to obtain these and other host-derived nutrients to fulfill metabolic requirements. Infection of THP-1 macrophages with R. conorii led to the predicted upregulation of pathways associated with de novo host cell fatty acid biosynthesis and β-oxidation of these fatty acids, presumably for the generation of ATP and changes in mitochondria abundance and function ( 23 ). In addition, rickettsial infections of THP-1 macrophages also led to an increase in the abundance of proteins involved in mitochondria function and a decrease in the abundance of several enzymes involved in host cell glycolysis, including phosphoglycerate kinase 1 (PGK1), pyruvate kinase (PKM), and enolase 1 (ENO1), strongly suggesting that rickettsial infections reprogram host cell metabolism to favor oxidative phosphorylation (OXPHOS) over glycolysis ( 23 ). In this current study, we demonstrated that infection of mammalian macrophages (iBMDMs) with R. parkeri leads to a significant increase in mitochondria content and an increase in mitochondria fission in infected cells during the time course of the experiment. These induced changes coincided with an increased synthesis of host cell ATP primarily through mitochondrial respiration (OXPHOS). In contrast, infection of human monocyte-derived macrophages by the vacuole-bound pathogen, L. pneumophila , results in an overall increase in host cell glycolysis and a decrease in OXPHOS (Warburg-like metabolism) along with changes in mitochondrial morphology to establish a more replicative favorable intracellular niche ( 36 ). These results strongly suggest that the metabolic requirements between intracellular Gram-negative bacterial pathogens may be distinct and possibly dictated by their respective intracellular localizations and mechanisms utilized to successfully proliferate within target mammalian cells. Mitochondrial dynamics including mitochondrial fission are controlled in large part by DRP1/DNM1L, a small GTP-binding protein that is activated by serine phosphorylation of a key residue (Ser616) ( 44 ). We demonstrated that R. parkeri protein synthesis is required to stimulate DRP1 serine phosphorylation starting at 4 h post-infection and maintained until 48 h post-infection, strongly suggesting that DRP1 is activated during the infection. L. pneumophila uses its type IV secretion machinery to secrete the effector protein (MitF/LegA) which is involved in DRP1-dependent mitochondrial fragmentation ( 37 ). Interestingly, several R. parkeri secreted proteins termed “secreted Rickettsia factors” (SrfsA-G) have recently been shown to interact with intracellular compartments and organelles, including the host cytoplasm, mitochondria, and endoplasmic reticulum in vitro . One of these proteins, SrfB, co-localizes with mitochondrial apoptosis inducing factor (AIF); however, SrfB was not sufficient to mediate significant changes to the mitochondrial networks ( 45 ) observed in our study. The putative rickettsial protein(s) that are involved in mediating changes to mitochondrial morphology and in stimulating DRP1 activation in infected macrophages are not known and are currently under investigation. The enzyme, farnesyl diphosphate synthase (FPP), can play a role in modulating mitochondrial dynamics and the abundance of mitochondria fission proteins in mammalian cells ( 32 ). Therefore, targeting FPP could potentially impact R. parkeri growth by perturbing mitochondrial function during infection. However, pharmacological inhibition of FPP did not significantly diminish the ability of R. parkeri to proliferate within murine macrophages, suggesting that rickettsial growth in these cells is independent of this arm of the mevalonate pathway. The host cell pathways that are stimulated by R. parkeri infection and lead directly to DRP1 activation and mitochondrial fission are not yet defined and are currently under investigation. Further elucidation of the host cell pathways which are involved in mitochondrial fission during infection may represent a novel alternative strategy for therapeutic intervention against pathogenic Rickettsia species. ACKNOWLEDGMENTS We would like to thank current and former members of the Martinez lab for helpful discussions regarding this work. This work was supported, in part, by an LSU School of Veterinary Medicine (LSU-SVM) graduate student fellowship and an LSU Pinkie Gordon Lane Graduate School Future Scholars Initiative fellowship to N.K. This work was also supported, in part, by a previous award by the National Institutes of Health, National Institute of Allergy and Infectious Diseases (grant R01AI072606) to J.J.M., a current award by the National Institutes of Health, National Institute of General Medical Sciences (grant R35GM154857) to W.B., and a current award by the National Institutes of Health, National Institute of General Medical Sciences (5P20GM130555) to B.A. Contributor Information Juan J. Martinez, Email: [email protected]. Sunny Shin, University of Pennsylvania Perelman School of Medicine, Philadelphia, Pennsylvania, USA. SUPPLEMENTAL MATERIAL The following material is available online at https://doi.org/10.1128/iai.00086-26 . Fig. S1. iai.00086-26-s0001.pdf. NBP fails to inhibit R. parkeri growth in mammalian macrophages. iai.00086-26-s0001.pdf (2.8MB, pdf) DOI: 10.1128/iai.00086-26.SuF1 Supplemental material. iai.00086-26-s0002.docx. Fig. S1 caption. iai.00086-26-s0002.docx (14.4KB, docx) DOI: 10.1128/iai.00086-26.SuF2 ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse. REFERENCES 1. Paddock CD, Finley RW, Wright CS, Robinson HN, Schrodt BJ, Lane CC, Ekenna O, Blass MA, Tamminga CL, Ohl CA, McLellan SLF, Goddard J, Holman RC, Openshaw JJ, Sumner JW, Zaki SR, Eremeeva ME. 2008. Rickettsia parkeri rickettsiosis and its clinical distinction from Rocky Mountain spotted fever. Clin Infect Dis 47:1188–1196. doi: 10.1086/592254 [ DOI ] [ PubMed ] [ Google Scholar ] 2. de Sousa R, Nóbrega SD, Bacellar F, Torgal J. 2003. Mediterranean spotted fever in Portugal: risk factors for fatal outcome in 105 hospitalized patients. Ann N Y Acad Sci 990:285–294. doi: 10.1111/j.1749-6632.2003.tb07378.x [ DOI ] [ PubMed ] [ Google Scholar ] 3. Walker DH, Occhino C, Tringali GR, Di Rosa S, Mansueto S. 1988. Pathogenesis of rickettsial eschars: the tache noire of boutonneuse fever. Hum Pathol 19:1449–1454. doi: 10.1016/s0046-8177(88)80238-7 [ DOI ] [ PubMed ] [ Google Scholar ] 4. Hand WL, Miller JB, Reinarz JA, Sanford JP. 1970. Rocky Mountain spotted fever. A vascular disease. Arch Intern Med 125:879–882. [ PubMed ] [ Google Scholar ] 5. Chan YGY, Riley SP, Chen E, Martinez JJ. 2011. Molecular basis of immunity to rickettsial infection conferred through outer membrane protein B. Infect Immun 79:2303–2313. doi: 10.1128/IAI.01324-10 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 6. Riley SP, Cardwell MM, Chan YGY, Pruneau L, Del Piero F, Martinez JJ. 2015. Failure of a heterologous recombinant Sca5/OmpB protein-based vaccine to elicit effective protective immunity against Rickettsia rickettsii infections in C3H/HeN mice. Pathog Dis 73:ftv101. doi: 10.1093/femspd/ftv101 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 7. Riley SP, Fish AI, Del Piero F, Martinez JJ. 2018. Immunity against the obligate intracellular bacterial pathogen Rickettsia australis requires a functional complement system. Infect Immun 86:e00139-18. doi: 10.1128/IAI.00139-18 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 8. Riley SP, Fish AI, Garza DA, Banajee KH, Harris EK, del Piero F, Martinez JJ. 2016. Nonselective persistence of a Rickettsia conorii extrachromosomal plasmid during mammalian infection. Infect Immun 84:790–797. doi: 10.1128/IAI.01205-15 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 9. Bechelli J, Vergara L, Smalley C, Buzhdygan TP, Bender S, Zhang W, Liu Y, Popov VL, Wang J, Garg N, Hwang S, Walker DH, Fang R. 2019. Atg5 supports Rickettsia australis infection in macrophages in vitro and in vivo. Infect Immun 87:e00651-18. doi: 10.1128/IAI.00651-18 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 10. Manor E. 1992. The effect of monocyte-derived macrophages on the growth of Rickettsia conorii in permissive cells. Acta Virol 36:13–18. [ PubMed ] [ Google Scholar ] 11. Engström P, Burke TP, Mitchell G, Ingabire N, Mark KG, Golovkine G, Iavarone AT, Rape M, Cox JS, Welch MD. 2019. Evasion of autophagy mediated by Rickettsia surface protein OmpB is critical for virulence. Nat Microbiol 4:2538–2551. doi: 10.1038/s41564-019-0583-6 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 12. Radulovic S, Price PW, Beier MS, Gaywee J, Macaluso JA, Azad A. 2002. Rickettsia-macrophage interactions: host cell responses to Rickettsia akari and Rickettsia typhi. Infect Immun 70:2576–2582. doi: 10.1128/IAI.70.5.2576-2582.2002 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 13. Manor E, Sarov I. 1990. Tumor necrosis factor alpha and prostaglandin E 2 production by human monocyte-derived macrophages infected with spotted fever group rickettsiae. Ann N Y Acad Sci 590:157–167. doi: 10.1111/j.1749-6632.1990.tb42218.x [ DOI ] [ PubMed ] [ Google Scholar ] 14. Raoult D, Roux V. 1997. Rickettsioses as paradigms of new or emerging infectious diseases. Clin Microbiol Rev 10:694–719. doi: 10.1128/CMR.10.4.694 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 15. Londoño AF, Mendell NL, Walker DH, Bouyer DH. 2019. A biosafety level-2 dose-dependent lethal mouse model of spotted fever rickettsiosis: Rickettsia parkeri atlantic rainforest strain. PLoS Negl Trop Dis 13:e0007054. doi: 10.1371/journal.pntd.0007054 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 16. Takemura H, Yamamoto H, Kunishima H, Ikejima H, Hara T, Kanemitsu K, Terakubo S, Shoji Y, Kaku M, Shimada J. 2000. Evaluation of a human monocytic cell line THP-1 model for assay of the intracellular activities of antimicrobial agents against Legionella pneumophila. J Antimicrob Chemother 46:589–594. doi: 10.1093/jac/46.4.589 [ DOI ] [ PubMed ] [ Google Scholar ] 17. Ghigo E, Capo C, Tung CH, Raoult D, Gorvel JP, Mege JL. 2002. Coxiella burnetii survival in THP-1 monocytes involves the impairment of phagosome maturation: IFN-γ mediates its restoration and bacterial killing. J Immunol 169:4488–4495. doi: 10.4049/jimmunol.169.8.4488 [ DOI ] [ PubMed ] [ Google Scholar ] 18. Theus SA, Cave MD, Eisenach KD. 2004. Activated THP-1 cells: an attractive model for the assessment of intracellular growth rates of Mycobacterium tuberculosis isolates. Infect Immun 72:1169–1173. doi: 10.1128/IAI.72.2.1169-1173.2004 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 19. Carratelli CR, Rizzo A, Catania MR, Gallè F, Losi E, Hasty DL, Rossano F. 2002. Chlamydia pneumoniae infections prevent the programmed cell death on THP-1 cell line. FEMS Microbiol Lett 215:69–74. doi: 10.1111/j.1574-6968.2002.tb11372.x [ DOI ] [ PubMed ] [ Google Scholar ] 20. Curto P, Simões I, Riley SP, Martinez JJ. 2016. Differences in intracellular fate of two spotted fever group Rickettsia in macrophage-like cells. Front Cell Infect Microbiol 6:80. doi: 10.3389/fcimb.2016.00080 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 21. Kristof MN, Allen PE, Yutzy LD, Thibodaux B, Paddock CD, Martinez JJ. 2021. Significant growth by Rickettsia species within human macrophage-like cells is a phenotype correlated with the ability to cause disease in mammals. Pathogens 10:228. doi: 10.3390/pathogens10020228 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 22. Curto P, Riley SP, Simões I, Martinez JJ. 2019. Macrophages infected by a pathogen and a non-pathogen spotted fever group Rickettsia reveal differential reprogramming signatures early in infection. Front Cell Infect Microbiol 9:97. doi: 10.3389/fcimb.2019.00097 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 23. Curto P, Santa C, Allen P, Manadas B, Simões I, Martinez JJ. 2019. A pathogen and a non-pathogen spotted fever group Rickettsia trigger differential proteome signatures in macrophages. Front Cell Infect Microbiol 9:43. doi: 10.3389/fcimb.2019.00043 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 24. Allen PE, Martinez JJ. 2020. Modulation of host lipid pathways by pathogenic intracellular bacteria. Pathogens 9:614. doi: 10.3390/pathogens9080614 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 25. Allen PE, Noland RC, Martinez JJ. 2021. Rickettsia conorii survival in THP-1 macrophages involves host lipid droplet alterations and active rickettsial protein production. Cell Microbiol 23:e13390. doi: 10.1111/cmi.13390 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 26. Ramond E, Jamet A, Coureuil M, Charbit A. 2019. Pivotal role of mitochondria in macrophage response to bacterial pathogens. Front Immunol 10:2461. doi: 10.3389/fimmu.2019.02461 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 27. Gao F, Reynolds MB, Passalacqua KD, Sexton JZ, Abuaita BH, O’Riordan MXD. 2020. The mitochondrial fission regulator DRP1 controls post-transcriptional regulation of TNF-α. Front Cell Infect Microbiol 10:593805. doi: 10.3389/fcimb.2020.593805 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 28. Paddock CD, Sumner JW, Comer JA, Zaki SR, Goldsmith CS, Goddard J, McLellan SLF, Tamminga CL, Ohl CA. 2004. Rickettsia parkeri: a newly recognized cause of spotted fever rickettsiosis in the United States. CLIN INFECT DIS 38:805–811. doi: 10.1086/381894 [ DOI ] [ PubMed ] [ Google Scholar ] 29. Ammerman NC, Beier-Sexton M, Azad AF. 2008. Laboratory maintenance of Rickettsia rickettsii. Curr Prot Microbiol Chapt 3:5. doi: 10.1002/9780471729259.mc03a05s11 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 30. Chan YGY, Cardwell MM, Hermanas TM, Uchiyama T, Martinez JJ. 2009. Rickettsial outer-membrane protein B (rOmpB) mediates bacterial invasion through Ku70 in an actin, c-Cbl, clathrin and caveolin 2-dependent manner. Cell Microbiol 11:629–644. doi: 10.1111/j.1462-5822.2008.01279.x [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 31. Cardwell MM, Martinez JJ. 2012. Identification and characterization of the mammalian association and actin-nucleating domains in the Rickettsia conorii autotransporter protein, Sca2. Cell Microbiol 14:1485–1495. doi: 10.1111/j.1462-5822.2012.01815.x [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 32. Budzinska A, Galganski L, Jarmuszkiewicz W. 2023. The bisphosphonates alendronate and zoledronate induce adaptations of aerobic metabolism in permanent human endothelial cells. Sci Rep 13:16205. doi: 10.1038/s41598-023-43377-3 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 33. Martinez JJ, Seveau S, Veiga E, Matsuyama S, Cossart P. 2005. Ku70, a component of DNA-dependent protein kinase, is a mammalian receptor for Rickettsia conorii. Cell 123:1013–1023. doi: 10.1016/j.cell.2005.08.046 [ DOI ] [ PubMed ] [ Google Scholar ] 34. Czyż DM, Potluri L-P, Jain-Gupta N, Riley SP, Martinez JJ, Steck TL, Crosson S, Shuman HA, Gabay JE. 2014. Host-directed antimicrobial drugs with broad-spectrum efficacy against intracellular bacterial pathogens. mBio 5:e01534-14. doi: 10.1128/mBio.01534-14 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 35. Riley SP, Macaluso KR, Martinez JJ. 2015. Electrotransformation and clonal isolation of Rickettsia species. Curr Protoc Microbiol 39:3A. doi: 10.1002/9780471729259.mc03a06s39 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 36. Escoll P, Song OR, Viana F, Steiner B, Lagache T, Olivo-Marin JC, Impens F, Brodin P, Hilbi H, Buchrieser C. 2017. Legionella pneumophila modulates mitochondrial dynamics to trigger metabolic repurposing of infected macrophages. Cell Host Microbe 22:302–316. doi: 10.1016/j.chom.2017.07.020 [ DOI ] [ PubMed ] [ Google Scholar ] 37. Bronner DN, O’Riordan MX. 2016. Measurement of mitochondrial DNA release in response to ER stress. Bio Protoc 6:e1839. doi: 10.21769/BioProtoc.1839 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 38. Sharma A, Heffernan LM, Hoang K, Jeyaseelan S, Beavers WN, Abuaita BH. 2025. Activation of the endoplasmic reticulum stress regulator IRE1α compromises pulmonary host defenses. Cell Rep 44:115632. doi: 10.1016/j.celrep.2025.115632 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 39. Zhang Y, Yao Y, Qiu X, Wang G, Hu Z, Chen S, Wu Z, Yuan N, Gao H, Wang J, Song H, Girardin SE, Qian Y. 2019. Listeria hijacks host mitophagy through a novel mitophagy receptor to evade killing. Nat Immunol 20:433–446. doi: 10.1038/s41590-019-0324-2 [ DOI ] [ PubMed ] [ Google Scholar ] 40. Goldstein JL, Brown MS. 1990. Regulation of the mevalonate pathway. Nature 343:425–430. doi: 10.1038/343425a0 [ DOI ] [ PubMed ] [ Google Scholar ] 41. Ahyong V, Berdan CA, Burke TP, Nomura DK, Welch MD. 2019. A metabolic dependency for host isoprenoids in the obligate intracellular pathogen Rickettsia parkeri underlies a sensitivity to the statin class of host-targeted therapeutics. mSphere 4:e00536-19. doi: 10.1128/mSphere.00536-19 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 42. Merhej V, Raoult D. 2011. Rickettsial evolution in the light of comparative genomics. Biol Rev Camb Philos Soc 86:379–405. doi: 10.1111/j.1469-185X.2010.00151.x [ DOI ] [ PubMed ] [ Google Scholar ] 43. Driscoll TP, Verhoeve VI, Guillotte ML, Lehman SS, Rennoll SA, Beier-Sexton M, Rahman MS, Azad AF, Gillespie JJ. 2017. Wholly Rickettsia ! Reconstructed metabolic profile of the quintessential bacterial parasite of eukaryotic cells. mBio 8:e00859-17. doi: 10.1128/mBio.00859-17 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 44. Taguchi N, Ishihara N, Jofuku A, Oka T, Mihara K. 2007. Mitotic phosphorylation of dynamin-related GTPase Drp1 participates in mitochondrial fission. J Biol Chem 282:11521–11529. doi: 10.1074/jbc.M607279200 [ DOI ] [ PubMed ] [ Google Scholar ] 45. Sanderlin AG, Kurka Margolis H, Meyer AF, Lamason RL. 2024. Cell-selective proteomics reveal novel effectors secreted by an obligate intracellular bacterial pathogen. Nat Commun 15:6073. doi: 10.1038/s41467-024-50493-9 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Associated Data This section collects any data citations, data availability statements, or supplementary materials included in this article. Supplementary Materials Fig. S1. iai.00086-26-s0001.pdf. NBP fails to inhibit R. parkeri growth in mammalian macrophages. iai.00086-26-s0001.pdf (2.8MB, pdf) DOI: 10.1128/iai.00086-26.SuF1 Supplemental material. iai.00086-26-s0002.docx. Fig. S1 caption. iai.00086-26-s0002.docx (14.4KB, docx) DOI: 10.1128/iai.00086-26.SuF2 Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM) ACTIONS View on publisher site PDF (2.4 MB) Cite Collections Permalink PERMALINK Copy RESOURCES Similar articles Cited by other articles Links to NCBI Databases Cite Copy Download .nbib .nbib Format: AMA APA MLA NLM Add to Collections Create a new collection Add to an existing collection Name your collection * Choose a collection Unable to load your collection due to an error Please try again Add Cancel Follow NCBI NCBI on X (formerly known as Twitter) NCBI on Facebook NCBI on LinkedIn NCBI on GitHub NCBI RSS feed Connect with NLM NLM on X (formerly known as Twitter) NLM on Facebook NLM on YouTube National Library of Medicine 8600 Rockville Pike Bethesda, MD 20894 Web Policies FOIA HHS Vulnerability Disclosure Help Accessibility Careers NLM NIH HHS USA.gov Back to Top