Identification of novel sources of resistance to squash leaf curl China virus (SLCCNV) and cucurbit chlorotic yellows virus (CCYV) and inheritance analysis of SLCCNV resistance in pumpkin (Cucurbita moschata Duchesne ex Poir.).

Identification of novel sources of resistance to squash leaf curl China virus (SLCCNV) and cucurbit chlorotic yellows virus (CCYV) and inheritance analysis of SLCCNV resistance in pumpkin (Cucurbita moschata Duchesne ex Poir.) - PMC Skip to main content An official website of the United States government Here's how you know Here's how you know Search Log in Primary site navigation Search Log in Search PMC Full-Text Archive Search in PMC Journal List User Guide As a library, NLM provides access to scientific literature. Inclusion in an NLM database does not imply endorsement of, or agreement with, the contents by NLM or the National Institutes of Health. Learn more: PMC Disclaimer | PMC Copyright Notice Physiol Mol Biol Plants . 2025 Jul 9;31(6):913–929. doi: 10.1007/s12298-025-01613-2 Identification of novel sources of resistance to squash leaf curl China virus (SLCCNV) and cucurbit chlorotic yellows virus (CCYV) and inheritance analysis of SLCCNV resistance in pumpkin ( Cucurbita moschata Duchesne ex Poir.) Bichhinna Maitri Rout 1, 2 , Amish Kumar Sureja 1, ✉ , S Subramanian 3 , S Gopala Krishnan 4 , Anirban Roy 5 , Prasanta Kumar Dash 6 , Anilabha Das Munshi 1 Author information Article notes Copyright and License information 1 Division of Vegetable Science, ICAR-Indian Agricultural Research Institute, New Delhi, 110012 India 2 The Graduate School, ICAR-Indian Agricultural Research Institute, New Delhi, 110012 India 3 Division of Entomology, ICAR-Indian Agricultural Research Institute, New Delhi, 110012 India 4 Division of Genetics, ICAR-Indian Agricultural Research Institute, New Delhi, 110012 India 5 Division of Plant Pathology, ICAR-Indian Agricultural Research Institute, New Delhi, 110012 India 6 ICAR-National Institute for Plant Biotechnology, New Delhi, 110012 India ✉ Corresponding author. Received 2024 Nov 25; Revised 2025 May 28; Accepted 2025 Jun 5; Issue date 2025 Jun. © Prof. H.S. Srivastava Foundation for Science and Society 2025. Springer Nature or its licensor (e.g. a society or other partner) holds exclusive rights to this article under a publishing agreement with the author(s) or other rightsholder(s); author self-archiving of the accepted manuscript version of this article is solely governed by the terms of such publishing agreement and applicable law. PMC Copyright notice PMCID: PMC12314156  PMID: 40756441 Abstract Pumpkin ( Cucurbita moschata Duchesne ex. Poir) is susceptible to various viral infections which significantly hinder its production, impacting agricultural sustainability and food security. The susceptibility of fifty four pumpkin genotypes to squash leaf curl China virus (SLCCNV) and cucurbit chlorotic yellows virus (CCYV) was assessed over two consecutive seasons (2021 rainy and 2022 spring–summer) and in 2023 (spring–summer), specifically for only SLCCNV, through screening in an insect-proof net house under whitefly inoculation conditions. Disease progression was evaluated through the vulnerability index (VI) and the area under the disease progress curve (AUDPC). During 2021 and 2022, on the basis of challenge inoculation studies, highly resistant genotypes (DPU-41, DPU-43, DPU-133, and DPU-105) consistently presented no symptoms and no PCR amplification of SLCCNV or CCYV. Furthermore, during 2023, four genotypes (DPU-41, DPU-43, DPU-133 and DPU-105) presented high resistance levels (VI = 0) to SLCCNV. VI and AUDPC exhibited a significant positive correlation (> 0.96) for whitefly-mediated inoculation screening during 2021 and 2022. Quantitative polymerase chain reaction (qPCR) analysis revealed no detectable SLCCNV load in the highly resistant (DPU-41, DPU-43, DPU-133, and DPU-105) and resistant (DPU-101, and DPU-129) genotypes, with cycle threshold (Ct) values indicating the absence of the virus. Furthermore, inheritance studies involving susceptible and resistant genotypes across six generations (P 1 , P 2 , F 1 , F 2 , B 1 , B 2 ) revealed a single dominant gene governing resistance to SLCCNV in the DPU-41 and DPU-43 genotypes. The present findings are the first to reveal the single dominant gene inheritance of resistance to SLCCNV in pumpkin. This study contributes to understanding resistance in pumpkin genotypes against SLCCNV and CCYV, offering a foundation for breeding programs focused on producing resistant varieties. Graphical abstract Supplementary Information The online version contains supplementary material available at 10.1007/s12298-025-01613-2. Keywords: Challenge inoculation, Cucurbita , Inheritance, Pumpkin, Resistance, Virus, Whitefly Introduction Cucurbits, including pumpkins, are important vegetables widely cultivated in tropical and subtropical regions for human consumption. The Cucurbitaceae family, with over 800 plant species in 120 genera, including annual or perennial herbaceous plants, is cultivated in temperate and tropical regions. India is home to approximately 100 species from 37 genera (Radouane et al. 2021 ). Pumpkin ( Cucurbita moschata Duchesne ex. Poir), with a chromosome number of 2n = 2x = 40, holds significant agricultural and nutritional value and is cultivated globally. This nutrient-rich vegetable provides essential macro‒ and micronutrients, vitamins, antioxidants, and bioactive compounds. In addition to the flesh, the peel, seeds, and shoots of some varieties are also consumed. The flesh is high in β‒carotene, and the seeds are protein‒rich, with a balanced amino acid content and low levels of antinutrients such as phytic acid and trypsin inhibitors. Pumpkin seeds also contain an abundance of B-complex vitamins and minerals, including magnesium, iron, zinc, phosphorus, potassium, selenium, manganese, and copper (Schafleitner et al. 2024 ). India is one of the major pumpkin-producing countries, with popular cultivated varieties such as Pusa Vishwas, Pusa Vikas, Arka Chandan, Swarna Amrit and Ambili, showing wide adaptability and consumer acceptance. India produces approximately 5.5 million tonnes of pumpkin annually, with an average productivity of 18.21 metric tonnes per hectare (FAO 2023 ). Cucurbits, whether grown outdoors or in protected environments, often face infections from multiple viruses within a single plant (Bananej and Vahdat 2008 ; Kassem et al. 2007 ; Massumi et al. 2007 ). With more than 70 reported viruses causing diseases in cucurbits globally (Neoh et al. 2023 ), the genera that pose threats include Begomovirus , Potyvirus , Cucumovirus , Tobamovirus , Tymovirus , Nepovirus , and Polerovirus (Lecoq and Katis 2014 ). Begomoviruses, notably tomato leaf curl New Delhi virus (ToLCNDV), squash leaf curl China virus (SLCCNV), and tomato leaf curl Palampur virus (ToLCPalV), are prevalent and diverse and infect pumpkins, with significant economic losses ranging from 60 to 100% (Kumari et al. 2022 ; Naganur et al. 2023 ; Desbiez et al. 2009 ). Emerging infectious diseases seriously threaten crop cultivation and food sustainability (Desbiez et al. 2009 ). SLCCNV, transmitted by the whitefly Bemisia tabaci , is a major issue in squash and other cucurbits in India and neighboring countries. SLCCNV, with a bipartite genome, causes leaf rolling, curling, and yellow patches (Phaneendra et al. 2012 ). It has a limited host range, is primarily infecting cucurbits, and thus hinders their cultivation in Southeast Asia (Varma and Malathi 2003 ). The incidence of SLCCNV is increasing in cucurbits across Asia, including India, Pakistan, China, the Philippines, Thailand, and East Timor (Hong et al. 1995 ; Muniyappa et al. 2003 ; Singh et al. 2008 , 2009 ; Tahir et al. 2010 ; Riyaz et al. 2015 ; Maina et al. 2017 ). Criniviruses, such as cucurbit chlorotic yellows virus (CCYV), add to the complexity of the situation. CCYV, which also has a bipartite genome, interacts with whiteflies and may result in synergistic interactions with other viruses, thus influencing symptoms and severity (Syller 2012 ; Okuda et al. 2010 ; Gyoutoku et al. 2009 ). The spread of these viruses is facilitated by the rapid growth of whitefly populations due to environmental factors and the agricultural trade (Navas-Castillo et al. 2011 ). Creating virus-resistant cucurbit cultivars is a complex and time-consuming process. Identifying suitable sources of resistance is crucial in the early stages, either for specific virus species or covering for multiple species (Martín-Hernández and Picó 2021 ). In northern India, pumpkin cultivation faces a significant threat from prevalent viral diseases (Kumari et al. 2021 ). The use of resistant pumpkin varieties is the most effective way to control mosaic disease in regions where it hinders production. Disease resistance in plants occurs through preexisting structures, chemicals, and immune system responses. Researchers have evaluated Cucurbita spp. germplasm to find sources of resistance to begomoviruses (Dhillon et al. 2021 ; Verma et al. 2023a , b ). Sáez et al. ( 2020 ) highlighted the importance of exploring genetic diversity in germplasms to create resilient elite pumpkin lines. Genetic resistance to various viruses, including ToLCNDV, has been identified in pumpkins‒, and is governed by single recessive gene or dominant genes (Sáez et al. 2020 ; Romero-Masegosa et al. 2020 ; Verma et al. 2023b ). Previous efforts in pumpkin breeding have primarily focused on traits such as yield, earliness, and fruit quality. Limited work has been done on developing resistance to viral diseases, especially begomoviruses like SLCCNV. A major limitation in earlier breeding programs has been the lack of identified resistant sources, a clear understanding of the inheritance of resistance, and the absence of reliable markers for resistance screening. This has significantly hindered the development of resistant cultivars through conventional or molecular breeding approaches. Understanding the inheritance of virus resistance aids breeders in developing and selecting plants with stable resistance traits, preserving genetic diversity for future breeding efforts against evolving virus strains (Dhillon et al. 2021 ; Romero-Masegosa et al. 2020 ). This research specifically aims to identify novel sources of resistance to mixed infections of SLCCNV and CCYV within diverse pumpkin germplasm and to elucidate the inheritance pattern of resistance to SLCCNV in pumpkin genotypes. By identifying novel sources of resistance within diverse germplasm and understanding the inheritance patterns, breeders will have access to specific, reliable genetic resources for developing resistant cultivars. It will lay the foundation for the identification of molecular markers linked to SLCCNV resistance, which will enable the application of marker-assisted selection (MAS), making the breeding process more efficient and precise. This will allow breeders to incorporate resistance traits into elite pumpkin varieties without the need for labor-intensive or time-consuming phenotypic screening. Moreover, the findings will support the development of climate-resilient pumpkin cultivars that can withstand the increasing threat of viral diseases, ensuring better yields and quality in regions where SLCCNV is prevalent. For future breeding programs, this research provides a foundation for enhancing resistance to SLCCNV, reducing the reliance on chemical control methods, and ultimately contributing to sustainable pumpkin production, which will be essential in meeting food security demands and promoting environmental sustainability in the years to come. Materials and methods Sample collection and maintenance of aviruliferous whiteflies and virus inoculum Leaf samples from virus-infected pumpkin plants were collected from the experimental field of the Indian Agricultural Research Institute, New Delhi, India, during October 2020, November 2021, and May 2022 (Supplementary Fig. 1). The majority of the pumpkin plants presented symptoms of begomovirus and CCYV infection, including marginal rolling and curling of leaves, yellow patches on the lamina, puckering on the leaves and overall stunting of the plants. Adult whiteflies ( Bemisia tabaci Asia II 1) were initially collected using aspirator from cucurbit fields at the ICAR-Indian Agricultural Research Institute (IARI), New Delhi, and reared in insect growth chambers at the Division of Entomology, ICAR-IARI, New Delhi. A homogeneous B. tabaci population (raised from a single pair of male and female whiteflies) was maintained on healthy disease-free pumpkin seedlings under optimum rearing conditions (temperature 25 ± 2 °C, RH 60–70%, and a photoperiod of 14:10 (L:D). The homogenous population derived from iso-female lines was used for identifying the biotype/genetic group status. The genetic group status of the B. tabaci population was identified by PCR (polymerase chain reaction) amplification of the mitochondrial cytochrome oxidase 1 gene using the forward primer CI–J–2195 (5′–TTGATTTTTTGGTCATCCAGAAGT–3′) and the reverse primer TL2–N–3014 (5′–TCCAATGCACTAATCTGCCATATTA–3′) (Dinsdale et al. 2010 ). Single whiteflies from the population were used in triplicate for DNA extraction using a DNeasy Blood and Tissue kit (Qiagen) following the manufacturer’s protocol. Genetic group identity was determined by direct sequence comparison using the web-based Basic Local Alignment Search Tool algorithm from the NCBI ( https://blast.ncbi.nlm.nih.gov/Blast.cgi ). Further, phylogenetic analysis was done using Mega 7.0 software, maintaining a well-assigned consensus database of B. tabaci genetic groups as the standard (Kanakala and Ghanim 2019 ; Nebapure et al. 2022 ). The homogenous healthy B. tabaci Asia II 1 population was maintained on pumpkin seedlings at the Insect Proof Climate Control Chamber (IPCC) facility at Division of Entomology. Additionally, the disease-free condition was ascertained by periodical monitoring of the host plants and by random sampling of the B. tabaci populations using diagnostic PCR for presence of the viruses investigated in this study. The diagnostic PCR analysis was performed using a set of gene-specific primers for the viruses (Supplementary Table 1). Similarly, to ensure the purity of the virus inoculum used for challenge inoculation, field-collected symptomatic pumpkin leaves were initially confirmed via PCR using generic and specific primers (Supplementary Table 1). Pumpkin variety Pusa Vishwas was selected for the whitefly transmission experiment and was tested via PCR using different generic and specific primers to eliminate the possibility of mixed infections with other cucurbit-infecting viruses, ensuring that only coinfection with SLCCNV and CCYV was present. The PCR results confirmed that the plant carried both viruses before the experiment was performed. A virus-free whitefly colony was established by collecting whiteflies from pumpkin plants in the field and rearing them on healthy cotton plants. A batch of 25 aviruliferous whiteflies was released onto symptomatic plants of the susceptible pumpkin variety Pusa Vishwas, obtained from the field to acquire the SLCCNV and CCYV with an acquisition access period (AAP) of 24 h. Healthy Pusa Vishwas genotype seedlings were raised in an insect‒free climate‒controlled chamber. Viruliferous whiteflies were then released into these healthy seedlings for inoculation of the viruses within 24 h of the inoculation access period (IAP). Fifty-four genotypes of pumpkin were screened for resistance to both SLCCNV and CCYV at the IPCC facility over two seasons i.e., 2021 (rainy) and 2022 (spring–summer) (Supplementary Table 2). Screening for resistance to only SLCCNV also continued for the 2023 (spring–summer) season. Fifteen seeds per genotype were individually sown in pots (15 × 9 × 10 cm 2 ), and fifteen seedlings from each of the genotypes were evaluated for their susceptibility to both SLCCNV and CCYV. Additionally, another set of fifteen seedlings from each genotype was specifically tested for their susceptibility to SLCCNV alone. Whitefly mediated inoculation was performed following the method outlined by Sohrab ( 2005 ). A virus-free whitefly stock was reared on healthy cotton plants in a controlled environment. The whiteflies were allowed acquisition access to both SLCCNV and CCYV in one cage and only SLCCNV-infected pumpkin plants in a separate cage for 24 h, all of which were maintained under the Insect-proof climate-controlled chamber. Each cage contained 15 plants, and all plants within a cage were from a single genotype. This design ensured that each genotype was tested independently within its own isolated environment, preventing any cross-contamination between genotypes through whitefly vectors or other factors. Following a 24 h of AAP, viruliferous whiteflies were released into 8-day-old healthy plants at the two true leaf stage (25 whiteflies per plant) within a transparent polycarbonate cage. Disease scoring was conducted at 8 days post‒inoculation (dpi) and then at weekly intervals for up to 2 months after inoculation. PCR-based detection of SLCCNV and CCYV in pumpkin samples Total RNA was extracted from 100 mg of infected leaf sample tissue using the PureLink™ RNA Mini Kit (Invitrogen, Life Technologies). Reverse transcription‒polymerase chain reaction (RT‒PCR) was performed on infected samples using generic primers specific to Crinivirus , which target a 550 bp fragment of the RNA-dependent RNA polymerase coding region. To identify the Crinivirus species infecting pumpkins, the coat protein (CP) gene, spanning 753 bp, was amplified and sequenced using CCYV-specific primers. To detect begomovirus presence, total nucleic acid was extracted from 100 mg of leaf tissue from fifty-four individual pumpkin samples using the GeneJET Plant Genomic DNA Purification Kit (Thermo Fisher Scientific, USA). The isolated DNA was then subjected to PCR amplification using begomovirus species‒specific primer pairs, which target a partial AV2 gene of begomoviruses with an expected amplicon size of 538 bp. Estimation of the vulnerability index (VI) and area under the disease progress curve (AUDPC) The symptoms were scored on a scale of 0–5, where 0 indicates no symptoms (highly resistant, HR); 1, mild mosaic pattern in young leaves covering < 10% of the area (resistant, R); 2, mosaic pattern in young leaves covering > 10% to < 25% of the area (moderately resistant, MR); 3, mosaic pattern in young leaves covering > 25% to < 50% of the area (moderately susceptible, MS); 4, widespread mosaic pattern in young leaves covering > 50% to < 75% of the area (susceptible, S); and 5, widespread mosaic pattern in young leaves covering > 75% of the area, marginal rolling and curling of leaves (highly susceptible, HS) (Islam et al. 2011 ) (Fig. 1 ). To facilitate a more effective comparison of resistance across the genotypes, the vulnerability index (VI) values were calculated for each genotype using the following equation, as adopted by Silbernagel and Jafari ( 1974 ) for measuring resistance in snap bean ( Phaseolus vulgaris ) to beet curly top virus and modified by Bos ( 1982 ). where, n0, n1, n2, n3, n4 and n5 are the numbers of plants with scores of 0, 1, 2, 3, 4 and 5, respectively. Fig. 1. Open in a new tab Scoring of disease symptoms using a scale of 0–5. Visual symptoms were assessed and scored using a standardized 0–5 disease severity scale to quantify the response of pumpkin genotypes to viral infection nt represents the total number of plants, and nc represents the total number of categories. On the basis of vulnerability indices, the genotypes were categorized into five categories, namely, highly resistant (where VI = 0‒1); resistant (VI =  > 1–25%); moderately resistant (VI =  > 25–50%); susceptible (VI =  > 50–75%); and highly susceptible (VI =  > 75–100%) (Islam et al. 2011 ). AUDPC was calculated by the following formula: where y i is an assessment of a disease (percentage) at the i th observation, t i is the time (in days) at the i th observation and n is the total number of observations. Quantitative polymerase chain reaction (qPCR)-based determination of the viral load of SLCCNV in pumpkin samples qPCR was employed to determine the relative concentration of the SLCCNV virus titer by extracting DNA from leaf samples (Livak and Schmittgen 2001 ). DNA was isolated from the leaf samples using the GeneJET Plant Genomic DNA Purification Kit (Thermo Fisher Scientific, USA), ensuring both high quality and quantity. The concentration and purity of the isolated DNA were then measured in a spectrophotometer. Specific primers for the target gene (qSLC-BC1b-F’:AGCAGACCATACAAAAACCTGGGAGG and qSLC-BC1b-R’: CTCGTCTCTCGTTATGCTTCCCAC) and housekeeping gene (elongation factor (EF gene) (EF1‒F’: TCCACAGAGCAATGTCAATGG and EF1‒R’: GCTTGGGTGCTCGACAAACT) were designed and optimized for qPCR, amplifying regions with relative fold changes. qPCR were set up by incorporating template DNA, primers, and a fluorescent reporter (SYBR Green master mix). Positive and negative controls were included to validate the experiment. Three technical replicates were used for each biological sample to ensure the accuracy and reliability of the qPCR data. These replicates were performed independently for each genotype and treatment, and the average values from these technical replicates were used in the analysis to minimize experimental error and ensure robustness of the results. Each qPCR was performed in triplicate. The thermal cycling process was initiated in a real-time PCR machine under the optimum conditions for 40 cycles: initialization at 94 °C for 3 min, denaturation at 94 °C for 30 s, annealing at 60 °C for 20 s, and extension at 72 °C for 30 s. The data obtained were analyzed, including Ct values (cycle quantification), which indicate the cycle at which fluorescence crosses a predefined threshold. The relative concentration of SLCCNV was calculated by the following formula: where ∆∆Ct = ∆Ct (sample of interest)—∆Ct (control sample), ∆Ct (sample of interest) = Ct value of target gene − Ct value of reference gene. Artificial screening against SLCCNV and its detection The SLCCNV susceptible and resistant genotype(s) were used to develop the F 1 , F 2 , B 1 and B 2 generations. The highly susceptible parent and highly resistant parents were crossed to produce F 1 hybrid(s) during the rainy season of 2021, and the F 2 and backcross populations were crossed during the spring‒summer season of 2022. The inheritance of resistance to SLCCNV was studied by screening the six generations (parents, F 1 , F 2 , B 1 and B 2 ) under challenge inoculation conditions in a double layered 40 mesh insect-proof net house during the spring‒summer season of 2023. Soilless potting media consisting of cocopeat, vermiculite and perlite in a 3:1:1 ratio was used as the potting mixture. Seeds of each generation were sown in 3-inch plastic pots containing the above media. The B 1 and B 2 populations, each comprising 100 plants, were raised alongside the parents (15 plants each), F 1 (15 plants), and F 2 populations (250 plants) inside the net house (Supplementary Fig. 2). The seedlings were screened for SLCCNV by inoculation with viruliferous whiteflies, which were obtained from a pure culture of SLCCNV maintained in plants of the highly susceptible cultivar Pusa Vishwas. After a 24-h acquisition access period, the viruliferous whiteflies were collected from acquisition cages and introduced into a net house containing pumpkin plants. The viruliferous whiteflies were released on every alternate day to the pumpkin plants until symptoms developed on the susceptible plants. Observations were taken after the appearance of symptoms. The scoring for disease symptoms began at 8 days post-inoculation (dpi) and was subsequently conducted at weekly intervals for a duration of up to two months following the inoculation. Disease symptoms were scored according to the scale described by Islam et al. ( 2011 ). To confirm the presence of begomovirus in the samples, total nucleic acid was extracted from 100 mg of leaf tissue from each pumpkin sample. The extracted DNA was then subjected to PCR amplification using primers specific to a partial region of the AV2 gene of begomoviruses, with an expected amplicon size of 538 bp. Statistical analyses SLCCNV resistance and susceptibility data were analyzed following six generations (P 1 , P 2 , F 1 , F 2 , B 1 , and B 2 ) with highly susceptible and resistant parents. Chi-square testing was employed based on the methodology of Babiker et al. ( 2009 ) to estimate the number of genes responsible for resistance to SLCCNV in these populations. where χ 2 = Chi-square test statistic, O = Observed number of individuals for each genotype, E = Expected number of individuals for each genotype on the basis of Mendelian ratios. Results Response of pumpkin genotypes to SLCCNV and CCYV under challenge inoculation Pumpkin genotypes were screened for susceptibility to SLCCNV and CCYV under whitefly inoculation in an insect-proof net house over two consecutive seasons (2021 rainy and 2022 spring summer). The variation in the vulnerability index (VI) at different time points ranging from 8 dpi (days post‒inoculation) to 40 dpi in the pumpkin genotypes was evaluated. The disease symptoms appeared at 8 dpi as small yellow spots on the youngest leaves of the susceptible lines. Within 24 dpi, the spots spread to cover the entire leaf area in highly susceptible lines, whereas disease progression was slower in moderately resistant lines. In these lines, the symptom coverage ranged from > 25 to 50% in the most severely affected plants. In contrast, genotypes categorized as highly susceptible and susceptible, exhibited the greatest increase in VI at 16 dpi, and this level remained consistent from 32 dpi onward. In 2021, the genotypes DPU-28, DPU-5, DPU-114, Pusa Vishwas and Pusa Vikas, which are classified under the highly susceptible category, showed rapid disease progression (rated from 0 to 5). The vulnerability indices and areas under the disease progression curves for SLCCNV and CCYV of the pumpkin genotypes are shown in Table 1 . The vulnerability index varied from 0 to 100.00 under the challenge inoculation conditions. In 2021, four genotypes (DPU-41, DPU-43, DPU-133 and DPU-105) exhibited a resistance level of VI = 0, indicating that they were highly resistant to SLCCNV and CCYV. Two genotypes (DPU-101 and DPU-129) were classified as resistant to SLCCNV and CCYV, with resistance levels ranging from VI = 1.66–5.0. Additionally, nineteen genotypes were classified as highly susceptible to SLCCNV and CCYV, with resistance levels ranging from VI = 76.66–100.0. In 2022 (spring summer season), the study was repeated, and the results were similar to those of the previous year. The four genotypes, DPU-41, DPU-43, DPU-133 and DPU-105 remained symptomless (VI = 0) to SLCCNV and CCYV. In 2021 and 2022, the 19 genotypes were highly susceptible (VI = 76.66–100.0) to SLCCNV and CCYV (Table 2 ). In 2021, the area under the disease progress curve ranged from 13.28 to 2819.00 (excluding DPU-41, DPU-43, DPU-133 and DPU-105, where the AUDPC was 0), with the lowest recorded in DPU-101 (13.28) and the highest in Pusa Vishwas (2819.96) (Table 2 ). The results for the lowest and highest mean values of VI and AUDPC were consistent, although the rankings of the genotypes differed. For example, genotype DPU-111 had a VI of 31.67% and was eighth in ranking on the VI scale but fifth in the AUDPC scale (Fig. 2 a, b). In 2022, the area under disease progress curve (AUDPC) ranged between 10.64 and 2880.00, with the exception of four genotypes (DPU-41, DPU-43, DPU-133 and DPU-105), where the AUDPC was recorded as 0 (Table 2 ). Among the other genotypes evaluated, DPU-101 showed the least disease progression with an AUDPC value of 10.64, whereas Pusa Vishwas exhibited the most extensive disease progression, with an AUDPC of 2880.00. The results for the lowest and highest mean values of VI and AUDPC were similar, but the rankings of the genotypes were not identical. For example, during 2022, the DPU-193 genotype had a VI of 31.67% which was ranked thirteenth in terms of the VI but fifteenth in terms of the AUDPC scale (Fig. 3 a, b). Table 1. Vulnerability index (VI) and area under the disease progress curve (AUDPC) of pumpkin genotypes against SLCCNV and CCYV under challenge inoculation Sl. no. Genotype 2021 Genotype 2022 Mean VI AUPDC Genotype class Mean VI AUPDC Genotype class 1 DPU-41 0 0 HR DPU-41 0 0 HR 2 DPU-43 0 0 HR DPU-43 0 0 HR 3 DPU-133 0 0 HR DPU-133 0 0 HR 4 DPU-105 0 0 HR DPU-105 0 0 HR 5 DPU-101 1.66 13.28 R DPU-101 1.33 10.64 R 6 DPU-129 5 73.28 R DPU-129 5.33 47.96 R 7 DPU-165 28.33 326.52 MR DPU-165 26.66 389.2 MR 8 Narendra Amrit 26.66 559.84 MR DPU-84 26.66 546.66 MR 9 DPU-84 28.33 619.82 MR Narendra Amrit 28.33 619.83 MR 10 DPU-92 28.33 593.24 MR DPU-57 31.67 566.56 MR 11 DPU-136 28.33 673.24 MR DPU-136 36.66 813.20 MR 12 DPU-111 31.67 566.56 MR DPU-92 38.33 819.88 MR 13 DPU-193 31.67 864.36 MR DPU-193 38.33 1086.80 MR 14 DPU-14 38.33 979.80 MR DPU-111 41.67 939.92 MR 15 DPU-60 38.33 833.24 MR DPU-131 41.67 1033.20 MR 16 DPU-57 43.33 866.52 MR DPU-54 43.33 1173.23 MR 17 DPU-131 43.33 946.60 MR DPU-63 43.33 919.88 MR 18 DPU-016K 43.33 866.52 MR DPU-14 48.33 1113.24 MR 19 DPU-54 48.33 1153.24 MR DPU-60 48.33 1273.32 MR 20 DPU-63 48.33 1099.96 MR DPU-016K 48.33 1153.16 MR 21 DPU-103 53.33 1173.16 S DPU-110 53.33 1493.32 S 22 DPU-7 55.00 1620.00 S DPU-115 55.00 1406.64 S 23 DPU-195 56.67 1626.76 S DPU-7 60.00 1693.28 S 24 DPU-104 58.33 1553.24 S DPU-27 60.00 1800.00 S 25 DPU-194 58.33 1579.96 S Narendra Agrim 60.00 1746.64 S 26 DPU-107 60.00 1666.64 S DPU-104 61.67 1633.32 S 27 DPU-149 60.00 1453.36 S DPU-149 61.67 1673.32 S 28 DPU-166 60.00 1800.00 S DPU-194 61.67 1638.72 S 29 DPU-27 61.67 1766.76 S DPU-103 63.33 1706.60 S 30 DPU-110 61.67 1660.04 S DPU-195 63.33 1826.60 S 31 DPU-115 61.67 1646.68 S DPU-53 66.67 1853.40 S 32 DPU-77 63.33 1906.60 S DPU-107 66.67 1880.04 S 33 DPU-53 65.00 1900.00 S DPU-166 68.33 1979.96 S 34 Narendra Agrim 66.67 1853.32 S DPU-77 68.33 2006.60 S 35 Punjab Samrat 76.66 2186.76 HS DPU-108 76.66 2000.04 HS 36 DPU-150 76.66 1933.40 HS DPU-113 76.66 2186.72 HS 37 Swarna Amrit 76.66 2140.04 HS DPU-151 78.33 2259.96 HS 38 DPU-113 78.33 2179.96 HS Punjab Samrat 80.00 1906.72 HS 39 DPU-151 80.00 2266.72 HS Swarna Amrit 85.00 2273.28 HS 40 DPU-112 85.00 2220.00 HS DPU-56 85.00 2486.72 HS 41 DPU-108 85.00 2306.64 HS DPU-112 86.67 2440.00 HS 42 DPU-56 88.33 2539.96 HS DPU-150 88.33 2359.92 HS 43 DPU-102 88.33 2313.32 HS DPU-117 90.00 2386.72 HS 44 DPU-117 88.33 2379.96 HS DPU-28 91.66 2540.04 HS 45 DPU-145 90.00 2600.00 HS DPU-102 91.66 2339.92 HS 46 DPU-29 91.67 2420.04 HS DPU-114 91.66 2660.04 HS 47 Anand Pumpkin-1 93.33 2333.32 HS DPU-145 91.66 2499.20 HS 48 DPU-S-4 93.33 2546.60 HS Pusa Vikas 91.66 2499.92 HS 49 DPU-55 96.66 2560.04 HS DPU-29 93.33 2372.32 HS 50 DPU-28 96.66 2626.68 HS DPU-55 93.33 2559.96 HS 51 DPU-5 98.33 2779.96 HS Anand Pumpkin-1 96.66 2626.68 HS 52 DPU-114 98.33 2606.60 HS DPU-5 96.66 2480.04 HS 53 Pusa Vishwas 98.33 2819.96 HS DPU-S-4 96.66 2360.04 HS 54 Pusa Vikas 100.00 2733.28 HS Pusa Vishwas 100.00 2880.00 HS Open in a new tab VI vulnerability index, HR highly resistant, R resistant, MR moderately resistant, S susceptible, HS highly susceptible Table 2. Correlation coefficient analysis among qualitative and quantitative variables of SLCCNV and CCYV on artificially screened (whitefly ‒ mediated) pumpkin genotypes against SLCCNV and CCYV during 2021 and 2022 Parameter VI (2021) AUPDC (2021) VI (2022) AUPDC (2022) VI (2021) 1 AUPDC (2021) 0.985** 1 VI (2022) 0.995** 0.985** 1 AUPDC (2022) 0.974** 0.968** 0.981** 1 Open in a new tab AUDPC area under disease progress curve, VI vulnerability index **Significant at P = 0.01 Fig. 2. Open in a new tab a Disease reactions to SLCCNV and CCYV under challenge inoculation in 2021, as determined by the mean VI values of the pumpkin genotypes. The data represent the average percentage of infected plants per genotype, with error bars indicating standard error of the mean (± SE). Genotypes were categorized as highly resistant, resistant, moderately resistant, susceptible and highly susceptible based on their VI scores. b Disease reactions to SLCCNV and CCYV based on AUDPC values of pumpkin genotypes under challenge inoculation in 2021. The AUDPC values represent the cumulative disease severity over time, providing a quantitative measure of disease progression in each genotype. Data are presented as mean AUDPC values with standard error (± SE) Fig. 3. Open in a new tab a Disease reactions to SLCCNV and CCYV under challenge inoculation in 2022 on the basis of the mean VI values of the pumpkin genotypes. The data represent the average percentage of infected plants per genotype, with error bars indicating standard error of the mean (± SE). Genotypes were categorized as highly resistant, resistant, moderately resistant, susceptible and highly susceptible based on their VI scores. b Disease reactions to SLCCNV and CCYV under challenge inoculation in 2022 on the basis of AUDPC values of pumpkin genotypes. The AUDPC values represent the cumulative disease severity over time, providing a quantitative measure of disease progression in each genotype. Data are presented as mean AUDPC values with standard error (± SE) The symptoms of SLCCNV and CCYV appeared simultaneously in all the plants of the susceptible lines (Fig. 4 ), whereas in the moderately resistant lines, symptoms appeared only sporadically in a few plants. No disease progression rate was observed for DPU-41, DPU-43, DPU-133 or DPU-105. These four genotypes consistently exhibited highly resistant reactions to SLCCNV and CCYV over the two-year period. The onset of disease symptoms in the moderately resistant genotypes was delayed compared with that in their susceptible counterparts. Fig. 4. Open in a new tab Various symptoms of different genotypes 24 days post-inoculation under controlled whitefly-mediated transmission of SLCCNV and CCYV. Visible symptoms include chlorosis, vein clearing, stunting, yellow patches and mosaic patterns, varying in intensity across genotypes; a DPU-103, b Anand Pumpkin-1, c DPU-136, d DPU-112, e DPU-107, f DPU-43, g DPU-5, h DPU-56, i Punjab Samrat, j DPU-55, k DPU-41, l DPU-102, m DPU-133, n DPU-28, o DPU-S-4, p DPU-115, q DPU-149 The fifty‒four pumpkin genotypes were screened for the presence or absence of SLCCNV and CCYV through PCR using SLCCNV- and CCYV-specific primers. PCR based analysis revealed the presence of SLCCNV in 50 samples and CCYV in 26 samples, generating 513 bp and 753 bp amplicons, respectively (Supplementary Table 3, Figs. 5 , 6 ). Furthermore, genotypes DPU-41, DPU-43, DPU-133 and DPU-105, which presented no symptoms, tested negative for both SLCCNV (Fig. 5 ) and CCYV (Fig. 6 ) in PCR, indicating that they are highly resistant to both viruses. Fig. 5. Open in a new tab Gel images representing amplification of SLCCNV in pumpkin genotypes: (1) DPU-5; (2) DPU-7; (3) DPU-14; (4) DPU-27; (5) DPU-28; (6) DPU-29; (7) DPU-41; (8) DPU-43; (9) DPU-53; (10) DPU-54; (11) DPU-55; (12) DPU-56; (13) DPU-57; (14) DPU-60; (15) DPU-63; (16) DPU-77; (17) DPU-84; (18) DPU-92; (19) DPU-102; (20) DPU-103; (21) DPU-104; (22) DPU-107; (23) DPU-108; (24) DPU-110; (25) DPU-111; (26) DPU-112; (27) DPU-113; (28) DPU-114; (29) DPU-115; (30) DPU-117; (31) DPU-131; (32) DPU-133; (33) DPU-136; (34) DPU-145; (35) DPU-149; (36) DPU-150; (37) DPU-151; (38) DPU-166; (39) DPU-193; (40) DPU-194; (41) DPU-195; (42) DPU-016K; (43) DPU-S-4; (44) Anand Pumpkin-1; (45) Narendra Agrim; (46) Narendra Amrit; (47) Punjab Samrat; (48) Pusa Vikas; (49) Pusa Vishwas; (50) Swarna Amrit. Amplified products were visualized on a 1.2% agarose gel stained with ethidium bromide. The presence of a specific band indicates successful amplification of the viral fragment, confirming SLCCNV infection in the respective genotype Fig. 6. Open in a new tab Gel images representing amplification of CCYV in pumpkin genotypes: (1) DPU-5; (2) DPU-7; (3) DPU-14; (4) DPU-27; (5) DPU-28; (6) DPU-29; (7) DPU-41; (8) DPU-43; (9) DPU-53; (10) DPU-54; (11) DPU-55; (12) DPU-56; (13) DPU-57; (14) DPU-60;(15) DPU-63; (16) DPU-77; (17) DPU-84; (18) DPU-92; (19) DPU-102; (20) DPU-103; (21) DPU-104; (22) DPU-107; (23) DPU-108; (24) DPU-110; (25) DPU-111; (26) DPU-112; (27) DPU-113; (28) DPU-114; (29) DPU-115; (30) DPU-117; (31) DPU-131; (32) DPU- 133; (34) DPU-14. Amplified products were visualized on a 1.2% agarose gel stained with ethidium bromide. The presence of a specific band indicates successful amplification of the viral fragment, confirming CCYV infection in the respective genotype The variables employed to evaluate disease, VI and AUDPC, exhibited highly significant positive correlations (> 0.96) for whitefly‒mediated screening during both 2021 and 2022 (Table 2 ). Screening of pumpkin germplasm for single infection of SLCCNV under controlled conditions During the spring–summer of 2023, an experiment was conducted within an insect-proof net house to evaluate the resistance of seven pumpkin genotypes, including the susceptible genotype Pusa Vishwas, to SLCCNV. Consistent with previous years, none of the highly resistant genotypes (DPU-41, DPU-43, DPU-133 and DPU-105) presented symptoms. Two genotypes (DPU-101 and DPU-129) were classified as resistant to SLCCNV, with resistance levels ranging from VI = 1.66–5.0 (Table 3 ). Table 3. Vulnerability index (VI) and area under the disease progress curve (AUDPC) of pumpkin genotypes against SLCCNV under challenge inoculation Genotype VI AUDPC Genotype class DPU-41 0 0 Highly resistant DPU-43 0 0 Highly resistant DPU-133 0 0 Highly resistant DPU-105 0 0 Highly resistant DPU-101 1.66 15.96 Resistant DPU-129 5.00 56.62 Resistant Pusa Vishwas 100 2654.43 Highly susceptible Open in a new tab Quantification of SLCCNV in pumpkin genotypes over time No viral Ct value was detected in any of the quantified samples from healthy control plants, underscoring the high sensitivity of the qPCR. This absence of detection indicates that the healthy control plants were indeed virus‒free, as expected. The ability of the qPCR technique to produce a clear distinction between infected and noninfected samples highlights its precision, ensuring that even low levels of viral DNA, if present, would have been reliably identified. This high sensitivity is crucial for accurately assessing the presence of viruses in plant samples, providing confidence in the results obtained from the experiment. Overall, the viral titer of SLCCNV was high after the 8th day of viruliferous whitefly inoculation in the susceptible genotype Pusa Vishwas and was 0.430 fold greater in the infected samples than in the healthy control plants. The viral load of the target gene (SLCCNV) decreases as the disease advances in later stages. After 24 days of viruliferous whitefly inoculation, the viral load in the susceptible genotype Pusa Vishwas decreased to a maximum extent, i.e., 0.0087 compared with the viral load at 8 days post-inoculation. A negligible viral load was observed in highly resistant genotypes and resistant genotypes throughout the study period (8th day to 24th day) (Fig. 7 ). Fig. 7. Open in a new tab Comparative analysis of the viral load of SLCCNV in highly resistant (DPU-41, DPU-43, DPU-105, DPU-133), resistant (DPU-101, DPU-129), and highly susceptible (Pusa Vishwas) pumpkin genotypes through qPCR. Viral DNA levels were normalized against a house keeping gene ( Actin ) using the 2 −ΔΔCt method Inheritance of resistance to SLCCNV in pumpkin During the spring‒summer seasons of 2021 and 2022, the SLCCNV susceptible genotype (Pusa Vishwas) was identified through whitefly‒mediated inoculation with the single virus SLCCNV. This susceptible genotype, along with two highly resistant genotypes (DPU-41, DPU-43) was used to develop the F 1 , F 2 , B 1 and B 2 generations. The inheritance pattern of resistance to SLCCNV was investigated in crosses involving Pusa Vishwas and DPU-41 and Pusa Vishwas and DPU-43 (Table 4 ). In Pusa Vishwas (HS) × DPU-41 (HR), all the plants in the F 1 generation were resistant to SLCCNV. Among the 250 plants in the F 2 population, 184 were resistant and 66 were susceptible to SLCCNV. The observed frequency of F 2 plants fit well to the expected ratio of 3 (resistant): 1 (susceptible), as evident from the nonsignificant χ 2 value of 0.26 ( P = 0.709). The B 1 (F 1 × Pusa Vishwas) population was segregated into 47 resistant and 53 susceptible plants for SLCCNV. The observed frequency of B 1 plants fit well to the expected ratio of 1 (resistant): 1 (susceptible), with a nonsignificant χ 2 value of 0.36 ( P = 0.7485). Additionally, the B 2 (F 1 × DPU-41) population was segregated into 100 resistant plants only, confirming that a single dominant gene governs resistance to SLCCNV in the genotype DPU-41. Table 4. Estimates of chi-square values and their probabilities for different Mendelian ratios for SLCCNV resistance in six generations in pumpkin Cross Generation Total number of plants R (observed value) R (expected value) S (observed value) S (expected value) Best fit mendelian ratio χ 2 value P value CROSS-I Pusa Vishwas P 1 15 0 0 15 15 DPU-41 P 2 15 15 15 0 0 Pusa Vishwas × DPU-41 F 1 15 15 0 Pusa Vishwas × DPU-41 F 2 250 184 187.5 66 62.5 3:1 0.261 0.709 (Pusa Vishwas × DPU-41) × Pusa Vishwas B 1 100 47 50 53 50 1:1 0.360 0.7485 (Pusa Vishwas × DPU-41) × DPU-41 B 2 100 100 100 0 0 CROSS-II Pusa Vishwas P 1 15 0 0 15 15 DPU-43 P 2 15 15 15 0 0 Pusa Vishwas × DPU-43 F 1 15 15 0 Pusa Vishwas × DPU-43 F 2 250 190 187.5 60 62.5 3:1 0.133 0.7150 (Pusa Vishwas × DPU-43) × Pusa Vishwas B 1 100 49 50 51 50 1:1 0.040 0.8415 (Pusa Vishwas × DPU-43) × DPU-43 B 2 100 100 100 0 0 Open in a new tab P values significant at P ≤ 0.05 level With respect to Pusa Vishwas (HS) × DPU-43 (HR), all the plants in the F 1 generation were resistant to SLCCNV (Table 4 ). Among the 250 plants in the F 2 population, 190 were resistant and 60 were susceptible to SLCCNV. The observed frequency of F 2 plants fit well to the expected ratio of 3 (resistant): 1 (susceptible) as evident from the nonsignificant χ 2 value of 0.133 ( P = 0.715). The B 1 (F 1 × Pusa Vishwas) population was segregated into 49 resistant and 51 susceptible plants for SLCCNV. The observed frequency of B 1 plants fit well to the expected ratio of 1 (resistant): 1 (susceptible) plant with non-significant χ 2 value of 0.04 ( P = 0.8415). Additionally, the B 2 (F 1 × DPU-43) population was segregated into 100 resistant plants only, confirming that a single dominant gene controls resistance to SLCCNV in the genotype DPU-43. Discussion Screening of different genotypes against SLCCNV and CCYV Chemical control of plant viruses is impractical since pesticides can only target the vectors, and their excessive use is harmful to health and the environment, with vectors developing resistance. Host resistance offers the most effective method for managing viral diseases, but begomoviruses evolve rapidly, overcoming resistance genes (Nigam 2021 ). Continuous identification of new resistance genes and integration of resistance to both viruses and their vectors is crucial for effective control, with molecular markers aiding in marker-assisted selection for durable resistance (Chen et al. 2021 ; Mundt 2018 ). The resistance shown by the DPU-41, DPU-43, DPU-133 and DPU-105 genotypes to SLCCNV and CCYV can be attributed to several factors, including whitefly’s nonpreference for certain genotypes under natural conditions, disease escape by specific genotypes, the presence of high levels of protective biochemicals such as phenols, lipoxygenase, and/or reactive oxygen species, or the absence of essential factors required for virus multiplication (Agrios 2005 ). More et al. ( 1993 ) reported six melon varieties exhibited strong resistance to cucumber green mottle mosaic virus (CGMMV). Kabelka and Grumet ( 1997 ) reported the cucumber inbred line TMG-1 showed resistance to multiple potyviruses. Similarly, Singh et al. ( 1999 ) reported that ridge gourd varieties like ‘Dodka,’ ‘Janhi,’ ‘Jhinga Tori,’ and ‘Dundul’ were highly tolerant to ridge gourd mosaic virus (RGMV). Khan et al. ( 2002 ) verified the presence of disease symptoms caused by cotton leaf curl virus (CoLCV) in upland cotton using PCR. The differential resistance could also be attributed to the interaction between the virus and the plant’s genetic makeup, highlighting the complex nature of virus resistance, which can vary between viral species and even among closely related virus strains (Mundt 2018 ). When utilizing resistance(s) from the pumpkin genotypes DPU-41, DPU-43, DPU-133 and DPU-105, it is essential to consider that these genotypes exhibit a high degree of resistance. The sharp decline in the viral load in the susceptible genotype Pusa Vishwas as the symptoms progressed suggested that although the virus initially established and proliferated within the plant, its replication was markedly suppressed as time progressed. The dramatic reduction, indicated by a 0.0087 fold change, means that less than 1% of the original viral load remained after 24 days. This decrease may be due to the plant’s natural defense mechanisms, a gradual decline in viral fitness, or environmental factors that could have limited the ability of the virus to maintain high replication levels. This significant decrease in viral load underscores the dynamic interaction between the host plant and the virus. As the host immune system recognizes the virus, it becomes better at controlling or limiting viral replication, resulting in a reduction in the viral load and a lower fold change. These findings suggest that the immune system of highly resistant varieties actively defends against infection. Therefore, as infection progresses, the virus may naturally transition to phases with reduced replication, leading to a decrease in the viral load and fold change. Inheritance of resistance to SLCCNV in pumpkin SLCCNV poses a significant threat to pumpkin cultivation in affected regions, causing substantial economic losses, which can range from 50 to 90%, depending on the stage and severity of the infection (Singh et al. 2009 ). Understanding the inheritance pattern of SLCCNV resistance in pumpkin genotypes is crucial for breeders to formulate effective breeding strategies for introgressing resistance to elite lines. In the present study, the resistance to SLCCNV in the DPU-41 and DPU-43 genotypes was found to be controlled by a single dominant gene. This was demonstrated by a 3:1 segregation ratio in the F 2 generation, consistent with a Mendelian model of monogenic dominant inheritance. In the backcross generation (B 1 ), a 1:1 ratio further confirmed the dominant genetic control. Reproductive isolation might have prevented the introduction of new genetic material into the isolated population, preserving the dominance of the ‘R’ allele. This isolation maintains genetic consistency and enhances the prevalence of the ‘R’ allele, ensuring its continued dominance across generations and reinforcing the Mendelian inheritance pattern. Thus, resistance to SLCCNV in the DPU-41 and DPU-43 genotypes is controlled by a single dominant gene. Additionally, the virus did not accumulate in the apices of inoculated DPU-41 and DPU-43 plants. The transfer of a single dominant gene conferring resistance to SLCCNV into elite pumpkin lines will be feasible. This finding is significant, as earlier studies suggested that SLCCNV resistance in the pumpkin line AVPU1426 was controlled by a single recessive gene (Dhillon et al. 2021 ). These results indicate that DPU-41 and DPU-43 represent novel sources of SLCCNV resistance in C. moschata and are governed by a single dominant gene. This study lays the groundwork for future breeding efforts aimed at enhancing resistance to SLCCNV. The next phase will involve mapping the genomic regions associated with SLCCNV resistance, with the goal of identifying molecular markers linked to these regions. The application of these markers will facilitate more efficient marker-assisted breeding, contributing to the development of pumpkin varieties with enhanced and durable resistance to SLCCNV. Distinct sources of resistance to different viruses have been identified within C. moschata . For example, resistance to Zucchini yellow mosaic virus (ZYMV) has been detected in four cultivars: Nigerian Local, Menina, Soler, and Nicklow’s Delight, with seven loci controlling the resistance (Pachner et al. 2011 ). ZYMV infection causes yellow mosaic patterns, leaf curling, stunted growth, and reduced fruit yield and quality. Infected plants may also show deformed fruit with yellow or mottled discoloration, impacting marketability (Pachner et al. 2011 ). Nigerian Local ( C. moschata ), carries dominant monogenic resistance to ZYMV, watermelon mosaic virus (WMV), and cucumber mosaic virus (CMV), as well as recessive monogenic resistance to papaya ringspot virus (PRSV) (Brown et al. 2003 ). Romero-Masegosa et al. ( 2020 ) identified a dominant resistance gene in BSUAL-252 against ToLCNDV. Verma et al. ( 2023b ) reported that SLCCNV resistance in a PVR-1343 × P-135 cross follows a recessive digenic inheritance, indicating different resistance mechanisms from those for potyviruses such as ZYMV, WMV, PRSV-W, and Cucumovirus such as CMV. Both the DPU-41 and DPU-43 genotypes presented no symptoms when inoculated and did not exhibit viral accumulation in their apices revealing that the virus was efficiently suppressed or unable to establish an infection. These findings indicate that DPU-41 and DPU-43 have strong resistance to SLCCNV, potentially through mechanisms like local resistance or systemic acquired resistance. Inheritance analysis revealed that resistance is controlled by a single dominant gene, which implies that the presence of just one copy of this gene is sufficient to confer complete resistance. Further research is essential to unravel the molecular mechanisms underlying the resistance observed in these pumpkin genotypes. Understanding these mechanisms will provide valuable insights into how resistance is activated and sustained at the genetic levels. Additionally, investigating these mechanisms will be crucial for leveraging this resistance in breeding programs aimed at developing pumpkin varieties that are not only resistant to viral infections like SLCCNV but also exhibit durable, stable resistance under field conditions. The coevolution of host plants and pathogens suggests that resistance genes are more likely to be present in plant materials from regions where the disease initially emerged (López et al. 2015 ). The discovery of distinct SLCCNV resistance genes opens up the possibility of combining these genes to create commercial cultivars with enhanced, long-lasting resistance to SLCCNV. This approach is akin to recent efforts in breeding oilseed pumpkins in C. pepo for resistance to ZYMV (Pachner et al. 2015 ), particularly if the genes operate through different mechanisms (Mundt 2018 ). The resistance of the DPU-41 and DPU-43 genotypes to SLCCNV is governed by a single dominant gene. Generally, dominant resistance to specific viruses, as well as certain fungi and bacteria, is often controlled by resistance genes (R genes), many of which encode nucleotide-binding domains and leucine-rich repeat (NBS-LRR) proteins. These R genes can initiate a resistance and hypersensitivity response when they interact with a pathogen’s avirulence (Avr) determinant (Maule et al. 2007 ; de Ronde et al. 2014 ). In contrast, recessive resistance is typically the result of mutations in susceptibility genes (S genes), which encode plant proteins essential for the pathogen’s interaction, movement, or replication within the host (Truniger and Aranda 2009 ). Natural resistance to the whitefly‒transmitted begomovirus, squash leaf curl virus (SqLCV) has been identified in several squash species, including C. ecuadorensis, C. lundelliana, C. foetidissima, and C. okeechobeensis (McCreight and Kishaba 1991 ). However, C. moschata is the most commonly used species for transferring virus resistance genes into C. pepo and carries genes conferring resistance to potyviruses (Paris et al. 1988 ; Formisano et al. 2010 ). Conclusively, the value of the backcross breeding method in creating virus‒resistant varieties lies in its ability to transfer resistance while preserving desirable traits and optimizing adaptation to local conditions. This method ensures the stability of the resistance trait and minimizes unwanted characteristics, resulting in effective, well adapted varieties. Conclusion This study identified two pumpkin genotypes, DPU-41 and DPU-43, which are highly resistant to SLCCNV and CCYV. These genotypes are valuable resources for breeding programs focused on enhancing resistance durability. Their resistance to SLCCNV is governed by a single dominant gene, and thus constitutes a novel finding for resistance breeding programmes in Cucurbita moschata . The distinct resistance mechanism observed in these genotypes, which has not been previously documented, indicates the presence of diverse genetic bases for viral resistance in pumpkin genotypes. This provides an opportunity for gene pyramiding strategies. The emergence of resistance-breaking virus isolates underscores the need for alternative resistance genes for increased durability. Harnessing these resistant lines through backcrossing method holds promise for developing robust, virus-resistant pumpkin varieties with desirable traits and adaptability to local conditions. Supplementary Information Below is the link to the electronic supplementary material. Supplementary file1 (DOC 11724 kb) (11.4MB, doc) Acknowledgements The authors are thankful to the Director, ICAR-Indian Agricultural Research Institute, New Delhi; Heads of Division of Plant Pathology, Division of Entomology, and Division of Vegetable Science; ICAR-Indian Agricultural Research Institute, New Delhi for providing facilities for conducting the experiments. The first author acknowledges the support provided by The Graduate School, ICAR-Indian Agricultural Research Institute, New Delhi in the form of Senior Research Fellowship during the study. Author contributions BMR: Investigation, Data curation, Formal analysis, Writing—original draft. AKS: Conceptualization, Resources, Supervision, Visualization, Methodology, Writing—review and editing. SS: Methodology, Supervision, Writing—review and editing. SGK: Conceptualization, Methodology, Supervision. AR: Methodology, Writing—review and editing. PKD: Supervision, Writing—review and editing. ADM: Supervision, Visualization. All authors read and approved the final manuscript. Funding There is no funding source in supporting this study. Data availability All data needed to evaluate the conclusions in the paper are present in the paper. Declarations Conflict of interest The authors have no competing interests to declare that are relevant to the content of this article. Ethical approval Not applicable. Consent to participate Not applicable. Consent for publication Not applicable. Footnotes Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. References Agrios GN (2005) Plant pathology. Elsevier Academic Press, New York [ Google Scholar ] Babiker E, Ibrahim AM, Yen Y, Stein J (2009) Identification of a microsatellite marker associated with stem rust resistance gene “sr35” in wheat. Aust J Crop Sci 3:195–200 [ Google Scholar ] Bananej K, Vahdat A (2008) Identification, distribution and incidence of viruses in field-grown cucurbit crops of Iran. Phytopathol Mediterr 47:247–257. 10.14601/Phytopathol_Mediterr-2728 [ Google Scholar ] Bos L (1982) Crop losses caused by viruses. Crop Prot 1:263–282. 10.1016/0261-2194(82)90002-3 [ Google Scholar ] Brown RN, Bolanos-Herrera A, Myers JR, Miller Jahn M (2003) Inheritance of resistance to four cucurbit viruses in Cucurbita moschata . Euphytica 129:253–258. 10.1023/A:1022224327064 [ Google Scholar ] Chen YJ, Lai HC, Lin CC, Neoh ZY, Tsai WS (2021) Genetic diversity, pathogenicity and pseudorecombination of cucurbit-infecting begomoviruses in Malaysia. Plants 10:2396. 10.3390/plants10112396 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] de Ronde D, Pasquier A, Ying S, Butterbach P, Lohuis D, Kormelink R (2014) Analysis of Tomato spotted wilt virus NSs protein indicates the importance of the N-terminal domain for avirulence and RNA silencing suppression. Mol Plant Pathol 15:185–195. 10.1111/mpp.12082 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Desbiez C, Joannon B, Wipf-Scheibel C, Chandeysson C, Lecoq H (2009) Emergence of new strains of Watermelon mosaic virus in South-eastern France: evidence for limited spread but rapid local population shift. Virus Res 141:201–208. 10.1016/j.virusres.2008.08.018 [ DOI ] [ PubMed ] [ Google Scholar ] Dhillon NP, Srimat S, Laenoi S, Bhunchoth A, Phuangrat B, Warin N, Kenyon L (2021) Resistance to three distinct begomovirus species in the agronomical superior tropical pumpkin line AVPU1426 developed at the World Vegetable Center. Agronomy 11:1256. 10.3390/agronomy11061256 [ Google Scholar ] Dinsdale A, Cook L, Riginos C, Buckley YM, Barro PD (2010) Refined global analysis of Bemisia tabaci (Hemiptera: Sternorrhyncha: Aleyrodoidea: Aleyrodidae) mitochondrial cytochrome oxidase 1 to identify species level genetic boundaries. Ann Entomol Soc Am 103(2):196–208. 10.1603/AN09061 [ Google Scholar ] FAO (2023) FAOSTAT statistical database 2021. Food and Agricultural Organization of the United Nations, Rome. http://www.fao.org/faostat/en/#data Formisano G, Paris HS, Frusciante L, Ercolano MR (2010) Commercial Cucurbita pepo squash hybrids carrying disease resistance introgressed from Cucurbita moschata have high genetic similarity. Plant Genet Resour 8:198–203. 10.1017/S1479262110000183 [ Google Scholar ] Gyoutoku Y, Okazaki S, Furuta A, Etoh T, Mizobe M, Kuno K, Hayashida S, Okuda M (2009) Chlorotic yellows disease of melon caused by Cucurbit chlorotic yellows virus, a new crinivirus. Jpn J Phytopathol 75:109–111. 10.37908/mkutbd.1098781. ( in Japanese with English abstract ) [ Google Scholar ] Hong Y, Wang X, Tian B, Cai J (1995) Chinese squash leaf curl virus: a new whitefly- transmitted geminivirus. Sci China Ser B 38:179–186 [ PubMed ] [ Google Scholar ] Islam S, Munshi AD, Verma M, Arya L, Mandal B, Behera TK, Kumar R, Lal SK (2011) Screening of Luffa cylindrica Roem. for resistance against Tomato Leaf Curl New Delhi Virus, inheritance of resistance, and identification of SRAP markers linked to the single dominant resistance gene. J Hortic Sci Biotechnol 86:661–667. 10.1080/14620316.2011.11512819 [ Google Scholar ] Kabelka E, Grumet R (1997) Inheritance of resistance to the Moroccan watermelon mosaic virus in the cucumber line TMG-1 and co-segregation with zucchini yellow mosaic virus resistance. Euphytica 95:237–242. 10.1023/A:1002987203987 [ Google Scholar ] Kanakala S, Ghanim M (2019) Global genetic diversity and geographical distribution of B. tabaci and its bacterial endosymbionts. PLoS ONE 14(3):e0213946. 10.1371/journal.pone.0213946 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Kassem MA, Sempere RN, Juárez M, Aranda MA, Truniger V (2007) Cucurbit aphid-borne yellows virus is prevalent in field-grown cucurbit crops of southeastern Spain. Plant Dis 91:232–238. 10.1094/PDIS-91-3-0232 [ DOI ] [ PubMed ] [ Google Scholar ] Khan SM, Javed N, Khan SM, Hussain MS (2002) Testing for cotton leaf curl virus resistance in candidate varieties/strains through different techniques. In: Integrated plant disease management, proceedings of the third national conference of plant pathology. NARC, Islamabad, Pakistan, pp 106–109 Kumari S, Krishnan N, Dubey V, Das B, Pandey KK, Singh J (2021) Investigations on annual spreading of viruses infecting cucurbit crops in Uttar Pradesh State, India. Sci Rep 11:1–17 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Kumari S, Krishnan N, Pandey KK (2022) Emergence of begomoviruses in cucurbits as a menace for its cultivation. In: Gaur RK, Sharma P, Czosnek H (eds) Geminivirus: detection, diagnosis and management. Academic Press, Cambridge, pp 107–124 [ Google Scholar ] Lecoq H, Katis N (2014) Control of cucurbit viruses. Adv Virus Res 90:255–296. 10.1016/B978-0-12-801246-8.00005-6 [ DOI ] [ PubMed ] [ Google Scholar ] Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 25:402–408. 10.1006/meth.2001.1262 [ DOI ] [ PubMed ] [ Google Scholar ] López C, Ferriol M, Picó MB (2015) Mechanical transmission of Tomato leaf curl New Delhi virus to cucurbit germplasm: selection of tolerance sources in Cucumis melo . Euphytica 204:679–691. 10.1007/s10681-015-1371 [ Google Scholar ] Maina S, Edwards OR, de Almeida L, Ximenes A, Jones RA (2017) First complete Squash leaf curl China virus genomic segment DNA-A sequence from East Timor. Genome Announc 5:e00483-e517. 10.1128/genomeA.00483-17 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Martín-Hernández AM, Picó B (2021) Natural resistances to viruses in cucurbits. Agronomy 11:23. 10.3390/agronomy11010023 [ Google Scholar ] Massumi H, Samei A, Pour AH, Shaabanian M, Rahimian H (2007) Occurrence, distribution, and relative incidence of seven viruses infecting greenhouse-grown cucurbits in Iran. Plant Dis 91:159–163. 10.1094/PDIS-91-2-0159 [ DOI ] [ PubMed ] [ Google Scholar ] Maule AJ, Caranta C, Boulton MI (2007) Sources of natural resistance to plant viruses: status and prospects. Mol Plant Pathol 8:223–231. 10.1111/j.1364-3703.2007.00386.x [ DOI ] [ PubMed ] [ Google Scholar ] McCreight JD, Kishaba AN (1991) Reaction of cucurbit species to squash leaf curl virus and sweetpotato whitefly. J Am Soc Hortic Sci 116:137–141 [ Google Scholar ] More TA, Varma A, Seshadri VS, Somkuwar RG, Rajamony L (1993) Breeding and development of cucumber green mottle mosaic virus (CGMMV) resistant lines in melon ( Cucumis melo L.). Rep-Cucurbit Genet Coop 16:44–46 [ Google Scholar ] Mundt CC (2018) Pyramiding for resistance durability: theory and practice. Phytopathol 108:792–802. 10.1094/PHYTO-12-17-0426-RVW [ DOI ] [ PubMed ] [ Google Scholar ] Muniyappa V, Maruthi MN, Babitha CR, Colvin J, Briddon RW, Rangaswamy KT (2003) Characterisation of pumpkin yellow vein mosaic virus from India. Ann Appl Biol 142:323–331. 10.1111/j.1744-7348.2003.tb00257.x [ Google Scholar ] Naganur P, Shankarappa KS, Mesta RK, Rao CD, Venkataravanappa V, Maruthi MN, Reddy LRCN (2023) Detecting Tomato Leaf Curl New Delhi Virus causing ridge gourd yellow mosaic disease, and other begomoviruses by antibody-based methods. Plants 12:490. 10.3390/plants12030490 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Navas-Castillo J, Fiallo-Olive E, Sanchez-Campos S (2011) Emerging virus diseases transmitted by whiteflies. Annu Rev Phytopathol 49:219–248. 10.1146/annurev-phyto-072910-095235 [ DOI ] [ PubMed ] [ Google Scholar ] Nebapure SM, Shankarganesh K, Rajna S, Naga KC, Pandey D, Gambhir S, Praveen KV, Subramanian S (2022) Dynamic changes in virus-induced volatiles in cotton modulate the orientation and oviposition behavior of the whitefly Bemisia tabaci . Front Physiol 13:1017948. 10.3389/fphys.2022.1017948 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Neoh ZY, Lai HC, Lin CC, Suwor P, Tsai WS (2023) Genetic diversity and geographic distribution of cucurbit-infecting begomoviruses in the Philippines. Plants 12:272. 10.3390/plants12020272 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Nigam D (2021) Genomic variation and diversification in begomovirus genome in implication to host and vector adaptation. Plants 10:1706. 10.3390/plants10081706 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Okuda M, Okazaki S, Yamasaki S, Okuda S, Sugiyama M (2010) Host range and complete genome sequence of Cucurbit chlorotic yellows virus, a new member of the genus Crinivirus . Phytopathol 100:560–566. 10.1094/PHYTO-100-6-0560 [ DOI ] [ PubMed ] [ Google Scholar ] Pachner M, Paris HS, Lelley T (2011) Genes for resistance to zucchini yellow mosaic in tropical pumpkin. J Hered 102:330–335. 10.1093/jhered/esr006 [ DOI ] [ PubMed ] [ Google Scholar ] Pachner M, Paris HS, Winkler J, Lelley T (2015) Phenotypic and marker-assisted pyramiding of genes for resistance to zucchini yellow mosaic virus in oilseed pumpkin ( Cucurbita pepo ). Plant Breed 134:121–128. 10.1111/pbr.12219 [ Google Scholar ] Paris HS, Cohen S, Burger Y, Yoseph R (1988) Single-gene resistance to zucchini yellow mosaic virus in Cucurbita moschata . Euphytica 37:27–29. 10.1007/BF00037219 [ Google Scholar ] Phaneendra C, Rao KS, Jain RK, Mandal B (2012) Tomato leaf curl New Delhi virus is associated with pumpkin leaf curl: a new disease in northern India. Indian J Virol 23:42–45. 10.1007/s13337-011-0054-z [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Radouane N, Ezrari S, Belabess Z, Tahiri A, Tahzima R, Massart S, Jijakli H, Benjelloun M, Lahlali R (2021) Viruses of cucurbit crops: current status in the Mediterranean Region. Phytopathol Mediterr 60:493–519. 10.36253/phyto-12340 [ Google Scholar ] Riyaz SM, Deepan S, Jesse M, Dharanivasan G, Kathiravan K (2015) New record of bipartite Squash leaf curl China virus (SLCCNV) and Croton yellow vein mosaic beta satellite associated with yellow vein disease of ash gourd in India. New Dis Rep 31:3. 10.5197/j.2044-0588.2015.031.003 [ Google Scholar ] Romero-Masegosa J, Martínez C, Aguado E, García A, Cebrián G, Iglesias-Moya J, Jamilena M (2020) Response of Cucurbita spp. to tomato leaf curl New Delhi virus inoculation and identification of a dominant source of resistance in Cucurbita moschata . Plant Pathol 70:206–218. 10.1111/ppa.13268 [ Google Scholar ] Sáez C, Martínez C, Montero-Pau J, Esteras C, Sifres A, Blanca J, Picó B (2020) A major QTL located in chromosome 8 of Cucurbita moschata is responsible for resistance to Tomato leaf curl New Delhi virus. Front Plant Sci 11:207. 10.3389/fpls.2020.00207 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Schafleitner R, Chen-Yu L, Laenoi S, Shu-Mei H, Srimat S, Gi-An L, Chatchawankanphanich O, Dhillon NP (2024) Molecular markers associated with resistance to squash leaf curl China virus and tomato leaf curl New Delhi virus in tropical pumpkin ( Cucurbita moschata Duchesne ex Poir.) breeding line AVPU1426. Sci Rep 14:6793. 10.1038/s41598-024-57348-9 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Silbernagel MJ, Jafari AM (1974) Temperature effects on curly top resistance in Phaseolus vulgaris . Phytopathol 64:825–827 [ Google Scholar ] Singh RP, Nie X, Singh M (1999) Tomato chlorotic dwarf viroid: an evolutionary link in the origin of pospiviroids. J Gen Virol 80:2823–2828. 10.1099/0022-1317-80-11-2823 [ DOI ] [ PubMed ] [ Google Scholar ] Singh R, Raj SK, Prasad V (2008) Molecular characterization of a strain of Squash leaf curl China virus from north India. J Phytopathol 156:222–228. 10.1111/j.1439-0434.2007.01347.x [ Google Scholar ] Singh AK, Mishra KK, Chattopadhyay B, Chakraborty S (2009) Biological and molecular characterization of a begomovirus associated with yellow mosaic vein mosaic disease of pumpkin from Northern India. Virus Genes 39:359–370. 10.1007/s11262-009-0396-4 [ DOI ] [ PubMed ] [ Google Scholar ] Sohrab SS (2005) Variability in the geminiviruses infecting cucurbits. Ph.D. thesis, Jamia Milia Islamia, New Delhi, India Syller J (2012) Facilitative and antagonistic interactions between plant viruses in mixed infections. Mol Plant Pathol 13:204–216. 10.1111/j.1364-3703.2011.00734.x [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Tahir M, Haider MS, Briddon RW (2010) First report of Squash leaf curl China virus in Pakistan. Australas Plant Dis Notes 5:21–24. 10.1071/DN10009 [ Google Scholar ] Truniger V, Aranda MA (2009) Recessive resistance to plant viruses. Adv Virus Res 75:119–159. 10.1016/S0065-3527(09)07504-6 [ DOI ] [ PubMed ] [ Google Scholar ] Varma A, Malathi VG (2003) Emerging geminivirus problems: a serious threat to crop production. Ann Appl Biol 142:145–164. 10.1111/j.1744-7348.2003.tb00240.x [ Google Scholar ] Verma N, Garcha KS, Sharma M, Sharma A, Dhatt AS (2023a) Gene effects for begomovirus resistance and plant architecture attributes in pumpkin ( Cucurbita moschata Duchesne). Czech J Genet Plant Breed 59:67–75. 10.17221/56/2022-CJGPB [ Google Scholar ] Verma N, Dhatt AS, Sharma A, Garcha KS, Sharma M, Bhatia D, Khosa JS, Kaur B (2023b) Genetics of begomovirus resistance in Cucurbita moschata Duchesne: a novel resistant source PVR-1343. Sci Hortic 322:112393. 10.1016/j.scienta.2023.112393 [ Google Scholar ] Associated Data This section collects any data citations, data availability statements, or supplementary materials included in this article. Supplementary Materials Supplementary file1 (DOC 11724 kb) (11.4MB, doc) Data Availability Statement All data needed to evaluate the conclusions in the paper are present in the paper. Articles from Physiology and Molecular Biology of Plants are provided here courtesy of Springer ACTIONS View on publisher site PDF (2.9 MB) Cite Collections Permalink RESOURCES Similar articles Cited by other articles Links to NCBI Databases Follow NCBI NCBI on X (formerly known as Twitter) NCBI on Facebook NCBI on LinkedIn NCBI on GitHub NCBI RSS feed Connect with NLM NLM on X (formerly known as Twitter) NLM on Facebook NLM on YouTube National Library of Medicine 8600 Rockville Pike Bethesda, MD 20894 Web Policies FOIA HHS Vulnerability Disclosure Help Accessibility Careers NLM NIH HHS USA.gov Back to Top

Related documents

• Whole-Genome Analysis of Mahsuri Rice and Its Blast-Resistant Mutant for Understanding Resistance Mechanisms#650010
• Detection and genetic characterization of Tembusu virus and other flaviviruses from mosquitoes in Lao PDR#269669
• Pathways to Recovery: Genomics and Resistance Assays for Tree Species Devastated by the Myrtle Rust Pathogen#382876
• The first record of Oxytropis nigrescens var. uniflora (Hooker) Barneby (Fabaceae), in Nunavik (Quebec, Canada)#314942
• Genetic analysis and mapping of adult plant stripe rust resistance loci in CIMMYT wheat ‘Kijil’ under Mexican and Chinese field environments#292692