Loss of Cathepsin Z enhances pro-inflammatory macrophage responses and promotes tissue regeneration.

Loss of Cathepsin Z enhances pro-inflammatory macrophage responses and promotes tissue regeneration - PMC Skip to main content An official website of the United States government Here's how you know Here's how you know Search Log in Primary site navigation Search Log in Search PMC Full-Text Archive Search in PMC Journal List User Guide As a library, NLM provides access to scientific literature. Inclusion in an NLM database does not imply endorsement of, or agreement with, the contents by NLM or the National Institutes of Health. Learn more: PMC Disclaimer | PMC Copyright Notice Dis Model Mech . 2026 Apr 29;19(4):dmm052520. doi: 10.1242/dmm.052520 Loss of Cathepsin Z enhances pro-inflammatory macrophage responses and promotes tissue regeneration Thais Sibioni Berti Bastos 1, *, ✉ , Catherine A Loynes 2, * , Zoë C Speirs 2, * , Jordana Dinorá de Lima 1 , Leonel Witckosk Junior 1 , André Guilherme Portela de Paula 1 , Andressa Pacheco Czaikovski 1 , Rebeca Bosso Santos Luz 1 , Lais Cavalieri Paredes 3 , Mia Norris 2 , Gillian S Tomlinson 2 , Wanderson Duarte da Rocha 4 , Stephen A Renshaw 2 , Philip M Elks 2, ✉ , Tarcio Teodoro Braga 1, ✉ Author information Article notes Copyright and License information 1 Basic Pathology Department, Biological Sciences Sector, Federal University of Paraná, Curitiba 81530-000, Brazil 2 Bateson Centre for Disease Mechanisms and Division of Clinical Medicine, School of Medicine and Population Health, University of Sheffield, Sheffield S10 2TN, UK 3 Biological Sciences Institute IV, University of São Paulo, São Paulo 05508-000, Brazil 4 Biochemistry Department, Biological Sciences Sector, Federal University of Paraná, Curitiba 81530-000, Brazil * These authors contributed equally to this work ✉ Authors for correspondence ( thaissibioni@ufpr.com ; p.elks@sheffield.ac.uk ; tarcio.braga@ufpr.br ) Handling Editor: David M. Tobin Competing interests The authors declare no competing or financial interests. Roles Thais Sibioni Berti Bastos : Data curation, Formal analysis, Investigation, Methodology, Validation, Visualization, Writing – original draft Catherine A Loynes : Methodology, Project administration, Validation, Writing – original draft, Writing – review & editing Zoë C Speirs : Data curation, Formal analysis, Investigation, Methodology, Validation, Visualization, Writing – original draft Jordana Dinorá de Lima : Formal analysis, Investigation, Validation, Writing – original draft Leonel Witckosk Junior : Formal analysis, Investigation, Validation, Writing – original draft André Guilherme Portela de Paula : Investigation, Writing – original draft Andressa Pacheco Czaikovski : Writing – original draft Rebeca Bosso Santos Luz : Writing – original draft Lais Cavalieri Paredes : Writing – original draft Mia Norris : Formal analysis Gillian S Tomlinson : Formal analysis, Investigation, Methodology, Validation Wanderson Duarte da Rocha : Supervision Stephen A Renshaw : Funding acquisition, Methodology, Project administration, Resources, Supervision, Writing – review & editing Philip M Elks : Conceptualization, Funding acquisition, Methodology, Project administration, Resources, Supervision, Writing – original draft, Writing – review & editing Tarcio Teodoro Braga : Conceptualization, Funding acquisition, Methodology, Project administration, Resources, Supervision, Writing – original draft, Writing – review & editing Received 2025 Jun 11; Accepted 2026 Feb 4; Collection date 2026 Apr 1. © 2026. Published by The Company of Biologists This is an Open Access article distributed under the terms of the Creative Commons Attribution License ( https://creativecommons.org/licenses/by/4.0 ), which permits unrestricted use, distribution and reproduction in any medium provided that the original work is properly attributed. PMC Copyright notice PMCID: PMC13225230  PMID: 42027136 ABSTRACT The plasticity of macrophages is well documented, with fundamental roles in modulating inflammation and promoting tissue repair, notably aiming to maintain homeostasis in multicellular organisms. However, the precise factors that regulate their polarization remain poorly understood. Cathepsin Z ( CTSZ ) encodes an enzyme highly expressed in macrophages and involved in various processes, such as migration, maturation and signal transduction, but its roles in regeneration are not described. Therefore, we used zebrafish models to investigate the roles of ctsz in macrophage polarization and regeneration in the context of sterile inflammation induced by caudal fin transection. CRISPR/Cas9-mediated knockdown of ctsz led to higher pro-inflammatory tnfα + macrophages than in control animals following injury (24-48 h post-injury), as well as accelerated regenerated area. Further studies in this field could prove valuable for the development of pharmacological approaches for chronic diseases characterized by impaired tissue regeneration, such as liver fibrosis or autoimmune diseases, in which dysregulated inflammation and regeneration play critical roles. Keywords: Zebrafish, Macrophages, Regeneration, Fibrosis Summary: Loss of CtsZ promotes a pro-inflammatory macrophage response that accelerates fin regeneration in zebrafish, highlighting CTSZ as a potential therapeutic target for tissue repair post injury. INTRODUCTION Wound healing is a complex biological process involving three overlapping phases (inflammation, proliferation and remodelling of the injured tissue), and macrophages actively participate in all these phases ( Krzyszczyk et al., 2018 ). While inflammation is essential for maintaining homeostasis, its dysregulation can lead to chronic conditions that contribute to diseases such as fibrosis, autoimmune disorders and cancer ( Gurevich et al., 2018 ; Rodríguez-Morales and Franklin, 2023 ). In addition, diseases such as type 2 diabetes, atherosclerosis and inflammatory bowel disease, for example, are characterized by chronic inflammatory processes ( Balde et al., 2024 ; Yang et al., 2024 ). Macrophages are central players in inflammation, with distinct phenotypes contributing to different stages of the inflammatory response. Pro-inflammatory (M1-like) macrophages promote inflammatory responses, whereas anti-inflammatory (M2-like) macrophages facilitate the resolution of inflammation and tissue repair ( Rodríguez-Morales and Franklin, 2023 ; Yang et al., 2024 ). Although this binary classification is widely used, it oversimplifies macrophage heterogeneity that occurs in vivo ; however, it remains useful for studying extreme polarization states ( Xue et al., 2024 ). Given their crucial role in regulating homeostasis and their involvement in various pathologies, macrophages are promising therapeutic targets for wound healing ( Ginhoux et al., 2016 ). Dysfunction in alternatively activated macrophages (typically M2-like) has been linked to increased extracellular matrix (ECM) deposition, resulting in tissue fibrosis ( Mosser and Edwards, 2008 ). Modulating the factors responsible for M2 macrophage polarization may, therefore, offer a therapeutic strategy to mitigate fibrosis progression ( Hu et al., 2023 ). Despite the well-documented plasticity of macrophages, the precise factors regulating their polarization remain poorly understood ( Novak and Koh, 2013 ). Moreover, a more detailed characterization of distinct macrophage populations is essential to advance our understanding of disease aetiology, alleviate pathological inflammation, promote tissue regeneration, and uncover the complex interactions between innate and adaptive immunity ( Mosser and Edwards, 2008 ; Xue et al., 2024 ). In vivo genetically modified animal models are crucial for elucidating the biological functions of specific genes within a complex organism, a perspective unattainable through cell culture alone ( Chang and Grieder, 2024 ; Soufizadeh et al., 2024 ). Mouse models have been instrumental in such studies, but in vivo imaging of inflammatory processes is challenging in mouse without surgical procedures, and manipulation of multiple genes is expensive ( Dawson et al., 2021 ; Lehman and Stairs, 2015 ). The zebrafish ( Danio rerio ), with its genetic tractability and translational relevance, is a powerful model for such studies, which are fundamental for identifying potential therapeutic targets ( Fujii et al., 2024 ; Howe et al., 2013 ). Here, we used the unique advantages that zebrafish embryos offer, including near-transparent larvae allowing in vivo imaging, immune cell transgenic lines and ease of CRISPR/Cas9 F0 knockdown. The zebrafish caudal fin amputation model ( Renshaw et al., 2006 ) has proven particularly suitable for studying the inflammatory process, from its onset to resolution, subsequently leading to tissue regeneration. Unlike humans, zebrafish possess a remarkable ability to regenerate complex tissues and organs, such as the heart, brain and fins ( Jimenez Gonzalez et al., 2023 ; Robertson and Huttenlocher, 2022 ). Moreover, macrophages play a pivotal role in caudal fin regeneration, yet the molecular mechanisms by which these cells mediate signalling remain poorly elucidated ( Nguyen-Chi et al., 2017 ; Tsarouchas et al., 2018 ). In adult zebrafish, macrophage ablation significantly reduces regeneration rates, while their absence during tissue growth alters the pattern of regenerated tissue. This suggests that distinct macrophage populations coordinate the regeneration of caudal fin tissues ( Nguyen-Chi et al., 2017 ; Petrie et al., 2014 ). Among the molecular players involved in macrophage biology, cathepsins have emerged as critical regulators of immune cell function. In humans, cathepsin Z (CTSZ), a lysosomal cysteine protease with carboxypeptidase activity, is predominantly expressed in immune cells such as monocytes, macrophages, dendritic cells and tumour-associated macrophages (TAMs) ( Garin et al., 2001 ; Journet et al., 2000 ; Szulc-Dąbrowska et al., 2020 ). This protease regulates processes such as migration, adhesion, proliferation, maturation, phagocytosis and signal transduction ( Fonović et al., 2017 ). Some recent studies have observed overexpression of CTSZ in macrophages infiltrating carcinoma, suggesting that it may serve as a specific macrophage marker and potentially as a prognostic and target biomarker ( Zhang et al., 2022 ). In order to identify novel regulators of anti-inflammatory macrophage phenotypes during regeneration, we performed bulk RNA-sequencing (RNAseq) analysis of existing human and zebrafish datasets. From this analysis, we selected ctsz alongside two other potential anti-inflammatory macrophages genes: P1, F-box associated domain containing ( nccrp1 ) and osteoclast stimulatory transmembrane protein ( ocstamp ) . Although less well characterized in the context of macrophage biology, nccrp1 has been implicated in innate immune responses ( Huang et al., 2024 ), and ocstamp is known to be involved in cell fusion processes, including those in macrophage-derived osteoclasts ( Yao et al., 2021 ). These genes were investigated for their potential roles in modulating macrophage phenotypes during regeneration. Among these, only ctsz mutations significantly altered both the macrophage polarization and the regenerative process; therefore, we propose that Ctsz functions as a modulator of the macrophage inflammatory response following injury, influencing regenerative outcomes. RESULTS Identification of candidate genes as markers for anti-inflammatory macrophages Publicly available RNAseq datasets were interrogated to identify candidate genes for anti-inflammatory macrophages in zebrafish larvae. To identify genes that could be translated to human models, an RNAseq dataset from polarized human monocyte-derived macrophages (MDMs) was compared to a dataset from fluorescence-activated cell sorting-sorted larval zebrafish Mycobacterium marinum ( Mm )-infected macrophages ( Baidžajevas et al., 2020 ; Rougeot et al., 2019 ). MDMs were isolated from eight donors and polarized towards M1 or M2 in vitro , providing a comprehensive transcriptome profile of human polarized macrophages ( Baidžajevas et al., 2020 ). The zebrafish dataset is the only RNAseq profile available of isolated larval macrophages, allowing interrogation of macrophage-specific gene expression, both under resting conditions and following immune challenge with Mm ( Rougeot et al., 2019 ). Furthermore, Mm challenge is known to modulate macrophages towards an M2-like phenotype ( Cronan et al., 2016 , 2021 ; Rougeot et al., 2019 ), thus increasing the likelihood of identifying potential anti-inflammatory macrophage marker genes that may also be present in M2-polarized MDMs. Genes upregulated in MDMs polarized towards an anti-inflammatory phenotype (IL-4 or IL-10 stimulated) and larval zebrafish Mm -infected macrophages were compared, and three candidate genes were identified in both datasets – ocstamp , ctsz and nccrp1 – based on differential gene expression after infection ( Fig. 1 ). In addition to being upregulated in MDMs polarized with IL-4 [1.48 log 2 fold change (FC); Fig. 1Ai ], OCSTAMP was found to be significantly downregulated in MDMs polarized towards a pro-inflammatory phenotype [IFNγ and lipopolysaccharide (LPS) stimulated; −0.65 log 2 FC; Fig. 1Ai ], and elevated ocstamp transcript levels were identified in zebrafish Mm -infected macrophages compared to uninfected macrophages [960.3 transcripts per kilobase million (TPM) compared to 2 TPM; Fig. 1B ]. Similarly, CTSZ was downregulated in M1-polarized MDMs (−0.38 log 2 FC) and significantly elevated when stimulated with IL-4 (0.54 log 2 FC; Fig. 1Aii ). ctsz transcript levels were high in infected and uninfected zebrafish macrophages (2586 TPM compared to 1587.3 TPM; Fig. 1B ). Finally, NCCRP1 was significantly upregulated in MDMs stimulated with IL-4 and IL-10 (6.01 log 2 FC and 1.08 log 2 FC, respectively), and also significantly upregulated in MDMs stimulated with IFNγ and LPS (5.62 log 2 FC; Fig. 1Aiii ). This gene was included as a candidate anti-inflammatory marker as nccrp1 was upregulated in zebrafish infected macrophages (1770 TPM compared to 367.7 TPM; Fig. 1B ). Fig. 1. Open in a new tab Comparison between RNA-sequencing (RNAseq) datasets obtained from human polarized macrophages and zebrafish Mycobacterium marinum ( Mm )-infected macrophages identified three candidate genes for anti-inflammatory macrophages. (Ai-iii) RNAseq of human macrophages polarized in vitro from eight donors ( Baidžajevas et al., 2020 ). M1 macrophages were polarized with IFNγ+LPS (M IFN+LPS ); M2-like macrophages were polarized with either IL-4 (M IL-4 ) or IL-10 (M IL-10 ). Polarized macrophages were compared to unpolarized ones. Expression of OCSTAMP (Ai), CTSZ (Aii) and NCCRP1 (Aiii) in polarized macrophages compared to unpolarized macrophages is shown. To comply with the ethical approval of the original study, data are presented as mean values only, as individual biological replicate data were not available for publication. FC, fold change. (B) RNAseq of 5 days post-infection isolated zebrafish macrophages following Mm infection ( Rougeot et al., 2019 ). For this analysis, 20 infected and uninfected cells were fluorescence-activated cell sorting (FACS) purified ( n =3 independent repeats) and used for cDNA synthesis, with resulting cDNA amplified for RNAseq. Data are means from three replicates; error bars depict s.e.m. No statistical differences were identified using an unpaired two-tailed t -test. (Ci-iii) Expression levels of these genes in four zebrafish blood cell types: erythrocytes, neutrophils, monocytes and thrombocytes. The atlas was generated with single-cell RNAseq (scRNAseq) of FACS-purified kidney-derived blood cells from eight transgenic and one non-transgenic fish, obtained from BASiCz – Blood Atlas of Single Cells in zebrafish. Interestingly, there is very little expression of ocstamp in adult zebrafish leukocyte populations (Ci). Expression of ctsz also shows minimal expression in leukocyte populations, but it is most prominently expressed in monocytes (Cii). This suggests that ocstamp and ctsz could be strong candidates for anti-inflammatory macrophages as low expression levels in unchallenged fish would be expected. However, nccrp1 is more widely expressed, particularly in both neutrophil and monocyte adult leukocyte populations (Ciii), suggesting that this gene may not be specific enough to be an anti-inflammatory macrophage marker. Each arm of the diagram indicates a haematopoietic cell population, and each dot represents separate single-cell RNAseq repeats performed. Populations are labelled on the image. Deeper colour indicates higher gene expression in that population. *False discovery rate (FDR)<0.05; **FDR<0.01; ****FDR<0.0001. Candidate gene expression in larval zebrafish haematopoietic populations indicates macrophage specificity To further determine expression levels of these candidate genes in zebrafish larvae, haematopoietic expression of the genes was assessed using Daniocell ( Sur et al., 2023 ). When macrophage clusters were assessed, nccrp1 could be identified in the haematopoietic uniform manifold approximation and projection (UMAP), with macrophage expression of nccrp1 across development [0.5-5 days post-fertilization (dpf)] remaining low, suggesting that it is not part of a developmental wave of gene expression changes and that it may be specific enough to label anti-inflammatory macrophages in vivo ( Fig. 2Ai ). Expression of ocstamp was not detected in the haematopoietic system; thus, no UMAP specifically of the haematopoietic system and macrophage cluster could be generated ( Fig. 2Aii ). Expression of ctsz across development from 3 h post-fertilization (hpf; ∼1000 cells) up to 5 dpf suggested highest expression at ∼4.5 dpf, before starting to fall again ( Fig. 2Aiii ). Fig. 2. Open in a new tab Under resting conditions, ctsz and nccrp1 are expressed in larval zebrafish macrophages, with very low expression levels of ocstamp in haematopoietic populations. (Ai-iii) Uniform manifold approximation and projections (UMAPs) of the larval haematopoietic/vasculature cluster: nccrp1 in the macrophage cluster within the haematopoietic system (Ai); ocstamp was not detected in the haematopoietic system (Aii); and ctsz expression across development suggests highest expression at ∼4.5 days post-fertilization (dpf) (Aiii). Timeline below UMAPs indicates gene expression across larval development up to 5 dpf. Zebrafish candidate genes share homology with human orthologues Zebrafish genes often have multiple isoforms of genes due to a genome duplication event ∼350 million years ago ( Hoegg et al., 2004 ); however, these three candidate genes ( ctsz , nccrp1 and ocstamp ) have only a single isoform, identified from the Ensembl database. Comparison of gene organization of zebrafish ctsz (ENSDARG00000043081), nccrp1 (ENSDARG00000035326) and ocstamp (ENSDARG00000022139) to human orthologues found high homology, with all three genes having the same number of exons as human counterparts. Human CTSZ and zebrafish ctsz share six exons. Although both have a small non-coding region at the start of exon 1, zebrafish ctsz has a larger non-coding region at the end of exon 6 compared to the human orthologue. Human CTSZ is larger than zebrafish ctsz (12.07 kb compared to 9.99 kb), and it is located on the reverse strand of chromosome 20, whereas zebrafish ctsz is located on the forward strand of chromosome 6 ( Fig. 3A ). Zebrafish ctsz shares synteny with human CTSZ , with gnas / GNAS , nelfcd / NELFCD and npepl1 / NPEPL1 genes in close proximity in both zebrafish and human genomes. Similarly, human NCCRP1 and zebrafish nccrp1 also have six exons, with both genes having a larger non-coding region at the end of exon 6. However, zebrafish nccrp1 has a larger non-coding region at the start of exon 1. As with the other candidate genes, human NCCRP1 is slightly larger than the zebrafish orthologue (4.92 kb compared to 3.91 kb), but both zebrafish nccrp1 and human NCCRP1 are located on forward chromosome strands (chromosome 5 and 19, respectively) ( Fig. 3A ). Zebrafish ocstamp , like human OCSTAMP , has three exons, with small non-coding regions at the beginning of exon 1 and the end of exon 3. Zebrafish ocstamp is smaller than the human orthologue (7.41 kb compared to 9.71 kb), and although human OCSTAMP is found on the reverse strand of chromosome 20, zebrafish ocstamp is located on the forward strand of chromosome 8 ( Fig. 3A ). Fig. 3. Open in a new tab Zebrafish gene organization of candidate genes share high homology with human orthologues. (A) Gene organization of human genes (yellow) and zebrafish gene (blue) orthologues share very similar exon numbers and coding exons. Exon maps were generated from the Ensembl database. Filled sections indicate coding exons; empty sections indicate non-coding exons. Chromosome number (ch), strand direction (FS, forward strand; RS, reverse strand) and gene size in kilobases (kb) are stated on exon maps. (B) Human and zebrafish protein sizes (aa, amino acids) of CTSZ and NCCRP1 encode proteins of very similar sizes. Zebrafish ocstamp is smaller than the human counterpart. Protein size was determined using the Ensembl database. (C) NCBI Blast Global Align comparing zebrafish sequences to human sequences identified high amino acid homology, depicted as percentage identities. The size of the proteins encoded by these candidate genes was assessed next. Zebrafish and human ctsz / CTSZ and nccrp1 / NCCRP1 encode proteins of very similar sizes [Ctsz, 301 amino acids (aa); CTSZ, 303 aa; Nccrp1, 237 aa; NCCRP1, 275 aa], with zebrafish ctsz and nccrp1 having conserved homology of 34% and 45%, respectively, for human orthologues ( Fig. 3B,C ). Looking at the overall protein size (in aa), zebrafish Ocstamp is smaller than the human counterpart (473 aa compared to 566 aa) ( Fig. 3B ). By using the NCBI Blast Global Align tool to compare human sequences to zebrafish orthologues, zebrafish ocstamp was found to share the highest identity match (46%) of the three candidate genes, indicating conserved amino acid homology ( Fig. 3C ). Together, these data identify additional candidate genes, which, following validation, could be used as markers for anti-inflammatory macrophages in zebrafish. Owing to the heterogeneity of the macrophage anti-inflammatory phenotype, this could allow us to further elucidate macrophage signalling. Additionally, the similarities in gene organization between human and zebrafish orthologues highlights a potentially conserved role of these genes between humans and zebrafish, suggesting that these candidate genes could translate to human systems. In situ hybridization confirms upregulation of ctsz expression following injury Given the ctsz expression in monocytes ( Fig. 1Cii ), in larval zebrafish macrophages ( Fig. 2Aiii ), its expression modulation through M1- and M2-like inducers ( Fig. 1Aii ), and the recent discovery that Ctsz plays a role in macrophage biology in tuberculosis context ( Meade et al., 2025 ), we decided to further perform in situ hybridization of ctsz in 3 dpf wild-type (WT) larvae to assess expression in unchallenged larvae and throughout an inflammatory time course, induced by tailfin injury. Unchallenged WT larvae expressed ctsz at 3 dpf ( Fig. 4A ) in cells overlying the heart cavity ( Fig. 4Bi ). Expression of ctsz was also seen in the intestinal bulb ( Fig. 4Bii ) and mid-intestine epithelium ( Fig. 4Biii ), where it is known to be involved in protein absorption in lysosome-rich enterocytes ( Childers et al., 2025 ). Following tailfin injury, ctsz expression could not be detected at the wound site until 24 h post-injury (hpi) ( Fig. 4C,D ), when expression was strong within recruited individual leukocytes (yellow arrowheads in Fig. 4D ). By 48 hpi, expression was still visible at the wound site but had markedly reduced compared to that at 24 hpi ( Fig. 4C,D ). These data and time points indicate that these cells are likely to be macrophages, as other leukocytes involved in the inflammatory process, such as neutrophils, accumulate up to 6 hpi and are removed by 24 hpi ( Gray et al., 2011 ). Fig. 4. Open in a new tab Wholemount in situ hybridization demonstrates ctsz expression in cells in the injured tailfin. (A-Biii) In situ hybridization of ctsz in unchallenged larvae at 3 dpf (A) highlighting cells overlying the heart cavity (Bi), the intestinal bulb (Bii) and mid-intestine (Biii). (C) Tailfin injury schematic view demonstrating the analysed area in the in situ hybridization of ctsz experiments. (D) Representative images of in situ hybridization of ctsz in unstimulated wild-type (WT) (top row) and injured WT (bottom row) larvae at different time points. Numbers at bottom right indicate the number of analysed animals. Yellow arrowheads indicate staining at recruited individual leukocytes. Yellow dashed line outlines the intestinal bulb. Scale bars: 1 mm (A); 500 µm (D); 330 µm (Bi). Crispants for ctsz knockdown demonstrate reduced transcript levels These data indicate ctsz is an interesting gene that may play a key role in dictating macrophage phenotype. To validate the ctsz crispants at the transcript level, in situ hybridization was performed in tyrosinase ( tyr ) and ctsz crispants to assess ctsz transcript levels and determine whether nonsense-mediated decay was occurring within these crispant larvae ( Fig. 5 ). All ctsz crispants showed reduced ctsz expression relative to tyr controls following tailfin injury at both 24 and 48 hpi, confirming effective gene knockdown. Within the ctsz crispant population, two distinct phenotypes were observed. Sixty-seven percent of larvae exhibited weak ctsz expression at both 24 and 48 hpi, with fewer than ten ctsz + cells visible at the wound site ( Fig. 5B , top row), indicating strong knockdown of gene expression. Thirty percent of the ctsz crispant larvae exhibited a higher level of ctsz at the wound site, with an average of ∼15 ctsz + cells present ( Fig. 5B , bottom row), indicating weaker knockdown with potentially functional transcripts produced. All of the ctsz knockdown fish, however, had lower ctsz expression compared to strong staining in ∼90% of tyr control larvae. Fig. 5. Open in a new tab ctsz in situ hybridization shows reduced expression in ctsz crispant larvae. (A) Tailfin injury schematic view demonstrating the analysed area in the in situ hybridization of ctsz experiments. (B) Representative images of in situ hybridization of tyrosinase (top row) and ctsz (middle and bottom rows) at 24 h post-injury (hpi) (left column) and 48hpi (right column). There were two phenotypes in the ctsz knockdown larvae: weak ctsz expression (middle row) and a relatively higher expression of ctsz at the wound site (lower row) at both 24 and 48 hpi. Numbers at bottom right indicate the numbers with that phenotype and total number of analysed larvae. Scale bar: 500 μm. ctsz crispant animals exhibit altered macrophage polarization upon fin fold injury Macrophages participate in all stages of tissue repair, with distinct phenotypes playing specific and critical roles throughout the process ( Wynn and Vannella, 2016 ). During resolution of inflammation, a prerequisite process for tissue remodelling and repair ( Sugimoto et al., 2019 ), bone marrow-derived inflammatory macrophages in mammals and renal-derived inflammatory macrophages in zebrafish often outnumber the tissue-resident macrophages ( Davies et al., 2013 ). Quantifying these inflammatory macrophages is essential for assessing the extent and progression of the inflammatory response. To achieve this, we aimed to quantify recruited macrophages using double-transgenic animals, Tg(mpeg1.1:nls-clover/tnfα:mcherry). These animals express nuclear-localized Clover specifically in macrophages, driven by the mpeg1 (also known as mpeg1.1 ) promoter, with mCherry fluorescent protein under the Tnfα (also known as Tnfa) pro-inflammatory cytokine promoter. This dual labelling allows the differentiation of pro-inflammatory macrophages from other phenotypes, as these cells exhibit overlapping fluorescence ( Fig. S1A-E ). ctsz crispant animals showed a significant increase in macrophage numbers at the wound site at 24 hpi, with numbers remaining high at 48 hpi ( Fig. 6A ). When analysing only the number of pro-inflammatory macrophages ( mpeg1 + tnfα + cells), crispant animals exhibited a significantly higher number at both 24 and 48 hpi compared to the control non-crispant group, with these increases not due to an overall increase in total macrophage number in non-wounded ctsz crispants ( Fig. 6B-F ). Fig. 6. Open in a new tab Evaluation and quantification of total and inflammatory macrophages in ctsz crispant larvae. (A,B) Quantification of the number of total macrophages ( mpeg1 + tnfα − cells; A) and pro-inflammatory macrophages ( mpeg1 + tnfα + cells; B) in transgenic Tg(mpeg1.1:nls-clover/tnfα:mcherry) tyrosinase control animals (pink) and crispants for the ctsz gene (blue) at 24 and 48 hpi. Each point represents a single larva. Data represent three independent repeats; ns, not significant; * P <0.05; ** P <0.01 (two-way ANOVA with Bonferroni post-test). (C) Counts of macrophages in unstimulated 2 dpf tyr (ten larvae) or ctsz (seven larvae) crispants with representative images, analysed by unpaired two-tailed t -test. Scale bar: 500 µm. (D) Representative image of the tailfin wound site of tyr control and ctsz crispant larvae obtained by confocal microscopy. Red dashed line indicates the circulation loop; yellow dashed yellow line indicates the region of the tailfin wound in which macrophages were imaged in subsequent images. Scale bar: 100 µm. (E) Representative images of macrophage (green) and tnfα (magenta) expression. Scale bar: 10 µm. (F) Representative images of the caudal inflammatory region, macrophage (green) and tnfα (magenta) expression of tyr control (top row) and ctsz crispant animals (bottom row) at 24 and 48 hpi. White, yellow and blue arrowheads indicate dual expression of mpeg1 and tnfα. Asterisk indicates cells with no tnfα expression. Scale bars: 50 µm. We additionally sought to identify any differences in macrophage numbers at the site of tissue regeneration in nccrp1 and ocstamp crispant animals. Using the transgenic zebrafish line TgBAC(csf1ra:eGFP)sh377 , in which macrophages express green fluorescent protein (GFP), we analysed macrophages based on the fluorescence intensity emitted by these cells. None of the genes knocked down were able to alter the number of macrophages at the injury site ( Fig. S2A,B ). Zebrafish larvae with mutations in ctsz exhibit enhanced caudal fin regeneration To investigate the in vivo functional role of the ctsz , nccrp1 and ocstamp genes during regeneration, crispant animals were subjected to a sterile inflammatory response followed by tissue regeneration. Caudal fin regeneration was assessed at three time points following fin fold transection: immediately after injury (0 hpi), and at 24 and 48 hpi. When comparing the regenerated area of crispants for the ctsz , nccrp1 and ocstamp genes with that of the tyr control animals at all time points, we observed that none of the crispants resulted in altered regeneration ( Fig. 7A-C ). We further assessed the amount of regeneration between 24 and 48 hpi in larvae in which an edit is detectable on a gel, indicating significant disruption to the gene and, potentially, its function. Crispants for the ctsz gene demonstrated higher regenerated area than did crispants for the tyr gene ( Fig. 7D ). In contrast, crispants for the nccrp1 and ocstamp genes showed no significant differences from tyr control animals ( Fig. 7E,F ). Altogether, these data suggest that, in addition to a greater number of M1-like cells, knockdown of ctsz leads to accelerated regeneration followed by tailfin injury in zebrafish. Fig. 7. Open in a new tab Regeneration area in crispants for ctsz , nccrp1 and ocstamp genes versus that in tyr control animals. (A-C) Regenerated area in crispants for the ctsz (A), nccrp1 (B) and ocstamp (C) genes versus that in tyr control animals. The normalized regenerated area was calculated for three intervals: regeneration during the first 24 hpi (area at 24 hpi−area at 0 hpi), regeneration during the second 24 hpi (area at 48 hpi−area at 24 hpi) and total regeneration up to 48 hpi (area at 48 hpi−area at 0 hpi). (D) Regeneration area during the second 24 hpi period (area at 48 hpi−area at 24 hpi) of ctsz crispant animals (blue) and tyr control (pink). (E) Regeneration area during the second 24 hpi of nccrp1 crispant animals (yellow) and tyr control (pink). (F) Regeneration area during the second 24 hpi of ocstamp crispant animals (dark blue) and tyr control (pink). In D-F, the analysis was performed in crispants for ctsz (D), nccrp1 (E) and ocstamp (F) genes only where an edit is detectable on a gel, indicating a significant disruption to the gene. Area is expressed in µm², and each point represents a single animal. Two-way ANOVA with Bonferroni multiple comparison test were applied (ns, not significant; * P <0.05); error bars represent mean±s.d. DISCUSSION This study identified three candidate genes for anti-inflammatory macrophage marker genes ( CTSZ , NCCRP1 , and OCSTAMP ) from M2-polarized human MDMs that have zebrafish orthologues. CTSZ mRNA levels have been found to be elevated in M2-like TAMs, suggesting that this gene is conserved in mammalian macrophages polarized towards an anti-inflammatory phenotype ( Cui et al., 2021 ). Currently, no studies have examined the potential role of NCCRP1 in determining macrophage phenotype, with human NCCRP1 being associated with squamous epithelium-containing tissues ( Kallio et al., 2011 ). However, its orthologue in several fish species (e.g. zebrafish, Atlantic salmon, Nile tilapia, northern snakehead, yellow croaker) has been associated with non-specific cytotoxic cells, particularly during infection challenge ( Hu et al., 2024 ; Jaso-Friedmann et al., 1997 ; Niu et al., 2020 ; Sun et al., 2024 ; Teng et al., 2023 ; Wu et al., 2021 ; Yao et al., 2024 ). Overexpression of Ocstamp has also been found to suppress M1 polarization in RAW264.7 cell culture, and although osteoclasts are a bone marrow-resident cells with phagocytic activity, they are derived from the macrophage lineage ( Lee et al., 2021 ; Yuan et al., 2017 ). Using CRISPR/Cas9, we generated deletions in ctsz , nccrp1 and ocstamp in zebrafish, achieving mutation efficiencies of 47.6%, 60% and 53%, respectively. Crispants for the ctsz gene exhibited a higher number of total recruited macrophages at 24 hpi than did controls, with an increased number of pro-inflammatory macrophages seen at 24 and 48 hpi. Functional analysis revealed that only ctsz mutations significantly altered the regenerative response, increasing the regeneration area between 24 and 48 hpi. Mutations in nccrp1 and ocstamp , in turn, did not result in any significant changes in the parameters assessed. Our findings indicate that ctsz plays a regulatory role in macrophage polarization following injury. Its deletion altered the balance between pro-inflammatory and anti-inflammatory macrophages, increasing tnfα + cells at 24 and 48 hpi in response to fin fold transection. Our data support the hypothesis that ctsz may act as an inflammatory modulator, and it is conceivable that ctsz plays a role in promoting M2 polarization. Previous studies have demonstrated the kinetics of macrophage recruitment during regeneration, showing that macrophages are rapidly recruited to the injury site and remain present for up to 3 days post-amputation. M1-like macrophages ( mpeg1 + / tnfα + ) peak at 6 h post-amputation (hpa), while M2-like macrophages ( mpeg1 + / tnfα − ) are present from 6 hpa to 3 days post-amputation, peaking between 24 and 72 hpa ( Bohaud et al., 2021 ; Nguyen-Chi et al., 2017 ). It has been shown that early vascular sprouting at the injury site depends on pro-inflammatory macrophages expressing vegfa ( Gurevich et al., 2018 ). Additionally, studies have demonstrated that early macrophage ablation impairs fin growth after amputation, whereas late depletion does not affect blastema cell proliferation ( Nguyen-Chi et al., 2017 ). In adult zebrafish, total macrophage ablation using the nitroreductase/metronidazole system has been shown to reduce regeneration at later time points ( Petrie et al., 2014 ). Our study, however, focused on the quantification of the regenerated area, and histological analyses could offer deeper insights into the architecture and organization of the regenerated tissue. Crispants for the ctsz gene exhibited a higher proportion of macrophages expressing tnfα at 24 and 48 hpi and increased regenerated area. The absence of ctsz could have led to an accelerated regenerative process, characterized by a more pronounced pro-inflammatory polarization of macrophages during the first 24 h of the inflammatory response. In both humans and zebrafish, macrophage migration and stromal remodelling depend on the degradation of the ECM by cathepsins and matrix metalloproteinases (MMPs) ( Travnickova et al., 2015 ). Blocking cathepsin activity has been shown to inhibit macrophage migration in Matrigel and collagen gel assays ( Hirakawa et al., 2007 ). Specific cathepsins – such as cathepsin S, B and L – play key roles in macrophage migration in various disease models, including atherosclerosis, transplant rejection and infection ( Christen et al., 2009 ; Hirakawa et al., 2007 ; Kitamoto et al., 2007 ). Moreover, macrophage migration and ECM remodelling have been linked to the expression of MMPs, as demonstrated in studies involving irf8 mutants ( Tsarouchas et al., 2018 ). CTSZ has been implicated in several inflammatory processes and malignancies ( Akkari et al., 2014 ; Dolenc et al., 2021 ; Mountford et al., 2020 ; Nägler et al., 2006 ). Although its role in health and disease is not fully understood, elevated plasma levels of CTSZ have been observed in patients with poor prognoses following trauma, suggesting its potential as a biomarker for inflammatory disorders ( Nägler et al., 2006 ). A CTSZ mouse mutant has linked cathepsins to breast cancer progression and metastasis and provides the option of further characterization of its role in macrophages in murine disease models ( Sevenich et al., 2010 ). It has also been demonstrated that CTSZ variants in humans and genetically diverse mice mediate tuberculosis disease severity ( Meade et al., 2025 ). Our findings suggest that ctsz regulates macrophage polarization dynamics following injury during the regeneration process. Its absence promotes an initial pro-inflammatory response, enhancing early regeneration. This highlights CTSZ as a potential therapeutic target for modulating inflammation and tissue regeneration. MATERIALS AND METHODS Zebrafish husbandry and ethics To study the inflammatory response of macrophages, we used TgBAC(csf1ra:eGFP)sh377 , as well as a Tg(mpeg1.1:nls-clover)sh436 ( Elworthy et al., 2023 ) and TgBAC(tnfα:mcherry)sh716 cross, known as Tg(mpeg1.1:nls-clover/tnfα:mcherry) . Adult zebrafish were maintained in a zebrafish rack system at 28°C with continuous water recirculation and a 14 h/10 h light/dark cycle. Adult fish were paired to obtain embryos. For experiments conducted in the UK, the zebrafish were raised at the Bateson Centre for Disease Mechanisms, University of Sheffield, in the Biological Services Aquaria approved by the UK Home Office and maintained according to standard protocols. All procedures were carried out on embryos <5 dpf, thus falling outside the scope of the Animals (Scientific Procedures) Act, and followed UK Home Office standards. Adult animals were covered under PPL 9853040C. For experiments conducted in Brazil, the zebrafish were raised in the Biological Sciences Facility at the Federal University of Paraná (UFPR). All experiments complied with the Brazilian Guidelines for Care and Use of Animals for Scientific and Teaching Purposes, established by the National Council for the Control of Animal Experimentation (CONCEA), and were approved by the Ethics Committee for Animal Use from the Biological Sciences Section of UFPR (CEUA/BIO – UFPR), under protocol number 1410 (process 23075.033243/2021-99). Published RNAseq data analysis A Microsoft Excel formula (see formula below, alphanumerics in bold are example cells) was used to identify mutual significantly upregulated genes in RNAseq datasets on IL-4/IL-10-polarized human MDMs and zebrafish macrophages infected with Mm . As only one gene was originally identified, genes upregulated in the human MDM dataset were also compared to non-significantly upregulated zebrafish genes to broaden the search. The MDM RNAseq dataset used to determine candidate genes can be accessed at doi:10.17632/j2hmt7k9fh.1 ( Baidžajevas et al., 2020 ). Zebrafish macrophage RNAseq datasets are available at the NCBI Gene Expression Omnibus under accession numbers GSE78954 (uninfected macrophages) and GSE68920 ( Mm -infected macrophages) ( Rougeot et al., 2019 ). Single-cell RNAseq data on adult zebrafish leukocytes can be accessed at BASiCz – Blood Atlas of Single Cells in zebrafish ( Athanasiadis et al., 2017 ). crRNA design and synthesis The selected target genes were ctsz (ENSDARG00000043081), nccrp1 (ENSDARG00000035326) and ocstamp (ENSDARG00000022139). Guides for targeting the zebrafish genome were designed using the online tool Custom Alt-R™ CRISPR-Cas9 guide RNA . A pair of guides was designed for each gene: one targeting the coding sequence and the other targeting the gene promoter region. Selection criteria for the sequences included proximity to the ATG start codon, localization within the first three exons, and on-target potential and off-target risk scores greater than 80. CRISPR/Cas9 reagents for microinjection The Alt-R™ CRISPR-Cas9 system consists of crRNA and tracrRNA (IDT) combined with Cas9 nuclease protein (IDT), which is recombinant, purified from a strain of Escherichia coli and derived from Streptococcus pyogenes . Transactivating RNAs (tracrRNAs) and gene-specific CRISPR RNAs (crRNAs) were resuspended in nuclease-free water at a concentration of 20 μM. The sequence of guides is shown in Table 1 . crRNA targeting the tyr gene, which encodes tyrosinase required for melanin synthesis, was used as a visual marker of editing efficiency ( Jao et al., 2013 ); successful knockdown results in an albino phenotype without affecting inflammatory responses. Larvae were also injected with guide RNAs targeting the genes ctsz , nccrp1 and ocstamp . The components were mixed in a 1:1:1 ratio of crRNA:tracrRNA:Cas9 protein. For guide hybridization, the crRNA and tracrRNA were first mixed and incubated at 95°C for 5 min. After incubation and cooling to room temperature, the Cas9 protein was added. To ensure complete complexation of the protein and the guide, the solution was incubated for 10 min before starting injections. Table 1. Summary of the CRISPR-Cas9 guide RNAs, the location relative to the gene start codon and the size of the deletion generated Gene Region Guide RNA (5′-3′) Deletion size ctsz ATG upstream TATAGAAGGTCATTACCCGT AGG 3185 bp CDS TTCATAGACTCATAAGGACG TGG nccrp1 ATG upstream AGTGATTCCACCTTGTGAAA TGG 5406 bp CDS CAATGCCTGACACCGTGGAC TGG ocstamp ATG upstream GAGGCCACTTCTGCAACTTG GGG 7897 bp CDS CCCGACACTGTTTACCCAAC AGG tyr CDS GGACTGGAGGACTTCTGGGG AGG − Open in a new tab The three nucleotides referring to the protospacer adjacent motif sequence are underlined. CDS, coding sequence. Genotyping of crispant larvae To validate and determine the efficiency of CRISPR/Cas9 in inducing gene-specific mutations, injected larvae were genotyped using PCR. Genomic DNA was extracted from individual larvae at 5 dpf. Each larva was placed in a 0.2 ml PCR tube containing 50 µl of 50 mM NaOH and heated at 95°C for 30 min in a thermocycler. 5 µl of 1 M Tris-HCl (pH 8.0) was then added to the reaction and thoroughly mixed by vortexing. 1 µl guide DNA was directly used as a template for the PCR reaction. The PCR was conducted using FirePol ® DNA polymerase (Solis BioDyne) to amplify the targeted genomic region. Gene-specific primers were designed with the Primer3 online tool (Primer3). For each gene, three primers were designed to amplify a WT allele, as well as an INDEL, in which both guides have successfully caused a DNA double-strand break. The primer sequences are shown in Table S1 . The PCR products were analysed by electrophoresis on a 2% agarose gel. Briefly, DNA samples were subjected to horizontal electrophoresis on a 2% agarose gel with SYBR™ safe DNA gel stain (Invitrogen, Thermo Fisher Scientific) in the TAE (Tris-acetate-EDTA) buffer. The electrophoresis chamber was connected to a power supply, and runs were performed at 110 V for 45 min. The run time was monitored by the migration of the molecular mass marker, and, after the run, the gel was revealed on a UVP transilluminator. The efficiency of the CRISPR system in generating mutations in the ctsz gene was 50.61%, because 41 of the 81 injected animals had detectable mutations in genotyping. The efficiency in generating mutations in the nccrp1 gene was 67.64% (changes in 69 of the 102 injected animals), and in the ocstamp gene it was 53% (changes in 35 of the 66 injected animals) ( Fig. S3 ). Induction of sterile inflammation in crispant larvae Zebrafish were dechorionated at 3 dpf using sterile laboratory tweezers, and the larvae were subsequently anesthetized in MS-222 Tricaine solution (0.168 mg/ml; Sigma-Aldrich) prepared in E3 medium. To induce an inflammatory response, the larvae were placed under a dissecting microscope (Leica Microsystems), where the caudal fin was transected using a scalpel blade (5 mm depth; WPI). The transection was made immediately posterior to the circulatory loop, ensuring that the loop remained intact, as previously described ( Renshaw et al., 2006 ). The larvae were then recovered and kept at 28°C in fresh E3 medium in 48-well plates. Caudal fin regeneration assay Zebrafish larvae from the TgBAC(csf1ra:eGFP)sh577 and Tg(mpeg1.1:nls-clover/tnfα:mcherry) lines were monitored via microscopy at different time points following caudal fin transection. A single brightfield z -slice image was acquired using a 20× objective on a Te2000-U Eclipse microscope (Nikon). A focused brightfield image of the circulatory loop in the tailfin was captured immediately after the injury (0 hpi) and subsequently at 24 and 48 hpi. The regenerated area was measured by drawing a line parallel to the notochord, starting from the circulatory loop and extending to the tail's distal edge. Regeneration quantification was performed using ImageJ software. The normalized regeneration rate was calculated for three intervals: regeneration during the first 24 hpi (area at 24 hpi−area at 0 hpi), regeneration during the second 24 hpi (area at 48 hpi−area at 24 hpi) and total regeneration up to 48 hpi (area at 48 hpi−area at 0 hpi). Generation of a Tg(tnfα:mCherry-F)sh716 transgenic line tnfα:eGFP-F - and mfap4:mCherry-F -containing plasmids (kind gifts from Dr Mai Nguyen-Chi, University of Montpellier, Montpellier, France) were digested using NotI-HF and SacI-HF to isolate the tnfα promoter (Gene ID: 405785) and farnesylated mCherry ( Nguyen-Chi et al., 2015 ). Digest products were purified and ligated (T4 ligase, NEB). Whole-plasmid sequencing was performed by Plasmidsaurus using Oxford Nanopore Technology with custom analysis and annotation. Forward (5′-TTGCGGCCGCTAATTGCTGTATGTCTTAAAG-3′) and reverse (5′-ATCAACATAAAATGAATCAATG-3′) primers were designed using SnapGene software to amplify the tnfα promoter via PCR, removing the ATG. The PCR product was purified and digested using NotI-HF (NEB) and ligated into the tnfα:mCherry-F vector at NotI-HF and EcoRV-HF (NEB) sites prior to transformation to competent E. coli cells (NEB). DNA was extracted and purified using a Qiagen MIDIprep kit according to the manufacturer's instructions, and whole-plasmid sequencing was performed by Plasmidsaurus to check for correct insertion. Cloned tnfα:mCherry-F plasmid was injected into single-cell-stage nacre embryos according to a published I-SceI meganuclease transgenesis protocol ( Soroldoni et al., 2009 ). To ensure that expression was macrophage specific, F0 adults were outcrossed to mpeg1:nls-clover. Founders identified were crossed to nacre WT fish, injured and screened. Subsequent embryos were screened for mCherry expression in the pharynx using a stereo microscope, as previously described ( Nguyen-Chi et al., 2015 ). Macrophage quantification assay for nccpr1 and oc stamp mutants Zebrafish larvae from the TgBAC(csf1ra:eGFP)sh577 line were monitored using fluorescence microscopy following caudal fin transection at 24 and 48 hpi. After the larvae were embedded in 1% low-melting-point agarose with tricaine, images were acquired using a Nikon Te2000-U Eclipse inverted fluorescence microscope. GFP fluorescence was detected using a filter set with excitation at 488 nm. Images were captured with a 20× objective, using a standard exposure time of 500 ms and a Z-piezo movement of 100 µM. Fluorescence intensity per pixel was analysed using ImageJ Fiji [National Institutes of Health (NIH)]. Z -stacks were compressed for maximum projection, and the region of interest for the regenerative area was delineated from the circulatory loop. Background subtraction was performed using a rolling ball radius of 50 pixels. Pixel intensity normalization was achieved by dividing the raw integrated density (RawIntDen) by the defined area. Because the pattern of GFP expression was not sufficient to delineate a single cell, the results were expressed as fluorescence intensity emitted by these cells. Total macrophage and pro-inflammatory macrophage assay in ctsz mutants For this assay, Tg(mpeg1:nls-clover/tnfα:mcherry) zebrafish were used. After embedding the animals in 1% low-melting-point agarose with tricaine, images were acquired using a Nikon Te2000-U Eclipse inverted fluorescence microscope. Clover fluorescence was detected using a filter set with excitation at 488 nm, and mCherry fluorescence was detected using a filter set with excitation at 543 nm and detected in the red detection channel (550–650 nm). Both lasers were set at an intensity of 5.00. High-resolution images were captured with a configuration of one frame every 4 s and a resolution of 1024. Images were captured with a 20× objective, using a standard exposure time of 500 ms and a Z-piezo movement of 100 µM. The image capture and processing software utilized was NIS Elements 4.20 Confocal. The number of macrophages at the tailfin wound was determined by manually counting cells that expressed clover, under the mpeg1 promoter. The number of inflammatory macrophages was determined by manually counting cells that expressed the fluorescent proteins mCherry under the tnfα promoter, which were co-expressed. The images were analysed using ImageJ/Fiji software (NIH). Whole-body macrophage numbers were assessed by counting the number of mpeg1 + cells in unstimulated tyr or ctsz crispants using TrackMate software ( Tinevez et al., 2017 ). Statistical analysis Statistical analyses were performed using GraphPad Prism software, applying two-way ANOVA with Bonferroni or Šidák multiple comparisons tests. Supplementary Material Supplementary information dmm-19-052520-s1.pdf (2.6MB, pdf) DOI: 10.1242/dmm.052520_sup1 Acknowledgements We thank the Advanced Fluorescence Technology Centre at UFPR for providing the facilities and support for acquiring the confocal microscopy images; the Biological Services Aquaria Team for fish care for practical assistance (University of Sheffield); and the Nguyen-Chi group (University of Montpellier) for the tnfα:eGFP-F and mfap4:mCherry-F plasmids used to generate the tnfα:mCherry-F transgenic line. Footnotes Author contributions Conceptualization: P.M.E., T.T.B.; Data curation: T.S.B.B., Z.C.S.; Formal analysis: T.S.B.B., Z.C.S., J.D.d.L., L.W.J., M.N., G.S.T.; Funding acquisition: S.A.R., P.M.E., T.T.B.; Investigation: T.S.B.B., Z.C.S., J.D.d.L., L.W.J., A.G.P.d.P., G.S.T.; Methodology: T.S.B.B., C.A.L., Z.C.S., G.S.T., S.A.R., P.M.E., T.T.B.; Project administration: C.A.L., S.A.R., P.M.E., T.T.B.; Resources: S.A.R., P.M.E., T.T.B.; Supervision: W.D.d.R., S.A.R., P.M.E., T.T.B.; Validation: T.S.B.B., C.A.L., Z.C.S., J.D.d.L., L.W.J., G.S.T.; Visualization: T.S.B.B., Z.C.S.; Writing – original draft: T.S.B.B., C.A.L., Z.C.S., J.D.d.L., L.W.J., A.G.P.d.P., A.P.C., R.B.S.L., L.C.P., P.M.E., T.T.B.; Writing – review & editing: C.A.L., S.A.R., P.M.E., T.T.B. Funding This work was supported by Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (Finance Code 001) . Z.C.S./P.M.E. are funded by a National Centre for the Replacement, Refinement and Reduction of Animals in Research (NC3Rs) training grant (NC/W001438/1). P.M.E. was funded by a Sir Henry Dale Fellowship jointly funded by the Wellcome Trust and the Royal Society (105570/Z/14/Z/A). Open Access funding provided by University of Sheffield. Deposited in PMC for immediate release. Data and resource availability All relevant data and details of resources can be found within the article and its supplementary information . Contributor Information Thais Sibioni Berti Bastos, Email: thaissibioni@ufpr.com. Philip M. Elks, Email: p.elks@sheffield.ac.uk. Tarcio Teodoro Braga, Email: tarcio.braga@ufpr.br. References Akkari, L., Gocheva, V., Kester, J. C., Hunter, K. E., Quick, M. L., Sevenich, L., Wang, H.-W., Peters, C., Tang, L. H., Klimstra, D. S.et al. (2014). Distinct functions of macrophage-derived and cancer cell-derived cathepsin Z combine to promote tumor malignancy via interactions with the extracellular matrix. Genes Dev. 28, 2134-2150. 10.1101/gad.249599.114 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Athanasiadis, E. I., Botthof, J. G., Andres, H., Ferreira, L., Lio, P. and Cvejic, A. (2017). Single-cell RNA-sequencing uncovers transcriptional states and fate decisions in haematopoiesis. Nat. Commun. 8, 2045. 10.1038/s41467-017-02305-6 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Baidžajevas, K., Hadadi, É., Lee, B., Lum, J., Shihui, F., Sudbery, I., Kiss-Tóth, E., Wong, S. C. and Wilson, H. L. (2020). Macrophage polarisation associated with atherosclerosis differentially affects their capacity to handle lipids. Atherosclerosis 305, 10-18. 10.1016/j.atherosclerosis.2020.05.003 [ DOI ] [ PubMed ] [ Google Scholar ] Balde, A., Ramya, C. S. and Nazeer, R. A. (2024). A review on current advancement in zebrafish models to study chronic inflammatory diseases and their therapeutic targets. Heliyon 10, e31862. 10.1016/j.heliyon.2024.e31862 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Bohaud, C., Johansen, M. D., Jorgensen, C., Ipseiz, N., Kremer, L. and Djouad, F. (2021). The role of macrophages during zebrafish injury and tissue regeneration under infectious and non-infectious conditions. Front. Immunol. 12, 707824. 10.3389/fimmu.2021.707824 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Chang, M. C. J. and Grieder, F. B. (2024). The continued importance of animals in biomedical research. Lab. Anim. 53, 295-297. 10.1038/s41684-024-01458-4 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Childers, L., Park, J., Wang, S., Liu, R., Barry, R., Watts, S. A., Rawls, J. F. and Bagnat, M. (2025). Protein absorption in the zebrafish gut is regulated by interactions between lysosome rich enterocytes and the microbiome. eLife 13, RP100611. 10.7554/eLife.100611 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Christen, T., Nahrendorf, M., Wildgruber, M., Swirski, F. K., Aikawa, E., Waterman, P., Shimizu, K., Weissleder, R. and Libby, P. (2009). Molecular imaging of innate immune cell function in transplant rejection. Circulation 119, 1925-1932. 10.1161/CIRCULATIONAHA.108.796888 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Cronan, M. R., Beerman, R. W., Rosenberg, A. F., Saelens, J. W., Johnson, M. G., Oehlers, S. H., Sisk, D. M., Jurcic Smith, K. L., Medvitz, N. A., Miller, S. E.et al. (2016). Macrophage epithelial reprogramming underlies mycobacterial granuloma formation and promotes infection. Immunity 45, 861-876. 10.1016/j.immuni.2016.09.014 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Cronan, M. R., Hughes, E. J., Brewer, W. J., Viswanathan, G., Hunt, E. G., Singh, B., Mehra, S., Oehlers, S. H., Gregory, S. G., Kaushal, D.et al. (2021). A non-canonical type 2 immune response coordinates tuberculous granuloma formation and epithelialization. Cell 184, 1757-1774.e14. 10.1016/j.cell.2021.02.046 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Cui, C., Chakraborty, K., Tang, X. A., Schoenfelt, K. Q., Hoffman, A., Blank, A., McBeth, B., Pulliam, N., Reardon, C. A., Kulkarni, S. A.et al. (2021). A lysosome-targeted DNA nanodevice selectively targets macrophages to attenuate tumours. Nat. Nanotechnol. 16, 1394-1402. 10.1038/s41565-021-00988-z [ DOI ] [ PubMed ] [ Google Scholar ] Davies, L. C., Jenkins, S. J., Allen, J. E. and Taylor, P. R. (2013). Tissue-resident macrophages. Nat. Immunol. 14, 986-995. 10.1038/ni.2705 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Dawson, C. A., Mueller, S. N., Lindeman, G. J., Rios, A. C. and Visvader, J. E. (2021). Intravital microscopy of dynamic single-cell behavior in mouse mammary tissue. Nat. Protoc. 16, 1907-1935. 10.1038/s41596-020-00473-2 [ DOI ] [ PubMed ] [ Google Scholar ] Dolenc, I., Štefe, I., Turk, D., Taler-Verčič, A., Turk, B., Turk, V. and Stoka, V. (2021). Human cathepsin X/Z is a biologically active homodimer. Biochim. Biophys. Acta Proteins Proteomics 1869, 140567. 10.1016/j.bbapap.2020.140567 [ DOI ] [ PubMed ] [ Google Scholar ] Elworthy, S., Rutherford, H. A., Prajsnar, T. K., Hamilton, N. M., Vogt, K., Renshaw, S. A. and Condliffe, A. M. (2023). Activated PI3K delta syndrome 1 mutations cause neutrophilia in zebrafish larvae. Dis. Model. Mech. 16, dmm049841. 10.1242/dmm.049841 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Fonović, U. P., Mitrović, A., Knez, D., Jakoš, T., Pišlar, A., Brus, B., Doljak, B., Stojan, J., Žakelj, S., Trontelj, J.et al. (2017). Identification and characterization of the novel reversible and selective cathepsin X inhibitors. Sci. Rep. 7, 11459. 10.1038/s41598-017-11935-1 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Fujii, K., Yamakawa, K., Takeda, Y., Okuda, N., Takasu, A. and Ono, F. (2024). Understanding the pathophysiology of acute critical illness: translational lessons from zebrafish models. Intensive Care Med. Exp. 12, 8. 10.1186/s40635-024-00595-x [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Garin, J., Diez, R., Kieffer, S., Dermine, J.-F., Duclos, S., Gagnon, E., Sadoul, R., Rondeau, C. and Desjardins, M. (2001). The phagosome proteome: insight into phagosome functions. J. Cell Biol. 152, 165-180. 10.1083/jcb.152.1.165 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Ginhoux, F., Schultze, J. L., Murray, P. J., Ochando, J. and Biswas, S. K. (2016). New insights into the multidimensional concept of macrophage ontogeny, activation and function. Nat. Immunol. 17, 34-40. 10.1038/ni.3324 [ DOI ] [ PubMed ] [ Google Scholar ] Gray, C., Loynes, C. A., Whyte, M. K. B., Crossman, D. C., Renshaw, S. A. and Chico, T. J. A. (2011). Simultaneous intravital imaging of macrophage and neutrophil behaviour during inflammation using a novel transgenic zebrafish. Thromb. Haemostasis 105, 811-819. 10.1160/TH10-08-0525 [ DOI ] [ PubMed ] [ Google Scholar ] Gurevich, D. B., Severn, C. E., Twomey, C., Greenhough, A., Cash, J., Toye, A. M., Mellor, H. and Martin, P. (2018). Live imaging of wound angiogenesis reveals macrophage orchestrated vessel sprouting and regression. EMBO J. 37, e97786. 10.15252/embj.201797786 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Hirakawa, H., Pierce, R. A., Bingol-Karakoc, G., Karaaslan, C., Weng, M., Shi, G.-P., Saad, A., Weber, E., Mariani, T. J., Starcher, B.et al. (2007). Cathepsin S deficiency confers protection from neonatal hyperoxia-induced lung injury. Am. J. Respir. Crit. Care. Med. 176, 778-785. 10.1164/rccm.200704-519OC [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Hoegg, S., Brinkmann, H., Taylor, J. S. and Meyer, A. (2004). Phylogenetic timing of the fish-specific genome duplication correlates with the diversification of teleost fish. J. Mol. Evol. 59, 190-203. 10.1007/s00239-004-2613-z [ DOI ] [ PubMed ] [ Google Scholar ] Howe, K., Clark, M. D., Torroja, C. F., Torrance, J., Berthelot, C., Muffato, M., Collins, J. E., Humphray, S., McLaren, K., Matthews, L.et al. (2013). The zebrafish reference genome sequence and its relationship to the human genome. Nature 496, 498-503. 10.1038/nature12111 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Hu, M., Yao, Z., Xu, L., Peng, M., Deng, G., Liu, L., Jiang, X. and Cai, X. (2023). M2 macrophage polarization in systemic sclerosis fibrosis: pathogenic mechanisms and therapeutic effects. Heliyon 9, e16206. 10.1016/j.heliyon.2023.e16206 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Hu, C., Zhang, N., Hong, Y., Tie, R., Fan, D., Lin, A., Chen, Y., Xiang, L. and Shao, J. (2024). Single-cell RNA sequencing unveils the hidden powers of zebrafish kidney for generating both hematopoiesis and adaptive antiviral immunity. eLife 13, RP92424. 10.7554/eLife.92424.2 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Huang, M., Zhang, Z., Li, X., Feng, J., Huang, Y., Kwaku, A., Huang, Y. and Jian, J. (2024). Molecular characteristics and functional analysis of non-specific cytotoxic cell receptor (NCCRP1) in golden pompano (Trachinotus ovatus). Fish Shellfish Immunol. 145, 109344. 10.1016/j.fsi.2023.109344 [ DOI ] [ PubMed ] [ Google Scholar ] Jao, L.-E., Wente, S. R. and Chen, W. (2013). Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc. Natl Acad. Sci. USA 110, 13904-13909. 10.1073/pnas.1308335110 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Jaso-Friedmann, L., Leary, J. H., III and Evans, D. L. (1997). NCCRP-1: a novel receptor protein sequenced from teleost nonspecific cytotoxic cells. Mol. Immunol. 34, 955-965. 10.1016/S0161-5890(97)00086-2 [ DOI ] [ PubMed ] [ Google Scholar ] Jimenez Gonzalez, A., Baranasic, D. and Müller, F. (2023). Zebrafish regulatory genomic resources for disease modelling and regeneration. Dis. Model. Mech. 16, dmm050280. 10.1242/dmm.050280 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Journet, A., Chapel, A., Kieffer, S., Louwagie, M., Luche, S. and Garin, J. (2000). Towards a human repertoire of monocytic lysosomal proteins. Electrophoresis 21, 3411-3419. 10.1002/1522-2683(20001001)21:16<3411::AID-ELPS3411>3.0.CO;2-M [ DOI ] [ PubMed ] [ Google Scholar ] Kallio, H., Tolvanen, M., Jänis, J., Pan, P.-W., Laurila, E., Kallioniemi, A., Kilpinen, S., Tuominen, V. J., Isola, J., Valjakka, J.et al. (2011). Characterization of non-specific cytotoxic cell receptor protein 1: a new member of the lectin-type subfamily of F-box proteins. PLoS ONE 6, e27152. 10.1371/journal.pone.0027152 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Kitamoto, S., Sukhova, G. K., Sun, J., Yang, M., Libby, P., Love, V., Duramad, P., Sun, C., Zhang, Y., Yang, X.et al. (2007). Cathepsin L deficiency reduces diet-induced atherosclerosis in low-density lipoprotein receptor–knockout mice. Circulation 115, 2065-2075. 10.1161/CIRCULATIONAHA.107.688523 [ DOI ] [ PubMed ] [ Google Scholar ] Krzyszczyk, P., Schloss, R., Palmer, A. and Berthiaume, F. (2018). The role of macrophages in acute and chronic wound healing and interventions to promote pro-wound healing phenotypes. Front. Physiol. 9, 419. 10.3389/fphys.2018.00419 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Lee, H. Y., Cho, K. M., Kim, M. K., Lee, M., Kim, H., Choi, C. Y., Kim, K. K., Park, J. S., Kim, H.-H. and Bae, Y.-S. (2021). Sphingosylphosphorylcholine blocks ovariectomy-induced bone loss by suppressing Ca2+ /calmodulin-mediated osteoclast differentiation. J. Cell. Mol. Med. 25, 473-483. 10.1111/jcmm.16101 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Lehman, H. L. and Stairs, D. B. (2015). Single and multiple gene manipulations in mouse models of human cancer. Cancer Growth Metastasis 8 Suppl. 1, 1-15. 10.4137/CGM.S21217 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Meade, R. K., Adefisayo, O. O., Gontijo, M. T. P., Harris, S. J., Pyle, C. J., Wilburn, K. M., Ecker, A. M. V., Hughes, E. J., Garcia, P. D., Ivie, J.et al. (2025). Cathepsin Z is a conserved susceptibility factor underlying tuberculosis severity. PLoS Biol. 23, e3003377. 10.1371/journal.pbio.3003377 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Mosser, D. M. and Edwards, J. P. (2008). Exploring the full spectrum of macrophage activation. Nat. Rev. Immunol. 8, 958-969. 10.1038/nri2448 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Mountford, S. J., Anderson, B. M., Xu, B., Tay, E. S. V., Szabo, M., Hoang, M.-L., Diao, J., Aurelio, L., Campden, R. I., Lindström, E.et al. (2020). Application of a sulfoxonium ylide electrophile to generate cathepsin X-selective activity-based probes. ACS Chem. Biol. 15, 718-727. 10.1021/acschembio.9b00961 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Nägler, D. K., Lechner, A. M., Oettl, A., Kozaczynska, K., Scheuber, H.-P., Gippner-Steppert, C., Bogner, V., Biberthaler, P. and Jochum, M. (2006). An enzyme-linked immunosorbent assay for human cathepsin X, a potential new inflammatory marker. J. Immunol. Methods 308, 241-250. 10.1016/j.jim.2005.11.002 [ DOI ] [ PubMed ] [ Google Scholar ] Nguyen-Chi, M., Laplace-Builhe, B., Travnickova, J., Luz-Crawford, P., Tejedor, G., Phan, Q. T., Duroux-Richard, I., Levraud, J.-P., Kissa, K., Lutfalla, G.et al. (2015). Identification of polarized macrophage subsets in zebrafish. eLife 4, e07288. 10.7554/eLife.07288 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Nguyen-Chi, M., Laplace-Builhé, B., Travnickova, J., Luz-Crawford, P., Tejedor, G., Lutfalla, G., Kissa, K., Jorgensen, C. and Djouad, F. (2017). TNF signaling and macrophages govern fin regeneration in zebrafish larvae. Cell Death Dis. 8, e2979. 10.1038/cddis.2017.374 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Niu, J., Huang, Y., Liu, X., Zhang, Z., Tang, J., Wang, B., Lu, Y., Cai, J. and Jian, J. (2020). Single-cell RNA-seq reveals different subsets of non-specific cytotoxic cells in teleost. Genomics 112, 5170-5179. 10.1016/j.ygeno.2020.09.031 [ DOI ] [ PubMed ] [ Google Scholar ] Novak, M. L. and Koh, T. J. (2013). Phenotypic transitions of macrophages orchestrate tissue repair. Am. J. Pathol. 183, 1352-1363. 10.1016/j.ajpath.2013.06.034 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Petrie, T. A., Strand, N. S., Yang, C.-T., Rabinowitz, J. S. and Moon, R. T. (2014). Macrophages modulate adult zebrafish tail fin regeneration. Development 141, 2581-2591. 10.1242/dev.098459 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Renshaw, S. A., Loynes, C. A., Trushell, D. M. I., Elworthy, S., Ingham, P. W. and Whyte, M. K. B. (2006). A transgenic zebrafish model of neutrophilic inflammation. Blood 108, 3976-3978. 10.1182/blood-2006-05-024075 [ DOI ] [ PubMed ] [ Google Scholar ] Robertson, T. F. and Huttenlocher, A. (2022). Real-time imaging of inflammation and its resolution: It's apparent because it's transparent. Immunol. Rev. 306, 258-270. 10.1111/imr.13061 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Rodríguez-Morales, P. and Franklin, R. A. (2023). Macrophage phenotypes and functions: resolving inflammation and restoring homeostasis. Trends Immunol. 44, 986-998. 10.1016/j.it.2023.10.004 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Rougeot, J., Torraca, V., Zakrzewska, A., Kanwal, Z., Jansen, H. J., Sommer, F., Spaink, H. P. and Meijer, A. H. (2019). RNAseq profiling of leukocyte populations in zebrafish larvae reveals a cxcl11 chemokine gene as a marker of macrophage polarization during mycobacterial infection. Front. Immunol. 10, 832. 10.3389/fimmu.2019.00832 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Sevenich, L., Schurigt, U., Sachse, K., Gajda, M., Werner, F., Müller, S., Vasiljeva, O., Schwinde, A., Klemm, N., Deussing, J.et al. (2010). Synergistic antitumor effects of combined cathepsin B and cathepsin Z deficiencies on breast cancer progression and metastasis in mice. Proc. Natl. Acad. Sci. USA 107, 2497-2502. 10.1073/pnas.0907240107 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Soroldoni, D., Hogan, B. M. and Oates, A. C. (2009). Simple and efficient transgenesis with meganuclease constructs in zebrafish. Methods Mol. Biol. 546, 117-130. 10.1007/978-1-60327-977-2_8 [ DOI ] [ PubMed ] [ Google Scholar ] Soufizadeh, P., Mansouri, V. and Ahmadbeigi, N. (2024). A review of animal models utilized in preclinical studies of approved gene therapy products: trends and insights. Lab. Anim. Res. 40, 17. 10.1186/s42826-024-00195-6 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Sugimoto, M. A., Vago, J. P., Perretti, M. and Teixeira, M. M. (2019). Mediators of the resolution of the inflammatory response. Trends Immunol. 40, 212-227. 10.1016/j.it.2019.01.007 [ DOI ] [ PubMed ] [ Google Scholar ] Sun, J., Ruiz Daniels, R., Balic, A., Andresen, A. M. S., Bjørgen, H., Dobie, R., Henderson, N. C., Koppang, E. O., Martin, S. A. M., Fosse, J. H.et al. (2024). Cell atlas of the Atlantic salmon spleen reveals immune cell heterogeneity and cell-specific responses to bacterial infection. Fish Shellfish Immunol. 145, 109358. 10.1016/j.fsi.2024.109358 [ DOI ] [ PubMed ] [ Google Scholar ] Sur, A., Wang, Y., Capar, P., Margolin, G., Prochaska, M. K. and Farrell, J. A. (2023). Single-cell analysis of shared signatures and transcriptional diversity during zebrafish development. Dev. Cell 58, 3028-3047.e12. 10.1016/j.devcel.2023.11.001 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Szulc-Dąbrowska, L., Bossowska-Nowicka, M., Struzik, J. and Toka, F. N. (2020). Cathepsins in bacteria-macrophage interaction: defenders or victims of circumstance? Front. Cell Infect. Microbiol. 10, 601072. 10.3389/fcimb.2020.601072 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Teng, J., Cui, M. Y., Zhao, Y., Chen, H. J., Du, W. J., Xue, L. Y. and Ji, X. S. (2023). Expression changes of non-specific cytotoxic cell receptor (NCCRP1) and proliferation and migration of NCCs post-Nocardia seriolae infection in Northern Snakehead. Dev. Comp. Immunol. 139, 104576. 10.1016/j.dci.2022.104576 [ DOI ] [ PubMed ] [ Google Scholar ] Tinevez, J.-Y., Perry, N., Schindelin, J., Hoopes, G. M., Reynolds, G. D., Laplantine, E., Bednarek, S. Y., Shorte, S. L. and Eliceiri, K. W. (2017). TrackMate: an open and extensible platform for single-particle tracking. Methods 115, 80-90. 10.1016/j.ymeth.2016.09.016 [ DOI ] [ PubMed ] [ Google Scholar ] Travnickova, J., Tran Chau, V., Julien, E., Mateos-Langerak, J., Gonzalez, C., Lelièvre, E., Lutfalla, G., Tavian, M. and Kissa, K. (2015). Primitive macrophages control HSPC mobilization and definitive haematopoiesis. Nat. Commun. 6, 6227. 10.1038/ncomms7227 [ DOI ] [ PubMed ] [ Google Scholar ] Tsarouchas, T. M., Wehner, D., Cavone, L., Munir, T., Keatinge, M., Lambertus, M., Underhill, A., Barrett, T., Kassapis, E., Ogryzko, N.et al. (2018). Dynamic control of proinflammatory cytokines Il-1β and Tnf-α by macrophages in zebrafish spinal cord regeneration. Nat. Commun. 9, 4670. 10.1038/s41467-018-07036-w [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Wu, L., Gao, A., Li, L., Chen, J., Li, J. and Ye, J. (2021). A single-cell transcriptome profiling of anterior kidney leukocytes from Nile Tilapia (Oreochromis niloticus). Front. Immunol. 12, 783196. 10.3389/fimmu.2021.783196 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Wynn, T. A. and Vannella, K. M. (2016). Macrophages in tissue repair, regeneration, and fibrosis. Immunity 44, 450-462. 10.1016/j.immuni.2016.02.015 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Xue, J.-D., Gao, J., Tang, A.-F. and Feng, C. (2024). Shaping the immune landscape: multidimensional environmental stimuli refine macrophage polarization and foster revolutionary approaches in tissue regeneration. Heliyon 10, e37192. 10.1016/j.heliyon.2024.e37192 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Yang, B., Hang, S., Xu, S., Gao, Y., Yu, W., Zang, G., Zhang, L. and Wang, Z. (2024). Macrophage polarisation and inflammatory mechanisms in atherosclerosis: Implications for prevention and treatment. Heliyon 10, e32073. 10.1016/j.heliyon.2024.e32073 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Yao, Y., Cai, X., Ren, F., Ye, Y., Wang, F., Zheng, C., Qian, Y. and Zhang, M. (2021). The macrophage-osteoclast axis in osteoimmunity and osteo-related diseases. Front. Immunol. 12, 664871. 10.3389/fimmu.2021.664871 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Yao, Y., Li, Q. and Yan, Q. (2024). Distribution and response strategies of non-specific cytotoxic cell receptor protein 1 in large yellow croaker. Fish Shellfish Immunol. 151, 109728. 10.1016/j.fsi.2024.109728 [ DOI ] [ PubMed ] [ Google Scholar ] Yuan, H., He, J., Zhang, G., Zhang, D., Kong, X. and Chen, F. (2017). Osteoclast stimulatory transmembrane protein induces a phenotypic switch in macrophage polarization suppressing an M1 pro-inflammatory state. Acta Biochim. Biophys. Sin. 49, 935-944. 10.1093/abbs/gmx092 [ DOI ] [ PubMed ] [ Google Scholar ] Zhang, F., Liang, J., Lu, Y., Tang, Y., Liu, S., Wu, K., Zhang, F., Lu, Y., Liu, Z. and Wang, X. (2022). Macrophage-specific cathepsin as a marker correlated with prognosis and tumor microenvironmental characteristics of clear cell renal cell carcinoma. J. Inflamm. Res. 15, 6275-6292. 10.2147/JIR.S375250 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Associated Data This section collects any data citations, data availability statements, or supplementary materials included in this article. Supplementary Materials Supplementary information dmm-19-052520-s1.pdf (2.6MB, pdf) DOI: 10.1242/dmm.052520_sup1 Articles from Disease Models & Mechanisms are provided here courtesy of Company of Biologists ACTIONS View on publisher site PDF (9.6 MB) Cite Collections Permalink RESOURCES Similar articles Cited by other articles Links to NCBI Databases Follow NCBI NCBI on X (formerly known as Twitter) NCBI on Facebook NCBI on LinkedIn NCBI on GitHub NCBI RSS feed Connect with NLM NLM on X (formerly known as Twitter) NLM on Facebook NLM on YouTube National Library of Medicine 8600 Rockville Pike Bethesda, MD 20894 Web Policies FOIA HHS Vulnerability Disclosure Help Accessibility Careers NLM NIH HHS USA.gov Back to Top

Related documents

• Macrophage Regulation of Ozone-Induced Lung Inflammation#1072874
• ASXL1 in proinflammatory macrophages attenuates inflammatory activation and macrophage-mediated renal tubular epithelial cell damage in acute kidney injury. Supplemental Figures 1-5.#377629
• Inflammation and Immune Mechanisms in Atherosclerosis.#653340
• Osteopontin promotes age-related adipose tissue remodeling through senescence-associated macrophage dysfunction#1146488
• Interleukin-7 Induces Osteoclast Formation via STAT5, Independent of Receptor Activator of NF-kappaB Ligand#439894