Dietary herbal mixture powder as a natural growth promoter: effects on growth performance, carcass traits, blood biochemistry, Antioxidant gene expression, and gut microbial load in arbor acres broilers.

Dietary herbal mixture powder as a natural growth promoter: effects on growth performance, carcass traits, blood biochemistry, Antioxidant gene expression, and gut microbial load in arbor acres broilers - PMC Skip to main content An official website of the United States government Here's how you know Here's how you know Search Log in Primary site navigation Search Log in Search PMC Full-Text Archive Search in PMC Journal List User Guide As a library, NLM provides access to scientific literature. Inclusion in an NLM database does not imply endorsement of, or agreement with, the contents by NLM or the National Institutes of Health. Learn more: PMC Disclaimer | PMC Copyright Notice Poult Sci . 2026 May 15;105(9):107141. doi: 10.1016/j.psj.2026.107141 Dietary herbal mixture powder as a natural growth promoter: effects on growth performance, carcass traits, blood biochemistry, Antioxidant gene expression, and gut microbial load in arbor acres broilers Khloud M Algothmi a, b, ⁎ , Dalal S Alshaya c Author information Article notes Copyright and License information a Department of Biological Sciences, Faculty of Science, King Abdulaziz University, Kingdom of Saudi Arabia b Immunology Unit, King Fahad Medical Research Center, King Abdulaziz University, Kingdom of Saudi Arabia c Department of Biology, College of Science, Princess Nourah bint Abdulrahman University, P.O. Box 84428, Riyadh 11671, Saudi Arabia ⁎ Corresponding author. kalgothmi@kau.edu.sa Received 2026 Apr 11; Accepted 2026 May 14; Collection date 2026 Sep. © 2026 The Authors This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). PMC Copyright notice PMCID: PMC13226908  PMID: 42184644 Abstract The objective of the current study was to determine the impact of a diet supplemented with herbal mixture powder (HMP) as a natural antioxidant and growth promoter on growth performance, carcass traits, blood indices, antioxidant gene expression, meat quality, and intestinal microbial load in Arbor Acres broiler chickens. The herbal mixture consists of 200 g cardamom seeds, 200 g black pepper, 300 g turmeric, and 300 g cinnamon. A total of 280 broiler chicks, one-day-old, were allotted to four experimental groups in a completely randomized design experiment. Each group was subdivided into five replicates, each of fourteen sexed chicks (7 males and 7 females). The treatments were as follows: control group without additives (basal diet); HMP1, HMP2 and HMP3: basal diet + 1, 2 and 3 g herbal mix powder/kg diet, respectively. The results revealed that HMP supplementation significantly affected body weight gain, feed conversion ratio, and performance index (P ≤ 0.05), with optimal responses at 2 and 3 g/kg. Carcass yield and abdominal fat percentage reduction were also significant ( P ≤ 0.05). Blood biochemical test results showed improvement in liver and kidney function, increases in total protein, albumin, and globulin, and a lipid profile with reduced cholesterol, triglycerides, and LDL, and increased HDL ( P ≤ 0.001). The activities of the enzymes GPx and GST were increased, enabling synchronous measurements of antioxidant status and resulting in significant reductions in MDA. Elevated levels of immunoglobulins (IgG and IgM) indicate increased immune system responsiveness. The results further indicate that HMP modulates gut microbiota by decreasing total bacterial numbers and simultaneously increasing the number of beneficial bacteria. In addition, the expression of antioxidant-related genes (CAT, SOD, and GPX) was significantly increased. Overall, HMP is likely to have a beneficial effect on broiler production, due in part to its antioxidant, antimicrobial, and immunomodulatory effects; therefore, it should be considered a natural feeding enhancer to improve the productive efficiency of broilers and serve as an AGP substitute. Keywords: Herbal mix powder, Broilers, Growth, Blood, Meat quality Introduction The growing global demand for high-quality, affordable animal protein drives the rapid development of the poultry industry. Broiler chickens are an efficient source of meat production due to their fast growth rate and short production cycle ( Nassar, 2026 ). However, intensive poultry production systems are frequently challenged by oxidative stress, disease outbreaks, poor feed efficiency, and compromised meat quality, all of which negatively impact productivity and profitability ( Mohamed et al., 2025 ; Naeem et al., 2026 ). For decades, antibiotic growth promoters (AGPs) were widely used in poultry diets to enhance growth performance and control pathogenic microorganisms ( Youssef et al., 2024a , b ; Dosoky et al., 2024 ). Even so, the unrestricted use of antibiotics has raised important public health issues, including the development of antibiotic-resistant bacteria and the accumulation of antibiotic residues in poultry products ( Kairalla et al., 2022a , b ; Ghimpețeanu et al., 2022 ; Cufadar et al., 2024 ; Kairalla and Alshelmani, 2025 ). As a result, the use of AGPs has been prohibited or highly constrained in numerous countries, and there is therefore a pressing need for a safe, natural, and effective replacement for AGPs to support poultry wellness and production ( Kairalla et al., 2023 ; Abou-Kassem et al., 2025 ; Abbas et al., 2026 ). Phytogenic feed additives, specifically herbal feed additives, have generated great interest in recent years as a viable substitute for AGPs ( Alhujaili et al., 2025 ). Herbal feed additives contain numerous bioactive compounds, including polyphenols, flavonoids, alkaloids, and essential oils, that exhibit various biological activities, such as antioxidant, antimicrobial, anti-inflammatory, and immunomodulatory effects ( Dar et al., 2023 ; Abd El-Hack et al., 2025 ). These effects enable phytogenic feed additives to improve nutrient utilization, gut health, and immunity in poultry ( Oni and Oke, 2025 ; Reda et al., 2026 ). Turmeric, cinnamon, black pepper, and cardamom, commonly used herbal ingredients, are well known for their antioxidant activity, mainly due to their high levels of phenolic compounds and essential oils ( Diniz do Nascimento et al., 2020 ). Turmeric ( Curcuma longa ) has curcumin, which is a strong antioxidant and anti-inflammatory agent that has shown promise in enhancing growth performance, lipid metabolism, and immune system modulation in poultry ( Aderemi and Alabi, 2023 ; Saber et al., 2026 ). Curcumin, the bioactive compound found in turmeric, plays a role in modulating growth performance and immunity in poultry through free radical scavenging, anti-inflammatory action through the inhibition of nuclear factor-kappa B, and antioxidant action through the nuclear factor erythroid 2-related factor 2 pathway ( Patel et al., 2020 ). Cinnamon ( Cinnamomum verum ) is another significant herbal component that has shown antimicrobial and antioxidant activity (Abd El-Hack et al., 2024 ). Cinnamon, which contains a bioactive compound called cinnamaldehyde, enhances digestive enzymes, gut microbiota, and lipid metabolism by activating AMP-activated protein kinase (AMPK) ( Tjandrawinata et al., 2026 ). Likewise, black pepper ( Piper nigrum ) contains the alkaloid piperine, known for increasing the bioavailability of other nutrients and phytochemicals by inhibiting metabolic enzymes and enhancing intestinal absorption ( Ashokkumar et al., 2021 ). Cardamom ( Elettaria cardamomum ) is rich in essential oils and terpenoids with antimicrobial, antioxidant, and digestive stimulant properties that may improve diet palatability and the digestion and metabolism of nutrients, and may influence the gut microbiota ( Parkavi et al., 2026 ). The combination of these herbs in a single dietary supplement may produce a synergistic effect greater than the sum of their individual effects, particularly in terms of antioxidant properties and bioavailability. Although there are established advantages of phytogenic compounds, an emerging trend suggests that herbal mixtures may offer more pronounced effects owing to their multi-targeting approaches. This is because such mixtures may simultaneously affect multiple physiological processes, such as digestion, metabolism, immunity, and oxidation. Additionally, the synergistic effect of curcumin and piperine improves the efficacy of the mixture by optimizing its bioavailability ( Salsabila et al., 2021 ). Although the effects of individual herbal additives in broiler nutrition have been widely studied, limited information is available regarding the combined use of turmeric, cinnamon, black pepper, and cardamom. Therefore, this study evaluated the effects of dietary herbal mixture powder (HMP) supplementation on growth performance, carcass traits, blood biochemical parameters, antioxidant status, immune response, cecal microbiota, and antioxidant-related gene expression in broiler chickens. It was hypothesized that HMP could improve broiler performance and health status through its antioxidant, antimicrobial, and immunomodulatory properties as a natural alternative to antibiotic growth promoters. Materials and methods Herbal mix (plant materials) Cardamom seeds (C.S) , Black Pepper (B.P) , Turmeric roots (T.R) , Cinnamon Powder (C.P) were bought from the botanicals, spices and herbs market. Chemical characterization Chemical reagents, including folate, Ciocalteu's phenol reagent, 2,2-Diphenyl-1-picrylhydrazyl (DPPH) , gallic acid, quercetin, methanol, ethanol, and aluminum chloride, were obtained from Merck (Merck KGaA, Darmstadt, Germany). Sample preparation Ten grams of cardamom seeds, black pepper, turmeric roots, cinnamon powder and its flour were mixed individually with 70% methanol (200 mL), then was stirred for 3 h and then purified through filter paper Whatman No.2. Methanol was removed under vacuum from an extract in a BuCHI- water bath -B-480 evaporator at 45 C followed by lyophilisation using a freeze-Dryer (Thermoelectron Corporation–Heto power dry LL 300 Freeze dryer). The resulting extract was kept at 20 C until used for the following analyses ( Negm et al., 2025 ). Total phenolic compounds (TPCs) estimation The TPCs in the methanolic extracts (1000 mg/mL) were measured utilizing the Folin-Ciocalteu procedure. The standard curve was created using gallic acid (10–1000 mg/mL), a common phenolic compound. Its formula is y = 0.001x + 0.0563 (R 2 = 0.9792). 3 mL of diluted Folin-Ciocalteu reagent, 2 mL of 7.5% sodium carbonate, and 1 mL of every sample or standard were mixed and incubated for 30 minutes at 25°C in the dark. Absorbance at 760 nm was determined utilizing a JENWAY 6405 UV/Vis spectrophotometer ( Abdel-Shafi et al., 2019 ). Total flavonoids (TFs) estimation The Ordonez et al. (2006) technique was used to calculate TFs content. The quercetin (10-1000 mg/mL) normal curve, y = 0.0012x + 0.008 (R 2 = 0.944), was employed. 1 mL of 20 g/L AlCl₃ ethanol was mixed with 1 mL of quercetin extract or solution. The spectrophotometer was utilized to measure the color intensity at 420 nm. Antioxidant activity estimation The DPPH assay was used to determine antioxidant activity ( Sirivibulkovit et al., 2018 ). 1 mL of every sample was mixed with 3 mL of a methanolic DPPH solution. A spectrophotometer was used to measure absorbance at 520 nm after a 30-minute incubation. The extract content that scavenged 50% of the DPPH and ABTS radicals (SC50) ( Deeb et al., 2025 ). Design, birds and diets All experimental procedures were carried out in accordance with the Institutional Animal Care and Use Committee (IACUC) and approved by Princess Nourah bint Abdulrahman University Institutional Review Board (IRB) number (H-01-R-060; 22-0147). A total of 280 one-day-old (Arbor Acres) with nearly the same initial body weights were allotted to four experimental groups in a complete randomized design experiment. Each group was subdivided into five replicates, each of fourteen sexed chicks (equal percent of males and females). The experiment was conducted for 31 days. A herbal mixture powder (HMP) was first formulated from a 1-kg blend containing 200 g cardamom seeds, 200 g black pepper, 300 g turmeric powder, and 300 g cinnamon powder. The prepared HMP was then incorporated into the basal diet at supplementation levels of 1, 2, and 3 g/kg diet to form the experimental treatments, designated as HMP1, HMP2, and HMP3, respectively. A control group was fed the basal diet without HMP supplementation. To meet dietary requirements, the diets were formulated according to guidelines for Arbor Acres broiler chicks, and amino acid management guidelines were considered. All chicks were fed the diets in pellet form for 1–31 days of age, as shown in Table 1 . The diets were given in two stages: starter (1–21 days) and finisher (22–31 days). Table 1. Composition and calculated analysis of the basal diet. Items Starter (1 – 21 days) Finisher (22 – 31 days) Ingredients (%) Soybean meal (44%) 34.50 29.5 Yellow corn 54.10 58.7 Corn germ (60%) 5.43 5.50 Dicalcium phosphate 2.00 1.75 Limestone 1.08 0.95 Premix 1 0.30 0.30 Salt 0.30 0.30 DL-methionine 0.20 0.18 L-lysine 0.29 0.24 Soybean oil 1.80 2.58 Calculated analysis 2 CP % 23.12 21.10 ME (Kcal/kg) 2950 3110 Calcium % 0.99 0.89 Available phosphorus % 0.47 0.46 Methionine + cysteine % 1.00 0.90 Lysine% 1.40 1.22 Crude fiber% 3.68 3.43 Chemical analysis 3 CP% 21.68 19.86 DM % 89.80 88.90 Ash % 6.80 6.40 Crude Fiber % 2.50 2.40 Starch % 38.35 40.15 Ether extract% 3.60 3.70 Open in a new tab 1 Minerals and vitamins premix provides Vit A 12000 IU; Vit D3 2500 IU; Vit E 20 mg; Vit K3 2 mg; Vit B1 2 mg, Vit B2 5 mg, Vit B6 2 mg, Vit B12 0.05 ug, niacin 30 mg, biotin 0.05 ug, folic acid 1 mg, pantothenic acid 10 mg; manganese 60 mg; zinc 50 mg; iron 40 mg; copper 10 mg; iodine 0.6 mg; selenium 0.3 mg per 1 kg diet. DL-methionine (manufactured by Evonik Industries, Essen, Germany) contains 99% methionine. Lysine = lysine hydrochloride (Evonik Industries) and includes 70% Lysine. CP, crude protein; ME, Metabolizable energy. 2 Calculated according to NRC ( 1994 ). 3 Chemical analysis according to Near Infra-Red device (NIR). The chicks were reared in an environmentally controlled closed-house system and housed in conventional wire-floor cages (1.70 × 1.70 × 0.5 m³) throughout the experimental period, with 14 birds allocated per cage. The ambient temperature was maintained at 33°C during the first 4 days and then gradually adjusted to 23–25°C, while relative humidity was maintained at approximately 70% until the end of the experiment at 31 days of age. Feed and drinking water were provided ad libitum throughout the trial. A lighting program of 23 h light and 1 h dark was applied using white fluorescent lamps at an average light intensity of approximately 20 lux. All birds were managed and cared for in accordance with institutional guidelines for the care and use of experimental animals, and all experimental procedures complied with the relevant regulations and ethical standards. Data collection Chicks were individually weighed at 1, 7, 14, 21, 28 and 31 days to obtain live body weight (LBW) and daily body weight gain (DBWG) . Average daily feed intake (FI) and feed conversion ratio (FCR) were calculated. The performance index (PI) was computed utilizing the following formula: PI = final body weight (FBW) kg divided by the FCR, multiplied by 100. ( North, 1981 ). At the termination of the experiment, five males from each group were randomly selected for carcass evaluation at 31 days of age, weighed, and manually slaughtered. We calculated the carcass weight and the total amount of edible portions (wings, breast, legs, liver, heart, gizzard, and abdominal fat), and the intestine length was determined. Carcass (%) = (Weight of edible carcass / Total weight of carcass) * 100. Edible carcass refers to the eviscerated carcass without offal. Dressing (%) = (Weight of carcass / Live weight of bird) * 100. Blood biochemical analysis Blood samples were collected by slaughtering the same five birds from each group after overnight fasting into non-heparinized tubes, followed by centrifugation at 5000 rpm for 15 min at 4°C to obtain serum, which was kept at −20 until biochemical analysis. The serum samples were used to detect serum alanine aminotransferase (ALT) , aspartate aminotransferase (AST) activities using commercial kits (Reactivos GPL CHEMELEX, S.A. Pol. Ind. Can Castells. C/Industria 113, Nau J 08420), in addition to total protein (TP) , albumin (ALB) , globulin (GLOB) , total cholesterol (TC) , triglycerides (TG) , low-density lipoprotein (LDL) , and high-density lipoprotein (HDL) levels were determined spectrophotometrically using semi-automated spectrophotometer (Erba-Chem7, Germany) by using the diagnostic reagent kits (Spectrum, Egypt) ( Arisha et al., 2024 ). Also, serum urea, creatinine and immune responses (IgG and IgM) were measured using commercial ELIZA kits from Thermo Scientific Companies Serving, Egypt ( Youssef et al., 2023 ). According to the Abd El-Hack et al. (2017) method, oxidative markers such as malondialdehyde (MDA) , glutathione peroxidase (GPx) , and glutathione-S-transferase (GST) were identified. Meat quality Proximate composition of meat The moisture content, crude protein, crude fat, carbohydrates and ash contents were analyzed in meat poultry as explained by AOAC ( 2012 ). Color measurement The color parameters of uncooked breast muscle samples were assessed using a Minolta CR-10 color reader (Minolta Co. Ltd., Osaka, Japan) to obtain CIE color values: L* (lightness), a* (redness), and b* (yellowness) ( Salem et al., 2025 ). Measurements were performed using an 8-mm measurement area under D65 illuminant conditions with a 10° standard observer angle. The instrument was calibrated using a standard white calibration plate before analysis, and color measurements were conducted under consistent laboratory lighting conditions. Total phenolic content (TPC) in breast muscle A 1 g sample of uncooked broiler meat was extracted with 25 mL of 80% methanol. The mixture was stirred for 2 hours and subsequently centrifuged at 3000 revolutions per minute for 20 minutes. The TPC of the methanolic extracts was measured according to the Folin-Ciocalteu procedure described by Salem et al. (2025) , with some adjustments. A 100 microliter aliquot of the methanolic extract was mixed with 900 microliters of a ten-fold diluted Folin-Ciocalteu reagent (10% dilution with filtered water), then incubated for five minutes at room temperature. Subsequently, 0.75 μL of a 7% sodium bicarbonate solution was added, and the mixture was vortexed for 30 seconds before standing for 90 minutes at ambient temperature. Absorbance was quantified at 725 nm utilizing a spectrophotometer (PG Instruments Ltd., Felsted, Dunmow, UK). A calibration curve for gallic acid (0-1.00 mg/mL) was established under analogous conditions. All values were shown as the mean (mg of gallic acid equivalents/g of dry weight) from three repetitions. Antioxidant activity determination The DPPH method was used to evaluate the antioxidant activity of the poultry meat sample, as outlined by Aref et al. (2022) , with some modifications. To prepare the stock reagent solution, 22 mg of DPPH was dissolved in 50 mL of methanol (1 × 10³ M) and stored at −20°C until required. A working solution (6 × 10^5 M) was formulated by combining 6 mL of stock solution with 100 mL of methanol to get an absorbance of 0.8 ± 0.02 at 515 nm. For the assay, 0.1 mL of the produced methanolic extract was mixed with 3.9 mL of the DPPH solution, and the mixture was incubated for 30 minutes. The absorbance (A) was subsequently measured at 515 nm, utilizing the extraction solvent as a control. The scavenging activity was determined using the subsequent formula: Scavenging activity ( % ) = [ ( A control − − A sample ) / Acontrol ] × 100 Microbial count in cecal samples The ceca were removed from five identical birds in each group. Cecal tissue from every group was combined and homogenized. Ten grams of the homogenate and 90 milliliters of sterile water peptone were combined, and the mixture was incubated for 30 minutes. For making a 1:10 dilution (10 -1 dilution), the liquid component was collected. Additional dilutions were prepared at 10-fold intervals up to a dilution of 10 -7 . Specific media were used to measure the amounts of Pseudomonas species, Escherichia coli, Lactobacillus , and total bacterial count (TBC) , ( Oxoid, 2006 ). Finally, logarithmic units were used to transform the bacterial data (log CFU/g). Gene expression Total RNA was isolated from the hepatic tissues of each experimental group using the RNA purification kit (Thermo Fisher Scientific, USA) according to the manufacturer's instructions. A Nanodrop Lite spectrophotometer (Thermo Scientific, US) was used to measure the O.D. at 260 nm/O.D. 280 nm ratio to assess the quantity of the extracted RNA. Meanwhile, the quality of extracted RNA was checked using 1.5% agarose gel electrophoresis system ( Tahir et al., 2025 ). Complementary DNAs (cDNAs) were synthesized from 1 μg of RNA using the SuperScript TM III First-Strand Synthesis System (Invitrogen, USA) and Oligo-dT primers following the manufacturer's instructions. After that, the cDNA samples were stored at −20°C until they were needed again. Subsequently, the mRNA expression levels of antioxidants such as catalase ( CAT ) , superoxide dismutase ( SOD ) , and glutathione peroxidase ( GPX ) correlated genes were quantified using qPCR (SensiFast SYBR Lo-Rox kit, Bioline, London, UK) to determine the fold changes in gene transcription ( Table 2 ). The thermal cycle conditions for the reaction were adjusted as follows: 10 min at 95°C, 40 cycles at 95°C for 15 s, 30 min at 60°C, and finally 5 min at 85°C. Transcription levels were standardized to the GAPDH gene as an internal control using the 2 −ΔΔCT method ( Livak and Schmittgen, 2001 ; Abdulla et al., 2019 ). Results were expressed as fold change relative to the control group. Table 2. The sequence of forward and reverse primers used for q-PCR analysis. Gene Primer Sequence 5´ - 3´ bp Accession no CAT F: GAAGCAGAGAGGTTCCCATTTA R: CATACGCCATCTGTTCTACCTC 142 NM_001031215.2 SOD F: CTGACCTGCCTTACGACTATG R: CGCCTCTTTGTATTTCTCCTCT 131 NM_204211.2 GPX F: TCACCATGTTCGAGAAGTGC R: ATGTACTGCGGGTTGGTCAT 124 NM_001277853.3 GAPDH F: TGAAAGTCGGAGTCAACGG R: ACGCTCCTGGAAGATAGTGA 230 NM_204305.2 Open in a new tab Statistical analysis Data were subjected to ANOVA using a completely randomized design in SAS (SAS Version 9.4; SAS Institute Inc., 2014 ). The differences among means were determined using the post-hoc Tukey’s test. In addition, orthogonal polynomial contrasts were used to determine the linear and quadratic effects of increasing dietary HMP levels. Statements of statistical significance were based on P < 0.05 unless otherwise stated. The following statistical model was used: Y i j = μ + T i + e i j where Y ij = observed value of the concerned treatment, μ = observed mean for the concerned treatment, T i = treatment effect and e ij = the error related to individual observation. Results Phytochemical composition and antioxidant activity of the herbal mixture The phytochemical analysis of the HMP showed that it had a high amount of bioactive compounds ( Table 3 ). The total phenolic content of the HMP extract was 86.89 mg GAE g⁻¹ extract, whereas the total flavonoids were 46.33 mg QE g⁻¹ extract. The antioxidant activity of the HMP extract, evaluated using the DPPH method, increased with increasing concentration, from 51.00% at 100 mg/mL to 87.66% at 800 mg/mL. Table 3. Total phenolic (TP), and total flavonoid contents (TF), and 2,2-diphenyl1-picryl-hydrazyl-hydrate (DPPH) activity of the methanolic extract acquired from herbal mixture powder. Items Herbal mixture powder content TP (mg GAE g -1 extract) 86.89 TF (mg QE g -1 extract) 46.33 DPPH activity (SC50; mg mL -1 ) at different concentrations 100 51.00 200 60.66 400 72.33 800 87.66 Open in a new tab 100, 200, 400, 800 = concentrations of extract (mg/mL). Growth performance Supplementation of broiler chickens with HMP resulted in substantial improvements in growth performance parameters ( Table 4 ). LBW was significantly linearly and quadratically increased ( P ≤ 0.05) in all treatment groups compared with the control group, starting at 7 days of age. At 7, 14, 21 and 31 days, the maximum LBW was observed in the 3 g/kg group, followed by the 2 g/kg and 1 g/kg treatment groups. However, there is no significant difference between the treatment of LBW at 28 days of age. Table 4. Influences of dietary herbal mixture powder (HMP * ) supplementation on growth performance and performance index (PI) of broiler chickens. Items Treatments (g / kg diet) SEM P value * Control 1 g HMP 2 g HMP 3 g HMP T L Q Live body weight (LBW) (g) Initial LBW 41.20 41.40 41.20 41.20 0.190 0.981 0.915 0.811 7 days 167.00 b 172.40 a 173.80 a 175.00 a 0.907 0.002 0.000 0.014 14 days 473.60 b 486.40 a 487.60 a 493.20 a 1.94 <0.001 <0.001 0.032 21 days 1015.20 c 1035.80 b 1040.00 a b 1050.60 a 3.55 <0.001 <0.001 0.025 28 days 1639.00 1660.20 1674.20 1675.60 5.57 0.057 0.597 0.321 31 days 1910.40 c 1952.40 b 1974.80 a b 1979.20 a 7.30 <0.001 <0.001 0.006 Daily body weight gain (g/bird/day) 1-7 days 17.97 b 18.71 a 18.94 a 19.11 a 0.135 0.005 0.001 0.037 8-14 days 43.80 b 44.86 a 44.83 a 45.46 a 0.194 0.010 0.002 0.014 15-21 days 77.37 b 78.49 a b 78.91 a 79.63 a 0.268 0.012 0.001 0.012 22-28 days 89.11 89.20 90.60 89.29 0.442 0.630 0.647 0.456 29-31 days 90.47 b 97.40 a b 100.20 a 101.20 a 1.45 0.024 0.005 0.030 1-31 days 60.30 c 61.65 b 62.37 a b 62.52 a 0.234 <0.001 0.000 0.035 Feed intake (g/bird/day) 1-7 days 20.53 20.04 20.14 20.05 0.110 0.370 0.190 0.369 8-14 days 49.83 a 48.76 b 48.55 b 48.92 b 0.163 0.016 0.023 0.014 15-21 days 95.81 94.34 94.84 94.99 0.273 0.307 0.425 0.147 22-28 days 131.98 131.21 131.26 130.56 0.465 0.788 0.350 0.970 29-31 days 151.66 146.79 152.03 150.54 1.44 0.596 0.888 0.577 1-31 days 89.96 88.23 89.36 89.01 0.300 0.232 0.515 0.246 Feed conversion ratio (g feed/g gain) 1-7 days 1.14 a 1.07 b 1.06 b 1.05 b 0.010 <0.001 <0.001 0.040 8-14 days 1.14 a 1.09 b 1.08 b 1.08 b 0.006 <0.001 <0.001 0.013 15-21 days 1.24 a 1.20 b 1.20 b 1.19 b 0.005 0.001 <0.001 0.013 22-28 days 1.48 1.47 1.45 1.46 0.006 0.342 0.182 0.369 29-31 days 1.68 a 1.51 b 1.52 b 1.49 b 0.023 0.004 0.002 0.033 1-31 days 1.49 a 1.43 b 1.43 b 1.42 b 0.007 0.001 <0.001 0.023 PI 128.06 b 136.47 a 137.85 a 139.04 a 1.16 <0.001 <0.001 0.015 Open in a new tab a,b,c Means within the same row with different superscripts are significantly different ( P ≤ 0. 05). ⁎ T, overall impacts of treatments; L, linear impacts of increasing HMP levels of broiler; Q, quadratic impacts of increasing HMP levels of broiler. *The herbal mixture used consists of a blend of 200 g cardamom seeds, 200 g black pepper, 300 g turmeric roots, and 300 g cinnamon powder. DBWG was also significantly improved ( P ≤ 0.05) across most growth periods. The BWG from 1 to 31 days increased from 60.30 g observed in the control group to 62.52 g observed in the 3 g/kg treatment group. FI was not significantly affected by the dietary supplementation of HMP, except during the growth period of 8–14 days, when FI was significantly reduced ( P = 0.016). The FCR was considerably increased linearly and quadratically ( P ≤ 0.05) for all HMP groups at most growth phases. The overall FCR dropped from 1.49 in the control group to 1.42 in the 3g/kg group. Accordingly, the PI was significantly increased ( P ≤ 0.001), with the highest value recorded for the 3g/kg HMP group. Carcass traits As shown in Table 5 , some carcass characteristics were significantly affected by HMP supplementation. Pre-slaughter weight was significantly affected ( P = 0.014) by 1 g/kg HMP supplementation compared to the control. The carcass yield (%) was significantly higher ( P ≤ 0.001) in birds that received 2 g/kg HMP, but not in birds that received 3 g/kg. Table 5. Influences of dietary herbal mixture powder (HMP * ) supplementation on carcass traits of broiler chickens. Items Treatments (g / kg diet) SEM P value * Control 1 g HMP 2 g HMP 3 g HMP T L Q Pre-slaughtered weight 1989.80 b 2090.20 a 2035.80 a b 2069.40 b 12.60 0.014 0.019 0.112 Carcass % 75.21 b 75.36 b 76.72 a 73.15 c 0.320 <0.001 <0.001 <0.001 Wings % 7.47 7.57 7.42 7.27 0.054 0.298 0.140 0.268 Breast % 25.71 26.24 25.95 24.71 0.259 0.177 0.150 0.088 Legs % 26.36 25.44 26.40 25.02 0.228 0.063 0.103 0.081 Gizzard % 1.52 1.45 1.33 1.40 0.078 0.868 0.522 0.675 Heart % 0.43 0.48 0.41 0.45 0.013 0.347 0.979 0.928 Liver % 2.11 2.27 2.02 2.20 0.044 0.243 0.932 0.892 Abdominal fat % 1.03 a 0.51 c 0.53 c 0.75 b 0.056 <0.001 <0.001 <0.001 Intestine length (cm) 203.80 a b 215.20 a 189.00 b 209.60 b 3.31 0.019 0.008 0.003 Open in a new tab a,b,c Means within the same row with different superscripts are significantly different ( P ≤ 0. 05). ⁎ T, overall impacts of treatments; L, linear impacts of increasing HMP levels of broiler; Q, quadratic impacts of increasing HMP levels of broiler. *The herbal mixture used consists of a blend of 200 g cardamom seeds, 200 g black pepper, 300 g turmeric roots, and 300 g cinnamon powder. The percentage of abdominal fat was markedly decreased linearly and quadratically ( P ≤ 0.001) in broilers supplemented with HMP compared with the control group, with the lowest values observed in the 1 g/kg and 2 g/kg HMP groups. Intestinal length was also significantly affected by dietary treatment ( P = 0.019), and the greatest intestinal length was recorded in birds fed 1 g HMP/kg diet compared with the other treatment groups. However, no significant differences ( P > 0.05) were observed among treatments in the percentages of wings, breast, legs, gizzard, heart, or liver. Blood biochemical parameters HMP supplementation at dietary levels significantly linearly and quadratically improved blood biochemical parameters ( Table 6 ). Total protein, albumin, and globulin concentrations were significantly increased ( P ≤ 0.001) in all the HMP-treated groups. The highest concentrations were recorded in the 3 g/kg group. The albumin-to-globulin ratio was also significantly increased in HMP-supplemented groups compared with the control. Table 6. Influences of dietary herbal mixture powder (HMP * ) supplementation on blood biochemical parameters of broiler chickens. Items Treatments (g / kg diet) SEM P value * Control 1 g HMP 2 g HMP 3 g HMP T L Q Liver and kidney functions TP (mg/dL) 3.06 c 4.37 b 4.40 b 4.45 a 0.134 <0.001 <0.001 <0.001 ALB (mg/dL) 1.08 b 2.14 a 2.13 a 2.14 a 0.105 <0.001 <0.001 <0.001 GLOB (mg/dL) 1.97 d 2.23 b 2.27 b 2.31 a 0.030 <0.001 <0.001 <0.001 A/G (%) 0.55 c 0.96 a 0.94 a b 0.93 b 0.039 <0.001 <0.001 <0.001 ALT (IU/L) 12.47 a 12.07 b 12.06 b 11.91 b 0.062 0.002 0.001 0.009 AST (IU/L) 130.60 a 126.27 b 124.54 c 124.32 c 0.596 <0.001 <0.001 <0.001 Urea (mg/dL) 41.05 a 33.23 b 32.81 b c 32.26 c 0.832 <0.001 <0.001 <0.001 Creatinine (mg/dL) 0.68 a 0.57 b 0.57 b 0.56 b 0.011 <0.001 <0.001 0.001 Lipid profile TC (mg/dL) 62.84 a 56.46 b 55.42 c 53.70 d 0.805 <0.001 <0.001 <0.001 TG (mg/dL) 85.32 a 66.45 b 61.78 c 58.41 d 2.39 <0.001 0.001 <0.001 HDL (mg/dL) 18.41 d 28.84 c 30.66 b 31.64 a 1.21 <0.001 <0.001 0.001 LDL (mg/dL) 27.36 a 14.33 b 12.41 c 10.38 d 1.53 <0.001 <0.001 <0.001 Open in a new tab a,b,c Means within the same row with different superscripts are significantly different ( P ≤ 0. 05). ⁎ T, overall impacts of treatments; L, linear impacts of increasing HMP levels of broiler; Q, quadratic impacts of increasing HMP levels of broiler. *The herbal mixture used consists of a blend of 200 g cardamom seeds, 200 g black pepper, 300 g turmeric roots, and 300 g cinnamon powder. TP: total protein; ALB: albumin; GLOB: globulin; AST: aspartate aminotransferase; ALT: alanine aminotransferase; TC: total cholesterol; TG: triglycerides; HDL: high-density lipoprotein; and LDL: low-density lipoprotein. Levels of ALT and AST, which are indicators of liver function, significantly decreased ( P ≤ 0.01). Kidney function indicators such as urea and creatinine were significantly decreased ( P ≤ 0.001) in the HMP-treated groups. In the lipid profile, total cholesterol, triglycerides, and LDL were significantly linearly and quadratically decreased ( P ≤ 0.001), and HDL was significantly increased in a dose-dependent manner, with the greatest increase observed in the 3 g/kg group. Antioxidant status and immune response As shown in Table 7 , antioxidant enzyme activity was significantly increased by HMP supplementation. GPx enzyme activity, as well as GST enzyme activity, was significantly increased ( P ≤ 0.001). MDA levels decreased, indicating reduced lipid peroxidation. Table 7. Influences of dietary herbal mixture powder (HMP * ) supplementation on blood antioxidant parameters and immunoglobulin levels of broiler chickens. Items Treatments (g / kg diet) SEM P value * Control 1 g HMP 2 g HMP 3 g HMP T L Q Antioxidant parameters GPx (U/mg protein) 52.80 b 69.80 a 71.20 a 71.20 a 1.81 <0.001 <0.001 0.001 GSTs (U/mg protein) 4.61 b 5.61 a 5.81 a 5.82 a 0.118 <0.001 <0.001 0.006 MDA (nmol/ml) 4.32 a 3.24 b 3.22 b 3.10 b 0.120 <0.001 <0.001 0.011 Immunoglobulin levels IgG (mg/dL) 204.80 c 233.00 b 237.20 b 279.80 a 1.32 <0.001 <0.001 0.001 IgM (mg/dL) 68.23 b 77.84 a 78.89 a 77.94 a 1.01 <0.001 <0.001 0.005 Open in a new tab a,b,c Means within the same row with different superscripts are significantly different ( P ≤ 0. 05). ⁎ T, overall impacts of treatments; L, linear impacts of increasing HMP levels of broiler; Q, quadratic impacts of increasing HMP levels of broiler. *The herbal mixture used consists of a blend of 200 g cardamom seeds, 200 g black pepper, 300 g turmeric roots, and 300 g cinnamon powder. GPx: Glutathione Peroxidase; GST: Glutathione S-Transferase; MDA: Malondialdehyde; IgG: immunoglobulin G; and IgM: immunoglobulin M. Immunological parameters were significantly linearly and quadratically improved. IgG and IgM concentrations were significantly increased ( P ≤ 0.001) in all supplemented groups. The highest IgG concentration was detected in the 3 g/kg group. Meat quality HMP supplementation significantly affected some meat quality parameters ( Table 8 ). Crude protein and ash were significantly increased ( P ≤ 0.001), especially in the 1g/kg group. Similarly, the crude fat and carbohydrates were increased in the treated groups. Table 8. Influences of dietary herbal mixture powder (HMP * ) supplementation on meat quality parameters of broiler chickens. Items Treatments (g / kg diet) SEM P value * Control 1 g HMP 2 g HMP 3 g HMP T L Q Chemical composition analysis (%) Moisture content 70.46 70.02 70.03 69.90 0.097 0.191 0.059 0.408 Crude protein 22.21 b 23.13 a 22.31 b 22.78 b 0.088 <0.001 0.014 0.005 Crude ash 1.06 b 1.37 a 1.16 b 1.28 a 0.028 <0.001 0.016 0.026 Crude fat 3.18 c 3.71 a 3.22 b c 3.42 b 0.058 <0.001 <0.001 <0.001 Carbohydrates 3.09 a 1.78 b 3.29 a 2.62 a 0.173 0.003 <0.001 <0.001 Color measurements L* 55.38 a 52.44 b c 53.22 b 51.10 c 0.439 0.001 0.000 0.018 a* 14.46 a 4.50 b 5.16 b 2.64 c 1.06 <0.001 <0.001 <0.001 b* 12.48 a b 12.72 a 14.64 a 8.22 b 0.662 <0.001 0.007 0.116 Antioxidant activity (%DPPH) 6.23 b 6.73 a b 6.65 a b 7.17 a 0.126 0.050 0.014 0.047 Total phenolic content mg GAE/100 g 0.89 0.92 0.91 0.92 0.005 0.245 0.134 0.496 Open in a new tab a,b,c Means within the same row with different superscripts are significantly different ( P ≤ 0. 05). ⁎ T, overall impacts of treatments; L, linear impacts of increasing HMP levels of broiler; Q, quadratic impacts of increasing HMP levels of broiler. *The herbal mixture used consists of a blend of 200 g cardamom seeds, 200 g black pepper, 300 g turmeric roots, and 300 g cinnamon powder. L* : Lightness; a* : Redness/Greenness; b* : Yellowness/Blueness. The color parameters were significantly affected. Lightness ( L* ) and redness ( a* ) were decreased ( P ≤ 0.001), whereas yellowness ( b* ) increased in some of the treated groups. The antioxidant activity (% DPPH) of the meat increased significantly ( P = 0.050), especially for the 3g/kg group. Moreover, there were no significant differences in moisture content or total phenolic content. Cecal microbiota The effect of HMP on cecal microbiota populations is depicted in Table 9 . Total bacterial count (TBC) was significantly linearly and quadratically reduced in the 2 and 3 g/kg groups compared to the control. Reduction of Escherichia coli and Pseudomonas spp. populations were not statistically significant ( P > 0.05). Lactobacillus populations showed numerical increases. Table 9. Influences of dietary herbal mixture powder (HMP * ) supplementation on cecal bacterial count (log10 CFU/g cecal content) of broiler chickens. Items Treatments (g / kg diet) SEM P value * Control 1 g HMP 2 g HMP 3 g HMP T L Q Total bacterial count (TBC) 6.65 a 5.68 ab 5.21 b 5.29 b 0.207 0.037 0.010 0.043 Pseudomonas spp. 1.47 ND 0.59 0.58 0.217 0.109 0.255 0.082 Lactobacillus spp. 1.21 1.89 2.01 1.57 0.254 0.717 0.618 0.309 Escherichia coli 3.61 2.33 2.50 2.23 0.274 0.266 0.114 0.354 Open in a new tab a,b,c Means within the same row with different superscripts are significantly different ( P ≤ 0. 05). ⁎ T, overall impacts of treatments; L, linear impacts of increasing HMP levels of broiler; Q, quadratic impacts of increasing HMP levels of broiler. *The herbal mixture used consists of a blend of 200 g cardamom seeds, 200 g black pepper, 300 g turmeric roots, and 300 g cinnamon powder. ND: Non-detected. Gene expression of antioxidant enzymes Dietary HMP supplementation significantly linearly and quadratically upregulated the expression of antioxidant-related genes ( Fig. 1 ). The relative expression levels of CAT, SOD , and GPX were significantly increased ( P ≤ 0.001) in a dose-dependent manner. The highest expression levels were detected in the 3 g/kg group. Fig. 1. Open in a new tab Influences of dietary herbal mixture powder (HMP*) supplementation on relative expression of antioxidant-related genes of broiler chickens. *The herbal mixture used consists of a blend of 200 g cardamom seeds, 200 g black pepper, 300 g turmeric roots, and 300 g cinnamon powder. CAT : Catalase; SOD : Superoxide Dismutase, GPX : Glutathione Peroxidase. Discussion The beneficial results observed in broilers receiving herbal mixture powder (HMP) may be attributed to the synergistic effects of bioactive phytochemicals found in cardamom, black pepper, turmeric, and cinnamon. These herbs are abundant in polyphenols, flavonoids, alkaloids, and essential oils, which have been shown to augment digestive enzyme activity, promote nutritional absorption, regulate gut microbiota, and bolster antioxidant and immunological responses in chicken. Compounds like curcumin, piperine, cinnamaldehyde, and terpenoids may synergistically enhance metabolic efficiency and diminish oxidative stress, therefore improving physiological performance and health in broilers ( Rudrapal et al., 2024 ). The elevated total phenolic and flavonoid contents in HMP are indicative of its potent antioxidant activity, as further validated by a dose-dependent increase in DPPH radical scavenging activity. Antioxidant phenolic compounds can donate hydrogen atoms or electrons to free radicals, helping retain cell integrity against oxidative insult ( Vuolo et al., 2019 ). Flavonoids, by virtue of their ability to chelate and inhibit chain propagation of free radical damage, exhibit significant antioxidant activity and improve the redox state of the cell ( Speisky et al., 2022 ). Based on the antioxidant activity of curcumin, cinnamaldehyde, piperine, and terpenoids, which are common to turmeric, cinnamon, black pepper, and cardamom, combining these spices will have a synergistic effect, providing an overall greater antioxidant activity than either compound alone. Piperine is known to increase the bioavailability of curcumin by inhibiting hepatic and intestinal glucuronidation ( Zeng et al., 2017 ), thereby increasing its antioxidant activity. The significant enhancements noted in body weight gain, FCR, and PI in broilers treated with HMP may be ascribed to the synergistic effects of the bioactive phytochemicals found in turmeric, cinnamon, black pepper, and cardamom. Previous studies have documented analogous improvements in growth performance after the administration of phytogenic feed additives ( Singh et al., 2019 ; Ayele et al., 2023 ; Ibrahim et al., 2024 ; El-Abasy et al., 2025 ). The enhancement of growth features may be attributed to the capacity of phytogenic chemicals to activate digestive physiology and promote food absorption. Phytogenic additions are recognized for their ability to enhance the secretion of digestive enzymes, bile acids, pancreatic secretions, and intestinal mucus, therefore optimizing feed digestion and nutrient absorption efficiency ( Patra et al., 2019 ). Cinnamaldehyde and cardamom essential oils may augment gastrointestinal enzyme activity and foster intestinal health, leading to increased food availability for growth and tissue accretion ( Chimbetete et al., 2019 ). Piperine, the principal alkaloid in black pepper, has been shown to enhance intestinal permeability and augment the bioavailability of nutrients and phytochemicals by modulating intestinal membrane dynamics and inhibiting metabolizing enzymes ( Balakrishnan et al., 2023 ). This may partially elucidate the enhanced feed efficiency noted in the HMP-supplemented groups. Piperine may enhance thermogenesis and metabolic activity, thereby benefiting growth rate and energy use ( Haq et al., 2021 ). Additionally, curcumin from turmeric demonstrates significant anti-inflammatory properties by inhibiting the NF-κB signaling pathway, which diminishes intestinal inflammation and oxidative stress ( Pandita and Pandita, 2025 ). Enhanced intestinal integrity and less inflammatory burden likely increased nutrient absorption and metabolic efficiency, hence contributing to the superior productive performance of broilers using HMP diets. The improvement observed in carcass yield, particularly in broilers supplemented with 2 g HMP/kg diet, may indicate enhanced protein deposition and muscle development resulting from improved nutrient utilization and metabolic efficiency. Phytogenic compounds present in the herbal mixture are known to enhance digestive enzyme activity and amino acid availability, which support muscle accretion and tissue growth ( Greene et al., 2021 ). In addition, the antioxidant properties of curcumin, cinnamaldehyde, piperine, and other phenolic compounds may reduce oxidative stress and cellular damage, thereby preserving muscle integrity and improving growth efficiency. Reduced oxidative stress can also decrease protein catabolism and redirect nutrients toward lean tissue formation rather than maintenance processes. The significant reduction in abdominal fat percentage in HMP-treated groups may be attributed to the hypolipidemic and metabolic regulatory activities of the bioactive compounds contained in the herbal mixture. Curcumin has been reported to suppress adipogenesis through downregulation of important lipogenic transcription factors, including peroxisome proliferator-activated receptor gamma (PPAR-γ) and sterol regulatory element-binding protein-1c (SREBP-1c) , thereby reducing fat accumulation ( Pan et al., 2021 ; Benbaibeche et al., 2025 ). Moreover, cinnamaldehyde can activate AMP-activated protein kinase (AMPK) , a key regulator of cellular energy metabolism, which enhances fatty acid oxidation and inhibits lipid synthesis ( Gao et al., 2021 ). Piperine may further contribute to improved lipid metabolism by enhancing insulin sensitivity and modulating lipid digestion and transport ( Wang et al., 2022 ). The reduction in abdominal fat is considered economically and commercially beneficial because excessive fat deposition is undesirable in broiler production. Lower abdominal fat improves carcass quality, increases dressing percentage, and enhances consumer acceptance and market value of broiler meat. The increase in TP, ALB, and GLOB levels shows that protein metabolism and immune responses are better. Albumin levels are an important indicator of liver function and protein production. Globulin levels are related to immune system function ( Belinskaia et al., 2021 ). The increase in these levels in birds given HMP indicates that the liver and immune system function better. This reduction in liver enzyme levels also indicates improved liver function. High levels of these enzymes are generally indicative of cellular damage. Their reduction indicates that HMP protects cells from damage ( Lam et al., 2016 ; Gajender et al., 2023 ). Studies have shown that curcumin and cinnamaldehyde protect liver cells from oxidative stress-induced damage by reducing oxidative stress and inhibiting inflammatory pathways ( Yin et al., 2022 ). A significant reduction in urea and creatinine levels indicates improved kidney function. This can be attributed to the herb's antioxidant and anti-inflammatory properties, which protect kidney cells from oxidative damage ( Rapa et al., 2019 ). The hypolipidemic effects observed in the present study, characterized by reduced serum total cholesterol, triglycerides, and low-density lipoprotein concentrations together with increased high-density lipoprotein levels, are in agreement with previous findings reported for phytogenic feed additives ( Ahmadipour et al., 2021 ; Sumadja et al., 2025 ). These improvements suggest that supplementation with HMP positively modulated lipid metabolism and hepatic lipid regulation in broiler chickens. The favorable lipid profile may be attributed to the synergistic effects of the biologically active compounds present in turmeric, cinnamon, black pepper, and cardamom, which collectively influence lipid synthesis, oxidation, and transport pathways. Curcumin, the principal polyphenol in turmeric, has been reported to reduce cholesterol biosynthesis through downregulation of 3‑hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase, the rate-limiting enzyme involved in hepatic cholesterol synthesis. Curcumin may also enhance bile acid excretion and stimulate antioxidant defense systems, thereby improving liver function and lipid utilization ( Hosseini et al., 2023 ). In addition, cinnamaldehyde, the major active component of cinnamon, has been shown to activate metabolic pathways associated with fatty acid oxidation while suppressing lipogenic enzymes such as fatty acid synthase and acetyl-CoA carboxylase (ACC) , leading to reduced hepatic triglyceride synthesis ( Mollazadeh and Hosseinzadeh, 2016 ). Piperine from black pepper may further contribute to the improved lipid profile by enhancing metabolic efficiency, improving nutrient bioavailability, and modulating lipid digestion and transport mechanisms ( Hosseini et al., 2023 ). Moreover, cardamom contains several bioactive constituents, including 1,8-cineole, α-terpinyl acetate, and flavonoids, which possess antioxidant and hypocholesterolemic activities. These compounds may inhibit HMG-CoA reductase activity and reduce hepatic cholesterol accumulation, thereby improving serum lipid parameters ( Sivaranjani, 2024 ). The combined action of these phytochemicals likely reduced lipid deposition and improved lipid homeostasis, which may have beneficial implications for broiler health, metabolic efficiency, and meat quality. The increase in antioxidant enzyme activities, such as GPx and GST, along with the decrease in MDA levels, clearly indicates that HMP-treated birds have a better oxidative status. Oxidative stress is a significant obstacle in poultry production, as it adversely affects growth, immune function, and meat quality ( Nawaz and Zhang, 2021 ). GPx and GST are very important parts of the body's antioxidant defense system. GPx speeds up the breakdown of hydrogen peroxide and lipid hydroperoxides, while GST cleans up reactive intermediates. The heightened activity of these enzymes indicates that HMP augments endogenous antioxidant defenses ( Bhagat and Ingole, 2016 ; Ighodaro and Akinloye, 2018 ). The reduction in MDA, a marker of lipid peroxidation, indicates a reduction in oxidation damage to cell membranes. This impact likely stems from the herb mixture's polyphenols, flavonoids, and/or essential oils, which act collectively as antioxidants ( Nguyen and Karboune, 2023 ). The evidence for these effects also comes from the upregulation of antioxidant genes ( CAT, SOD, GPX ), indicating that the Nrf2 signaling pathway has been activated. Nrf2 is an important regulator of antioxidant gene expression, and some phytochemicals, such as curcumin, can activate it ( Shahcheraghi et al., 2021 ). The substantial increase in immunoglobulin levels reflects improved humoral immunity in HMP-treated birds. The immunomodulatory effect of phytogenic compounds may explain this. Curcumin improves immunological well-being by modulating cytokine production and stimulating lymphocyte proliferation ( Makuch et al., 2021 ). Cinnamaldehyde and essential oils from cardamom have immunostimulatory effects, which improve immune responses by stimulating macrophage and antibody production ( Sandner et al., 2020 ). Moreover, reduced oxidative stress may have contributed to improved immunological well-being, as oxidative damage impairs immune cell function. HMP maintains redox status, which is necessary for optimal immune responses ( Lauridsen, 2019 ). Finally, piperine improves nutrient and phytochemical uptake from the gastrointestinal tract. This improves the availability of amino acids, Zn, and Fe, which are required by B cells for immunoglobulin production ( Fernández-Lázaro et al., 2020 ). The present outcomes demonstrated that dietary supplementation with HMP significantly influenced several physicochemical and oxidative stability parameters of broiler meat. The mixture contained many bioactive phytochemicals, including polyphenols, flavonoids, curcuminoids, essential oils, and alkaloids from turmeric, cinnamon, black pepper, and cardamom. These are what caused these effects. These compounds work together to alter how muscles contract, how fats are stored, and how oxidative processes function. This makes the meat taste better and lasts longer ( Ahmad et al., 2024 ). The increase in crude protein content, particularly in birds ingesting 1 g/kg HMP, indicates boosted protein deposition and muscle development. This upgrade may be linked to improved nutrient digestibility and amino acid utilization, since phytogenic additives are known to increase the secretion of digestive enzymes and the intestines' ability to absorb nutrients ( Zumbaugh et al., 2020 ). Cinnamaldehyde and terpenoids are two compounds that can enhance the activity of pancreatic enzymes, thereby speeding up the digestion and absorption of proteins ( Smitha Grace et al., 2019 ). Piperine, which comes from black pepper, has also been shown to increase nutrient bioavailability by regulating intestinal membrane function and blocking pathways that break down nutrients, leading to better protein deposition in muscle tissues ( Srinivasan, 2007 ). The concurrent increase in ash content indicates improved mineral retention and deposition in muscle, possibly linked to enhanced intestinal absorption promoted by phytogenic compounds ( Madesh et al., 2025 ). The rise in crude fat content observed in HMP-treated groups, although statistically significant, should be interpreted as a modification in lipid metabolism rather than an augmentation in fat storage. The simultaneous decrease in abdominal fat indicates a redistribution of lipids to intramuscular fat, which can enhance meat juiciness and palatability. Color is a vital qualitative trait of meat that significantly affects consumer acceptance and is particularly sensitive to alterations related to myoglobin oxidation and postmortem muscle metabolism. The current investigation demonstrated that dietary supplementation with HMP significantly decreased L* and a* values, but b* values exhibited inconsistent responses across treatment groups. The decrease in L* values signifies a deeper meat color, potentially linked to enhanced water-holding capacity and diminished protein denaturation, resulting in decreased light reflection from the muscle surface ( Hughes et al., 2014 ). The improved oxidative stability due to the antioxidant components of HMP may aid in maintaining muscle cell integrity and diminishing excessive light scattering. Redness is mostly determined by myoglobin content, its chemical state, muscle pH, and the rate of oxygen consumption in postmortem tissues ( Bekhit et al., 2019 ). While antioxidants are typically anticipated to stabilize oxymyoglobin and preserve redness, certain phytogenic substances may modify muscle pigment chemistry and oxygen usage in distinct ways ( Faehnrich et al., 2016 ). The herbal mixture utilized in this study comprised elevated concentrations of polyphenols, essential oils, and curcuminoids derived from turmeric, cinnamon, cardamom, and black pepper, potentially affecting myoglobin redox dynamics and diminishing the formation or stability of bright-red oxymyoglobin ( Zhu et al., 2024 ). Furthermore, curcumin, derived from turmeric, exhibits a vivid yellow-orange hue that may disrupt instrumental color detection and alter the balance of reflected wavelengths, thereby diminishing observed a* values. The antioxidant activity of HMP diminished lipid oxidation and metabolic stress, potentially affecting postmortem oxygen consumption and resulting in a deeper, less vibrant red hue characteristic of meat with reduced surface oxygenation ( Ramanathan et al., 2023 ). Fluctuations in muscle pH and water distribution may have influenced disparities in redness among groups by impacting light absorption and pigment condition ( Hughes et al., 2020 ). Previous reports indicate that comparable decreases in redness values occur after supplementation with phytogenic additives abundant in phenolic compounds, implying that natural antioxidants do not consistently enhance meat redness, even while they improve oxidative stability ( Orlowski et al., 2018 ). The variable alterations in b* (yellowness) readings may be associated with the accumulation of carotenoid and phenolic pigments found in turmeric and other herbal constituents. Curcumin, specifically, may enhance yellowness in certain treatment groups due to its inherent pigmenting characteristics ( Abdeldaiem, 2013 ). One of the most significant findings of this study is the enhancement of meat's antioxidant activity, as reflected by a significant increase in DPPH free radical scavenging activity. This study clearly indicates that dietary inclusion of HMP significantly improves the oxidative stability of broiler meat. Phenolic compounds and flavonoids in the herbal mixture function as primary antioxidants that donate hydrogen atoms or electrons to free radicals to neutralize them. This action stops the propagation step of lipid peroxidation and maintains membrane stability ( Asif, 2015 ). The dietary inclusion of HMP has been shown to improve the antioxidant defense system in meat, as reflected by increased activity of antioxidant enzymes and expression of antioxidant genes. The marked reduction in TBC in birds receiving 2 and 3 g/kg of HMP indicates that the herbal mixture has a significant antimicrobial effect. The reduction in total microbial load in the birds receiving the herbal mixture can be attributed mainly to the bioactive compounds in turmeric, cinnamon, black pepper, and cardamom, which exhibit antimicrobial activity. These bioactive compounds include phenolics, flavonoids, and essential oils. These exhibit antimicrobial activity through various mechanisms, including disruption of bacterial cell membranes, leakage of cellular contents, and inhibition of key metabolic enzymes ( Khatri et al., 2023 ). The bioactive compound cinnamaldehyde in cinnamon has been reported to disrupt bacterial cell membranes and interfere with energy metabolism ( Vasconcelos et al., 2018 ). The bioactive compound piperine has been reported to enhance membrane permeability and inhibit bacterial efflux mechanisms ( Sharma et al., 2010 ). The bioactive compound curcumin has been reported to exhibit antimicrobial activity by binding to bacterial proteins and DNA, thereby inhibiting replication and transcription ( Trigo-Gutierrez et al., 2021 ). The modulation of gut microbiota can enhance intestinal integrity by strengthening tight junctions and stimulating mucin production, thereby improving barrier function ( Gieryńska et al., 2022 ). Improved gut health reduces endotoxin translocation and systemic inflammation, which ultimately contributes to better growth performance and physiological status ( Ghareeb et al., 2016 ). The lack of detectable Pseudomonas spp. in the 1 g/kg HMP group, in contrast to the low counts in the higher supplementation groups, may indicate normal microbiological variability and detection-limit sensitivity rather than a contradictory biological response, especially since the treatment differences were statistically non-significant ( P > 0.05). Significantly, all groups treated with HMP demonstrated reduced counts of Pseudomonas spp. compared to the control group, suggesting a general inhibitory impact of the herbal mixture on cecal pathogenic bacteria. The observed upregulation of antioxidant-related genes ( CAT, SOD , and GPX ) in HMP-supplemented broilers suggests a biologically coordinated enhancement of the endogenous antioxidant defense system rather than a simple isolated gene response. These enzymes function sequentially to maintain redox homeostasis: SOD first dismutates superoxide radicals into hydrogen peroxide, which is then detoxified into water and oxygen by CAT and GPX, thereby limiting ROS accumulation and protecting cellular structures from oxidative damage ( Ighodaro and Akinloye, 2018 ). Mechanistically, this transcriptional activation may be associated with stimulation of the nuclear factor erythroid 2–related factor 2 (Nrf2) signaling pathway, which is a central regulator of cellular antioxidant defense. Under oxidative challenge or exposure to bioactive phytochemicals, Nrf2 is released from its cytoplasmic inhibitor and translocates into the nucleus, where it binds to antioxidant response elements (ARE) and induces the expression of detoxifying and antioxidant enzymes. Phytochemicals present in HMP, particularly curcumin from turmeric and piperine from black pepper, are known to act as mild electrophilic and signaling modulators that can activate Nrf2-mediated transcriptional responses, thereby strengthening cellular resistance to oxidative stress ( Shahcheraghi et al., 2021 ). In addition to direct molecular signaling, the improved gut microbial balance observed in HMP-treated birds may have contributed indirectly to the enhanced antioxidant gene expression. A reduction in pathogenic bacterial populations can lower intestinal endotoxin load and systemic inflammatory signaling, thereby decreasing ROS production and alleviating oxidative burden. This reduced oxidative and inflammatory pressure creates a physiological environment that favors the activation and sustained expression of antioxidant defense genes ( Sahoo et al., 2023 ). Conclusion Overall, the addition of HMP to broilers' feed improved growth performance, feed efficiency, carcass characteristics, blood biochemical constituents, antioxidant status, immune response, and gene expression, particularly at 2 g/kg and 3 g/kg supplementation. CRediT authorship contribution statement Khloud M. Algothmi: Writing – review & editing, Writing – original draft, Visualization, Validation, Methodology, Investigation, Data curation, Conceptualization. Dalal S. Alshaya: Writing – review & editing, Writing – original draft, Visualization, Methodology, Funding acquisition, Formal analysis, Conceptualization. Disclosures The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Acknowledgments Princess Nourah bint Abdulrahman University Researchers Supporting Project number (PNURSP2026R465), Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia. References Abbas M., Abbas G., Hashmi A.H., Jaffery S., Li Y., Zhao G., Xihe L. Sustainable AGP alternatives: a systems approach to non-antibiotic growth regulators standardization, synergistic formulation and environmental safety. Front. Vet. Sci. 2026;12 doi: 10.3389/fvets.2025.1695160. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Abd El-Hack M.E., Rudayni H..A., Aldhalmi A.K., Youssef I.M., Arif M., Alawam A.S., Allam A.A., Khafaga A.F., Ashour E.A., Khan M.M. Beyond traditional uses: unveiling the epigenetic, microbiome-modulating, metabolic, and nutraceutical benefits of Salvia officinalis in human and livestock nutrition. J. Funct. Foods. 2025;128 [ Google Scholar ] Abd El-Hack M.E., AboElMaati M..F., Abusudah W.F., Awlya O.F., Almohmadi N.H., Fouad W., Mohamed H.S., Youssef I.M., Al-Gabri N.A., Othman S.I., Allam A.A., Taha A.E., Tellez-Isaias G., Mansour A.M. Consequences of dietary cinnamon and ginger oils supplementation on blood biochemical parameters, oxidative status, and tissue histomorphology of growing Japanese quails. Poult. Sci. 2024;103 doi: 10.1016/j.psj.2023.103314. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Abd El-Hack M.E., Mahgoub S..A., Alagawany M., Ashour E.A. Improving productive performance and mitigating harmful emissions from laying hen excreta via feeding on graded levels of corn DDGS with or without Bacillus subtilis probiotic. J. Anim. Physiol. Anim. Nutr. 2017;101:904–913. doi: 10.1111/jpn.12522. [ DOI ] [ PubMed ] [ Google Scholar ] Abdeldaiem M.H. Use of yellow pigment extracted from turmeric (Curcuma longa) rhizomes powder as natural food preservative and colorant. Food Sci. Qual. Manag. 2013;22:56–68. [ Google Scholar ] Abdel-Shafi S., Al-Mohammadi A.R., Sitohy M., Mosa B., Ismaiel A., Enan G., Osman A. Antimicrobial activity and chemical constitution of the crude, phenolic-rich extracts of Hibiscus sabdariffa, Brassica oleracea and Beta vulgaris. Molecules. 2019;24:4280. doi: 10.3390/molecules24234280. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Abdulla N.R., Loh T..C., Foo H.L., Alshelmani M.I., Akit H. Influence of dietary ratios of n-6: n-3 fatty acid on gene expression, fatty acid profile in liver and breast muscle tissues, serum lipid profile, and immunoglobulin in broiler chickens. J. Appl. Poult. Res. 2019;28:454–469. [ Google Scholar ] Abou-Kassem D.E., Ashour E..A., Mahrose K.M., Youssef I.M., Tellez-Isaias G., Swelum A.A., Abd El-Hack M.E. Growth performance, carcass traits, meat composition, digestibility coefficients and caecal microbiota of growing rabbits fed diets supplemented with a herbal mixture. Trop. Anim. Health Prod. 2025;57:22. doi: 10.1007/s11250-024-04249-8. [ DOI ] [ PubMed ] [ Google Scholar ] Aderemi F.A., Alabi O.M. Turmeric (Curcuma longa): an alternative to antibiotics in poultry nutrition. Transl. Anim. Sci. 2023;7:txad133. doi: 10.1093/tas/txad133. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Ahmad T., Muhammad Sayyaf A.R., Talukder S., Kumar D., Sen A.R., Devadason I.P. Hand Book of Processed Functional Meat Products. Springer Nature Switzerland; Cham: 2024. Herbs, spices and condiments for processed meat products; pp. 97–111. [ Google Scholar ] Ahmadipour B., Pat S., Abaszadeh S., Hassanpour H., Khajali F. Pomegranate peel as a phytogenic in broiler chickens: influence upon antioxidant, lipogenesis and hypotensive response. Vet. Med. Sci. 2021;7:1907–1913. doi: 10.1002/vms3.556. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Alhujaili W., Youssef I.M., Alharbi H.M., Alwutayd K.M., Alkhateeb M.A., Baset S.A.A. Influence of plant-based antioxidant and immune-enhancing agents on blood profiles, growth metrics, carcass traits, and gut microbiota in broiler chickens. Poult. Sci. 2025;104 doi: 10.1016/j.psj.2025.106321. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] AOAC . 18th ed. Association of Official Analytical Chemistry; Maryland, USA: 2012. Official Method of Analysis of. [ Google Scholar ] Aref S., Habiba R., Morsy N., Abdel-Daim M., Zayet F. Improvement of the shelf life of grey mullet (Mugil cephalus) fish steaks using edible coatings containing chitosan, nanochitosan, and clove oil during refrigerated storage. Food prod. Process. Nutr. 2022;4:27. [ Google Scholar ] Arisha M., Attia A.I., Reda F.M., Youssef I.M., Swelum A.A., Cheng Y., Abd El-Hack M.E. Consequences of dietary red pepper and radish oils’ supplementation on growth, carcass traits, blood indices, digestive enzymes activity and intestinal microbial load of broilers. J. Appl. Poult. Res. 2024;33 [ Google Scholar ] Ashokkumar K., Murugan M., Dhanya M.K., Pandian A., Warkentin T.D. Phytochemistry and therapeutic potential of black pepper [Piper nigrum (L.)] essential oil and piperine: a review. Clin. Phytosci. 2021;7:52. [ Google Scholar ] Asif M. Chemistry and antioxidant activity of plants containing some phenolic compounds. Chem. Int. 2015;1:35–52. [ Google Scholar ] Ayele M., Waktole H., Tamir B., Regassa F., Tufa T.B. Effects of phytogenic feed additives on body weight gain and gut bacterial load in broiler chickens. Worlds Vet. J. 2023;13:205–213. [ Google Scholar ] Balakrishnan R., Azam S., Kim I.S., Choi D.K. Neuroprotective effects of black pepper and its bioactive compounds in age-related neurological disorders. Aging Dis. 2023;14:750. doi: 10.14336/AD.2022.1022. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Bekhit A., Morton J.D., Bhat Z.F., Kong L. Meat color: factors affecting colour stability. Encycl. Food Chem. 2019;2:202–210. [ Google Scholar ] Belinskaia D.A., Voronina P..A., Goncharov N.V. Integrative role of albumin: evolutionary, biochemical and pathophysiological aspects. J. Evol. Biochem. Physiol. 2021;57:1419–1448. doi: 10.1134/S002209302106020X. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Benbaibeche H., Boumehira A.Z., Khan N.A. Natural bioactive compounds and their mechanisms of action in the management of obesity: a narrative review. Front. Nutr. 2025;12 doi: 10.3389/fnut.2025.1614947. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Bhagat, J., and B.S. Ingole. 2016. Glutathione S-transferase, catalase, superoxide dismutase, glutathione peroxidase, and lipid peroxidation as a biomarker of oxidative stress in snails: a review. Chimbetete N., Verghese M., Sunkara R., Walker L.T. Food Nutr. Sci. Vol. 10, No. 03. 2019. Phytochemical content, radical scavenging ability & enzyme inhibiting activities of selected spices (cinnamon, cardamom and cloves) pp. 266–275. [ Google Scholar ] Cufadar Y., Beyari E.A., Hassoubah S.A., Curabay B., Sevim B., Aksoy A., Alfassam H.E., Rudayni H.A., Allam A.A., Youssef I.M., Moustafa M., Al-Shahrani M.O., Algopish U., Hassan H., Abd El-Hack M.E. Impacts of Bacillus probiotics on productive performance and egg quality criteria in laying Japanese quail. J. Appl. Poult. Res. 2024;33 [ Google Scholar ] Dar R.A., Shahnawaz M.., Ahanger M.A., Majid I.U. Exploring the diverse bioactive compounds from medicinal plants: a review. J. Phytopharm. 2023;12:189–195. [ Google Scholar ] Deeb S.E., Ashour E..A., Youssef I.M., Alshehry G., Abuljadayel D.A., Aljahdali N., Albaqami N.M., Bahnas M.M., Abd El-Hack M.E. Enhancing broiler growth, carcass quality, blood parameters and intestinal microbial load: the role of dietary garlic powder as a natural growth promoter. Ann. Anim. Sci. 2025;25:1467–1478. [ Google Scholar ] Diniz do Nascimento L., Barbosa de Moraes A.A., Santana da Costa K., Pereira Galúcio J.M., Taube P.S., Leal Costa C.M., Cruz N.J., Helena de Aguiar Andrade E., Guerreiro de Faria L.J. Bioactive natural compounds and antioxidant activity of essential oils from spice plants: new findings and potential applications. Biomolecules. 2020;10:988. doi: 10.3390/biom10070988. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Dosoky W.M., Farag S..A., Almuraee A.A., Youssef I.M., Awlya O.F., Abusudah W.F., Qadhi A., Arbaeen A.F., Moustafa M., Hassan H., Tellez-Isaias G. Vitamin C and/or garlic can antagonize the toxic effects of cadmium on growth performance, and hematological, and immunological parameters of growing Japanese quail. Poult. Sci. 2024;103 doi: 10.1016/j.psj.2024.103457. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] El-Abasy M.M., Ashour E..A., Bassiony S.S., Youssef I.M., Loutfi M., Salem S.S., Mahgoub S.A., Abou-Kassem D.E., Althubyani S.A., Zouidi F., Abd El-Hack M.E. Effects of dietary levels of bay laurel leaf extract conjugated with zinc nanoparticles on growth performance, carcass traits, and blood parameters in broilers. Ann. Anim. Sci. 2025;25:1065–1074. [ Google Scholar ] Faehnrich B., Lukas B., Humer E., Zebeli Q. Phytogenic pigments in animal nutrition: potentials and risks. J. Sci. Food Agric. 2016;96:1420–1430. doi: 10.1002/jsfa.7478. [ DOI ] [ PubMed ] [ Google Scholar ] Fernández-Lázaro D., Mielgo-Ayuso J., Martínez A.C., Seco-Calvo J. Iron and physical activity: bioavailability enhancers, properties of black pepper (bioperine®) and potential applications. Nutrients. 2020;12:1886. doi: 10.3390/nu12061886. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Gajender A.M., Sharma A., Azad M.A. A comprehensive review of the pharmacological importance of dietary flavonoids as hepatoprotective agents. Evid. Based Complement. Alternat. Med. 2023;2023 doi: 10.1155/2023/4139117. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Gao J., Zhang M., Niu R., Gu X., Hao E., Hou X., Deng J., Bai G. The combination of cinnamaldehyde and kaempferol ameliorates glucose and lipid metabolism disorders by enhancing lipid metabolism via AMPK activation. J. Funct. Foods. 2021;83 [ Google Scholar ] Ghareeb K.A.A.W., Awad W.A., Böhm J., Zebeli Q. Impact of luminal and systemic endotoxin exposure on gut function, immune response and performance of chickens. Worlds Poult. Sci. J. 2016;72:367–380. [ Google Scholar ] Ghimpețeanu O.M., Pogurschi E..N., Popa D.C., Dragomir N., Drăgotoiu T., Mihai O.D., Petcu C.D. Antibiotic use in livestock and residues in food—A public health threat: a review. Foods. 2022;11:1430. doi: 10.3390/foods11101430. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Gieryńska M., Szulc-Dąbrowska L., Struzik J., Mielcarska M.B., Gregorczyk-Zboroch K.P. Integrity of the intestinal barrier: the involvement of epithelial cells and microbiota—a mutual relationship. Animals. 2022;12:145. doi: 10.3390/ani12020145. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Greene E.S., Maynard C.., Owens C.M., Meullenet J.F., Dridi S. Effects of herbal adaptogen feed-additive on growth performance, carcass parameters, and muscle amino acid profile in heat-stressed modern broilers. Front. Physiol. 2021;12 doi: 10.3389/fphys.2021.784952. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Haq I.U., Imran M.., Nadeem M., Tufail T., Gondal T.A., Mubarak M.S. Piperine: a review of its biological effects. Phytother. Res. 2021;35:680–700. doi: 10.1002/ptr.6855. [ DOI ] [ PubMed ] [ Google Scholar ] Hosseini H., Ghavidel F., Panahi G., Majeed M., Sahebkar A. A systematic review and meta-analysis of randomized controlled trials investigating the effect of the curcumin and piperine combination on lipid profile in patients with metabolic syndrome and related disorders. Phytother. Res. 2023;37:1212–1224. doi: 10.1002/ptr.7730. [ DOI ] [ PubMed ] [ Google Scholar ] Hughes J.M., Clarke F..M., Purslow P.P., Warner R.D. Meat color is determined not only by chromatic heme pigments but also by the physical structure and achromatic light scattering properties of the muscle. Compr. Rev. Food Sci. Food Saf. 2020;19:44–63. doi: 10.1111/1541-4337.12509. [ DOI ] [ PubMed ] [ Google Scholar ] Hughes J.M., Oiseth S..K., Purslow P.P., Warner R.D. A structural approach to understanding the interactions between colour, water-holding capacity and tenderness. Meat Sci. 2014;98:520–532. doi: 10.1016/j.meatsci.2014.05.022. [ DOI ] [ PubMed ] [ Google Scholar ] Ibrahim A.A., Osman E..S., Megahid A.A., Rabie A.H., Galal M.S. Effect of some dietary herbal supplements as growth promoters on productive and physiological performance of broilers. Egypt. J. Agric. Res. 2024;102:315–321. [ Google Scholar ] Ighodaro O.M., Akinloye O.A. First line defence antioxidants-superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPX): their fundamental role in the entire antioxidant defence grid. Alexandria J. Med. 2018;54:287–293. [ Google Scholar ] Kairalla M.A., Aburas A.A., Alshelmani M.I. Effect of diet supplemented with graded levels of ginger (Zingiber officinale) powder on growth performance, hematological parameters, and serum lipids of broiler chickens. Arch. Razi Inst. 2022;77:2077–2083. doi: 10.22092/ARI.2022.359958.2524. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Kairalla M.A., Alshelmani M.I. The influence of supplementation of licorice powder (Glycyrrhiza glabra) to broiler diets on growth performance, hematological parameters and serum lipids. Arch. Vet. Med. 2025;18:129–143. [ Google Scholar ] Kairalla M.A., Alshelmani M..I., Aburas A.A. Effect of diet supplemented with graded levels of garlic (Allium sativum L.) powder on growth performance, carcass characteristics, blood hematology, and biochemistry of broilers. Open Vet. J. 2022;12:595–601. doi: 10.5455/OVJ.2022.v12.i5.1. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Kairalla M.A., Alshelmani M..I., Imdakim M.M. Effect of diet supplemented with different levels of moringa powder on growth performance, carcass characteristics, meat quality, hematological parameters, serum lipids, and economic efficiency of broiler chickens. Arch. Razi Inst. 2023;78:1421–1430. doi: 10.22092/ARI.2023.78.5.1647. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Khatri P., Rani A., Hameed S., Chandra S., Chang C.M., Pandey R.P. Current understanding of the molecular basis of spices for the development of potential antimicrobial medicine. Antibiotics. 2023;12:270. doi: 10.3390/antibiotics12020270. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Lam P., Cheung F., Tan H.Y., Wang N., Yuen M.F., Feng Y. Hepatoprotective effects of Chinese medicinal herbs: a focus on anti-inflammatory and anti-oxidative activities. Int. J. Mol. Sci. 2016;17:465. doi: 10.3390/ijms17040465. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Lauridsen C. From oxidative stress to inflammation: redox balance and immune system. Poult. Sci. 2019;98:4240–4246. doi: 10.3382/ps/pey407. [ DOI ] [ PubMed ] [ Google Scholar ] Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [ DOI ] [ PubMed ] [ Google Scholar ] Madesh M., Yan J., Jinan G., Hu P., Kim I.H., Liu H.Y., Ennab W., Jha R., Cai D. Phytogenics in swine nutrition and their effects on growth performance, nutrient utilization, gut health, and meat quality: a review. Stress Biol. 2025;5:11. [ Google Scholar ] Makuch S., Więcek K., Woźniak M. The immunomodulatory and anti-inflammatory effect of curcumin on immune cell populations, cytokines, and in vivo models of rheumatoid arthritis. Pharmaceuticals. 2021;14:309. doi: 10.3390/ph14040309. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Mohamed A.A., Attia A..I., Reda F.M., Youssef I.M., Alshehry G., Aljahdali N., Albaqami N.M., El-Kholy M.S., Abd El-Hack M.E. Effect of Artemisia absinthium oil supplementation on growth performance, immune response, digestive health, and gut microbiota in broiler chicks. Ann. Anim. Sci. 2025;25:1489–1499. [ Google Scholar ] Mollazadeh H., Hosseinzadeh H. Cinnamon effects on metabolic syndrome: a review based on its mechanisms. Iran. J. Basic Med. Sci. 2016;19:1258. doi: 10.22038/ijbms.2016.7906. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Naeem M., Fatima A., Raut R., Kumar R., Tushar Z., Rahman F., Bourassa D. Management and genetic approaches for enhancing meat quality in poultry production systems: a comprehensive review. Poultry. 2026;5:4. [ Google Scholar ] Nassar F.S. Strategic role of poultry production sciences in shaping the future of global food security and strengthen sustainability. Poult. Sci. 2026 doi: 10.1016/j.psj.2026.106617. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Nawaz A.H., Zhang L. Oxidative stress in broiler chicken and its consequences on meat quality. Int. J. Life Sci. Res. Arch. 2021;1:045–054. [ Google Scholar ] Negm M.H., Aldhalmi A..K., Ashour E.A., Mohamed L.A., Youssef I.M., Moustafa M., Abdelglil M.I., Abdel-Shafi S., Mahgoub S.A., Abd El-Hack M.E., Swelum A.A. The effect of celery (Apium graveolens) seed powder in the diet on growth, immune function, antioxidant status and gut microbial balance in broiler chickens. Trop. Anim. Health Prod. 2025;57:377. doi: 10.1007/s11250-025-04625-y. [ DOI ] [ PubMed ] [ Google Scholar ] Nguyen M.M., Karboune S. Combinatorial interactions of essential oils enriched with individual polyphenols, polyphenol mixes, and plant extracts: multi-antioxidant systems. Antioxidants. 2023;12:486. doi: 10.3390/antiox12020486. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] North M.O. 2nd ed. AV., Publishing Company I.N.C.; Westpost Connicticut, USA: 1981. Commercial Chicken Production. Annual. [ Google Scholar ] NRC . 9th ed. National Academy Press; Washington, DC, USA: 1994. Nutrient Requirements of Poultry. [ Google Scholar ] Oni A.I., Oke O.E. Gut health modulation through phytogenics in poultry: mechanisms, benefits, and applications. Front. Vet. Sci. 2025;12 doi: 10.3389/fvets.2025.1616734. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Ordonez A.A.L., Gomez J.D., Vattuone M.A. Antioxidant activities of Sechium edule (Jacq.) Swartz extracts. Food Chem. 2006;97:452–458. [ Google Scholar ] Orlowski S., Flees J., Greene E.S., Ashley D., Lee S.O., Yang F.L., Owens C.M., Kidd M., Anthony N., Dridi S. Effects of phytogenic additives on meat quality traits in broiler chickens. J. Anim. Sci. 2018;96:3757–3767. doi: 10.1093/jas/sky238. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Oxoid Ltd . 9th ed. Oxoid Ltd.; UK: 2006. Oxoid Manual. Wade Rd., Basingstoke, Hants RG24 8PW. [ Google Scholar ] Pan S., Chen Y., Zhang L., Liu Z., Xu X., Xing H. Curcumin represses lipid accumulation through inhibiting ERK1/2-PPAR-γ signaling pathway and triggering apoptosis in porcine subcutaneous preadipocytes. Anim. Biosci. 2021;35:763. doi: 10.5713/ab.21.0371. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Pandita D., Pandita A. CRC Press; 2025. Antiviral Secrets of Medicinal Plants. [ Google Scholar ] Parkavi S., Saraswathy S., Rajasree V., Venkatesan K., Anand G., Rajesh S. Cardamom bioactives in functional foods: advances in green extraction, encapsulation and therapeutic efficacy. N. Z. J. Crop Hortic. Sci. 2026;54 [ Google Scholar ] Patel S.S., Acharya A.., Ray R.S., Agrawal R., Raghuwanshi R., Jain P. Cellular and molecular mechanisms of curcumin in prevention and treatment of disease. Crit. Rev. Food Sci. Nutr. 2020;60:887–939. doi: 10.1080/10408398.2018.1552244. [ DOI ] [ PubMed ] [ Google Scholar ] Patra A.K., Amasheh S.., Aschenbach J.R. Modulation of gastrointestinal barrier and nutrient transport function in farm animals by natural plant bioactive compounds–a comprehensive review. Crit. Rev. Food Sci. Nutr. 2019;59:3237–3266. doi: 10.1080/10408398.2018.1486284. [ DOI ] [ PubMed ] [ Google Scholar ] Ramanathan R., Denzer M., Kiyimba F., Harr K., Suman S.P., Hunt M., Pfeiffer M., Mafi G.G., Kim Y.H.B. Role of postmortem bioenergetics in beef colour chemistry. Ital. J. Anim. Sci. 2023;22:711–727. [ Google Scholar ] Rapa S.F., Di Iorio B..R., Campiglia P., Heidland A., Marzocco S. Inflammation and oxidative stress in chronic kidney disease—potential therapeutic role of minerals, vitamins and plant-derived metabolites. Int. J. Mol. Sci. 2019;21:263. doi: 10.3390/ijms21010263. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Reda F.M., Mahmoud H..K., Youssef I.M., Khan M.M., Algahdali E.H., Alharbi H.M., Alwutayd K.M., Abd El-Hack M.E., Mohamed R.S., El-Mekkawy M.M. Effects of dietary Rhus coriaria L. powder on growth performance, antioxidant status, and immune competence of broiler chickens under high-density rearing conditions. J. Appl. Poult. Res. 2026;35 [ Google Scholar ] Rudrapal M., Rakshit G., Singh R.P., Garse S., Khan J., Chakraborty S. Dietary polyphenols: review on chemistry/sources, bioavailability/metabolism, antioxidant effects, and their role in disease management. Antioxidants. 2024;13:429. doi: 10.3390/antiox13040429. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Saber H.S., Khalil H..A., El-Kashef M.M., Elsayed D.A., Anas H., Alharbi H.M., Alwutayd K.M., Khan M.M.H., Abd El-Hack M.E., Youssef I.M. Synergistic impacts of garlic and curcumin on growth performance, carcass characteristics, immunity, antioxidant status, and gut histology of broiler chickens. Poult. Sci. 2026;105 doi: 10.1016/j.psj.2026.106608. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Sahoo D.K., Heilmann R..M., Paital B., Patel A., Yadav V.K., Wong D., Jergens A.E. Oxidative stress, hormones, and effects of natural antioxidants on intestinal inflammation in inflammatory bowel disease. Front. Endocrinol. 2023;14 doi: 10.3389/fendo.2023.1217165. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Salem M.E., Aref S..M., Abouelwafa M.Y., Mokbel S.M., Motawei A.M., Al-Farga A., Moussa-Ayoub T.E. Impact of replacing fat with pearl millet fibers on the bioactivity and quality of beef burger. Sci. Rep. 2025 doi: 10.1038/s41598-025-30464-w. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Salsabila H.U.L.W.A., Fitriani L.I.L.I., Zaini E.R.I.Z.A.L. Recent strategies for improving solubility and oral bioavailability of piperine. Int. J. Appl. Pharm. 2021;13:31–39. [ Google Scholar ] Sandner G., Heckmann M., Weghuber J. Immunomodulatory activities of selected essential oils. Biomolecules. 2020;10:1139. doi: 10.3390/biom10081139. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] SAS . Version 9.4 SASInst. Inc.; Cary, NC., USA: 2014. SAS User’s Guide: Statistics. [ Google Scholar ] Shahcheraghi S.H., Salemi F.., Peirovi N., Ayatollahi J., Alam W., Khan H., Saso L. Nrf2 regulation by curcumin: molecular aspects for therapeutic prospects. Molecules. 2021;27:167. doi: 10.3390/molecules27010167. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Sharma S., Kumar M., Sharma S., Nargotra A., Koul S., Khan I.A. Piperine as an inhibitor of Rv1258c, a putative multidrug efflux pump of mycobacterium tuberculosis. J. Antimicrob. Chemother. 2010;65:1694–1701. doi: 10.1093/jac/dkq186. [ DOI ] [ PubMed ] [ Google Scholar ] Singh V.V., Singh V..K., Tewari D., Gautam S., Singh V.B., Singh P. Performance of broiler chicken fed diets supplemented with a phytogenic mixture. Indian J. Anim. Nutr. 2019;36:58. [ Google Scholar ] Sirivibulkovit K., Nouanthavong S., Sameenoi Y. Based DPPH assay for antioxidant activity analysis. Anal. Sci. 2018;34:795–800. doi: 10.2116/analsci.18P014. [ DOI ] [ PubMed ] [ Google Scholar ] Sivaranjani R. The Cardamom Genome. Springer Nature Switzerland; Cham: 2024. Genomics of flavor constituents of cardamom; pp. 77–87. [ Google Scholar ] Smitha Grace S.R., Chandran G.., Chauhan J.B. Plant and Human Health, Volume 2: Phytochemistry and Molecular Aspects. 2019. Terpenoids: an activator of "fuel-sensing enzyme AMPK" with special emphasis on antidiabetic activity; pp. 227–244. [ Google Scholar ] Speisky H., Shahidi F., Costa de Camargo A., Fuentes J. Revisiting the oxidation of flavonoids: loss, conservation or enhancement of their antioxidant properties. Antioxidants. 2022;11:133. doi: 10.3390/antiox11010133. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Srinivasan K. Black pepper and its pungent principle-piperine: a review of diverse physiological effects. Crit. Rev. Food Sci. Nutr. 2007;47:735–748. doi: 10.1080/10408390601062054. [ DOI ] [ PubMed ] [ Google Scholar ] Sumadja W.A., Filawati F.., Ramadhan I.I., Rahmasari N., Tarigan I.L. Phytogenic feed additive derived from Peronema canescens leaves: bioactive profile, effects on broiler growth, carcass yield, blood biochemistry, and molecular interactions. Open Vet. J. 2025;15:4617. doi: 10.5455/OVJ.2025.v15.i9.67. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Tahir M., Diyana N., Yap S.Y., Azmai A., Noor M., Zahli U., Gan H.M. Genomic characterization of vibrio spp. in Asian seabass (Lates calcarifer, Bloch, 1790) following field vaccination using a feed-based inactivated vaccine against vibriosis. J. Med. Vet. 2025;8:1. [ Google Scholar ] Tjandrawinata R.R., Rosari B..P., Syahputra R.A., Surya R., Nurkolis F. Cinnamon-derived phytonutrients as modulators of ion channels and G protein-coupled receptor signaling in metabolic diseases. Nutrients. 2026;18:547. doi: 10.3390/nu18030547. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Trigo-Gutierrez J.K., Vega-Chacón Y.., Soares A.B., Mima E.G.D.O. Antimicrobial activity of curcumin in nanoformulations: a comprehensive review. Int. J. Mol. Sci. 2021;22:7130. doi: 10.3390/ijms22137130. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Vasconcelos N.G., Croda J.., Simionatto S. Antibacterial mechanisms of cinnamon and its constituents: a review. Microb. Pathog. 2018;120:198–203. doi: 10.1016/j.micpath.2018.04.036. [ DOI ] [ PubMed ] [ Google Scholar ] Vuolo M.M., Lima V..S., Junior M.R.M. Bioactive Compounds. Woodhead Publishing; 2019. Phenolic compounds: structure, classification, and antioxidant power; pp. 33–50. [ Google Scholar ] Wang X., Zhang Y., Zhang L., Wang W., Che H., Zhang Y. Piperine attenuates hepatic steatosis and insulin resistance in high-fat diet-induced obesity in Sprague-Dawley rats. Nutr. Res. 2022;108:9–21. doi: 10.1016/j.nutres.2022.10.007. [ DOI ] [ PubMed ] [ Google Scholar ] Yin L., Hussain S., Tang T., Gou Y., He C., Liang X., Yin Z., Shu G., Zou Y., Fu H., Song X., Tang H., Xu F., Ouyang P. Protective effects of cinnamaldehyde on the oxidative stress, inflammatory response, and apoptosis in the hepatocytes of Salmonella Gallinarum-challenged young chicks. Oxid. Med. Cell. Longev. 2022;2022 doi: 10.1155/2022/2459212. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Youssef I.M., Elsherbeni A..I., Almuraee A.A., Nass N.M., Beyari E.A., Alshammarii N.M., Abdel-Ghany A.M., Ahmed E.G., Nasr S., Youssef K.M., Salem H.M., Abd El-Hack M.E., Saber H.S. Influence of using synbiotics by various routes on Mandarah male chicks: intestinal bacterial counts, gut morphology and histological status. Poult. Sci. 2024;103 doi: 10.1016/j.psj.2024.103601. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Youssef I.M., Aldhalmi A..K., Felemban S.G., Elsherbeni A.I., Khalil H.A., Hassan M.S., Abd El Halim H.S., Abd El-Hack M.E., Youssef K.M., Swelum A.A., Tufarelli V., Abo-Samra M.A. Mannan oligosaccharides as a prebiotic for laying hens: effects on fertility, hatchability, productive performance, and immunity. Transl. Anim. Sci. 2024 doi: 10.1093/tas/txae123. txae123. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Youssef I.M., Khalil H..A., Shakoori A.M., Bagadood R.M., Alyahyawi A.Y., Alhazzaa R.A., Fakiha K.G., Nasr N., Abo-Samra M.A., Hassan M.S., Abd El Halim H.S., Abd El-Hack M.E., Jaremko M., Al-Nemi R., Youssef K.M. Immune response, hematological traits, biochemical blood parameters and histological status of laying hens influenced by dietary chitosan-oligosaccharides. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2023.102834. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Zeng X., Cai D., Zeng Q., Chen Z., Zhong G., Zhuo J., Gan H., Huang X., Zhao Z., Yao N., Huang D., Zhang C., Sun D., Chen Y. Selective reduction in the expression of UGTs and SULTs, a novel mechanism by which piperine enhances the bioavailability of curcumin in rat. Biopharm. Drug Dispos. 2017;38:3–19. doi: 10.1002/bdd.2049. [ DOI ] [ PubMed ] [ Google Scholar ] Zhu W., Han M., Bu Y., Li X., Yi S., Xu Y., Li J. Plant polyphenols regulating myoglobin oxidation and color stability in red meat and certain fish: a review. Crit. Rev. Food Sci. Nutr. 2024;64:2276–2288. doi: 10.1080/10408398.2022.2122922. [ DOI ] [ PubMed ] [ Google Scholar ] Zumbaugh C.A., Murugesan G..R., Wong E.A., Syed B., Persia M.E. Evaluation of a phytogenic feed additive on performance, nutrient digestion, and absorption in turkey poults. Anim. Feed Sci. Technol. 2020;267 [ Google Scholar ] Articles from Poultry Science are provided here courtesy of Elsevier ACTIONS View on publisher site PDF (1.2 MB) Cite Collections Permalink RESOURCES Similar articles Cited by other articles Links to NCBI Databases Follow NCBI NCBI on X (formerly known as Twitter) NCBI on Facebook NCBI on LinkedIn NCBI on GitHub NCBI RSS feed Connect with NLM NLM on X (formerly known as Twitter) NLM on Facebook NLM on YouTube National Library of Medicine 8600 Rockville Pike Bethesda, MD 20894 Web Policies FOIA HHS Vulnerability Disclosure Help Accessibility Careers NLM NIH HHS USA.gov Back to Top

Related documents

• Dietary supplementation with natural antioxidants: assessment of growth performance and meat quality in broiler chickens#200696
• Growth Response and Gastrointestinal Tract Characteristics of Broiler Chickens Offered Additives Extracts of Chromoleana Odorata Leaves#230149
• Exploring the modulatory effects of spotted pumpkin (Lagenaria breviflora) fruit aqueous extract on growth performance, behaviour and blood profile of broiler chickens.#360943
• Dietary Proteins: Metagenomic and Metabolomics Approaches for Human Biomarkers Identification#847407
• Effects of dietary garlic oil and black seed oil supplementation on growth performance, immunity, and immune-related gene expression in broiler chickens.#415496