Conceptio › Archive › NCBI PubMed Central
NCBI PubMed Centralopen access

Comprehensive mitogenomic insights into Hemibagrus velox endemic to Sumatra, Indonesia and its phylogenetic relationships within the Bagridae lineage.

Putra A et al. · ncbi_pmc
NCBI PubMed Central · Papers · License: Open Access
Open Source ↗Direct PDF ↓
distributed systems architecture

Comprehensive mitogenomic insights into Hemibagrus velox endemic to Sumatra, Indonesia and its phylogenetic relationships within the Bagridae lineage - PMC Skip to main content An official website of the United States government Here's how you know Here's how you know Official websites use .gov A .gov website belongs to an official government organization in the United States. Secure .gov websites use HTTPS A lock ( Lock Locked padlock icon ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites. Search Log in Dashboard Publications Account settings Log out Search… Search NCBI Primary site navigation Search Logged in as: Dashboard Publications Account settings Log in Search PMC Full-Text Archive Search in PMC Journal List User Guide PERMALINK Copy As a library, NLM provides access to scientific literature. Inclusion in an NLM database does not imply endorsement of, or agreement with, the contents by NLM or the National Institutes of Health. Learn more: PMC Disclaimer | PMC Copyright Notice BMC Genomics . 2026 Mar 10;27:386. doi: 10.1186/s12864-026-12705-y Search in PMC Search in PubMed View in NLM Catalog Add to search Comprehensive mitogenomic insights into Hemibagrus velox endemic to Sumatra, Indonesia and its phylogenetic relationships within the Bagridae lineage Angkasa Putra Angkasa Putra 1 Interdisciplinary Program of Marine and Fisheries Sciences and Convergent Technology, Pukyong National University, Busan, 48513 Republic of Korea Find articles by Angkasa Putra 1, # , Sarifah Aini Sarifah Aini 1 Interdisciplinary Program of Marine and Fisheries Sciences and Convergent Technology, Pukyong National University, Busan, 48513 Republic of Korea Find articles by Sarifah Aini 1, # , Hamdani Hamdani 2 Jakarta Technical University of Fisheries, Ministry of Marine Affairs and Fisheries, Jakarta, 12520 Republic of Indonesia Find articles by Hamdani 2 , Soo Rin Lee Soo Rin Lee 3 Marine Integrated Biomedical Technology Center, National Key Research Institutes in Universities, Pukyong National University, Busan, 48513 Republic of Korea 4 Research Center for Marine Integrated Bionics Technology, Pukyong National University, Busan, 48513 Republic of Korea Find articles by Soo Rin Lee 3, 4 , Ah Ran Kim Ah Ran Kim 3 Marine Integrated Biomedical Technology Center, National Key Research Institutes in Universities, Pukyong National University, Busan, 48513 Republic of Korea 4 Research Center for Marine Integrated Bionics Technology, Pukyong National University, Busan, 48513 Republic of Korea Find articles by Ah Ran Kim 3, 4 , Tatty Yuniarti Tatty Yuniarti 2 Jakarta Technical University of Fisheries, Ministry of Marine Affairs and Fisheries, Jakarta, 12520 Republic of Indonesia Find articles by Tatty Yuniarti 2 , Sang Van Vu Sang Van Vu 5 Faculty of Biology, University of Science, Vietnam National University, Hanoi, 11400 Vietnam Find articles by Sang Van Vu 5 , Jung Hwa Choi Jung Hwa Choi 6 Ocean and Fisheries Development International Cooperation Institute, College of Fisheries Science, Pukyong National University, Busan, 48513 Republic of Korea Find articles by Jung Hwa Choi 6 , Won-Kyo Jung Won-Kyo Jung 3 Marine Integrated Biomedical Technology Center, National Key Research Institutes in Universities, Pukyong National University, Busan, 48513 Republic of Korea 7 Major of Biomedical Engineering, Division of Smart Healthcare, College of Information Technology and Convergence and New-Senior Healthcare Innovation Center (BK21 Plus), Pukyong National University, Busan, 48513 Republic of Korea Find articles by Won-Kyo Jung 3, 7 , Hyun-Woo Kim Hyun-Woo Kim 3 Marine Integrated Biomedical Technology Center, National Key Research Institutes in Universities, Pukyong National University, Busan, 48513 Republic of Korea 4 Research Center for Marine Integrated Bionics Technology, Pukyong National University, Busan, 48513 Republic of Korea 8 Department of Marine Biology, College of Fisheries Science, Pukyong National University, Busan, 48513 Republic of Korea 9 Department of Biology, Faculty of Science and Technology, Airlangga University, Surabaya, 60115 Republic of Indonesia Find articles by Hyun-Woo Kim 3, 4, 8, 9 , Hye-Eun Kang Hye-Eun Kang 10 Institute of Marine Life Science, Pukyong National University, Busan, 48513 Republic of Korea Find articles by Hye-Eun Kang 10, ✉ , Shantanu Kundu Shantanu Kundu 1 Interdisciplinary Program of Marine and Fisheries Sciences and Convergent Technology, Pukyong National University, Busan, 48513 Republic of Korea 6 Ocean and Fisheries Development International Cooperation Institute, College of Fisheries Science, Pukyong National University, Busan, 48513 Republic of Korea 11 International Graduate Program of Fisheries Science, Pukyong National University, Busan, 48513 Republic of Korea Find articles by Shantanu Kundu 1, 6, 11, ✉ Author information Article notes Copyright and License information 1 Interdisciplinary Program of Marine and Fisheries Sciences and Convergent Technology, Pukyong National University, Busan, 48513 Republic of Korea 2 Jakarta Technical University of Fisheries, Ministry of Marine Affairs and Fisheries, Jakarta, 12520 Republic of Indonesia 3 Marine Integrated Biomedical Technology Center, National Key Research Institutes in Universities, Pukyong National University, Busan, 48513 Republic of Korea 4 Research Center for Marine Integrated Bionics Technology, Pukyong National University, Busan, 48513 Republic of Korea 5 Faculty of Biology, University of Science, Vietnam National University, Hanoi, 11400 Vietnam 6 Ocean and Fisheries Development International Cooperation Institute, College of Fisheries Science, Pukyong National University, Busan, 48513 Republic of Korea 7 Major of Biomedical Engineering, Division of Smart Healthcare, College of Information Technology and Convergence and New-Senior Healthcare Innovation Center (BK21 Plus), Pukyong National University, Busan, 48513 Republic of Korea 8 Department of Marine Biology, College of Fisheries Science, Pukyong National University, Busan, 48513 Republic of Korea 9 Department of Biology, Faculty of Science and Technology, Airlangga University, Surabaya, 60115 Republic of Indonesia 10 Institute of Marine Life Science, Pukyong National University, Busan, 48513 Republic of Korea 11 International Graduate Program of Fisheries Science, Pukyong National University, Busan, 48513 Republic of Korea ✉ Corresponding author. # Contributed equally. Received 2025 Jul 1; Accepted 2026 Feb 25; Collection date 2026. © The Author(s) 2026 Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/ . PMC Copyright notice PMCID: PMC13085329  PMID: 41808001 Abstract Background The Bagridae (Actinopteri: Siluriformes) catfish Hemibagrus velox , endemic to Sumatra, Indonesia, raises critical taxonomic concerns due to limited molecular evidence. Recent advances in mitogenomic approaches offer a robust framework for resolving such ambiguities. Accordingly, the present study aims to characterize the complete mitogenome of H. velox and to conduct a comprehensive comparative analysis of gene structure and variation among its congeners, as well as to evaluate its phylogenetic position within the broader bagrid lineage. Results The current investigation reveals the mitogenome of H. velox (16,512 bp), comprising 37 genes, a non-coding control region (CR), an overall A + T bias of 58.09%, eleven intergenic spacers, and six overlapping regions. Most protein-coding genes (PCGs) in Hemibagrus species initiated translation with the standard ATG start codon, except for the COI gene (GTG). The amino acid composition analysis exhibited a high frequency of leucine, serine, and arginine residues, whereas methionine and tryptophan were the least abundant. The ratio of nonsynonymous to synonymous substitutions indicated strong purifying selection acting on the PCGs across Hemibagrus species. The secondary structure of 21 transfer RNAs showed the typical cloverleaf structure, except for tRNA-Ser (S1). The comparative analysis of conserved sequence blocks within the CR among eight Hemibagrus species established variation in length and nucleotide composition, with tandem repeats exclusively found in H. guttatus within the extended termination-associated sequence region. The phylogenetic analyses employing Bayesian inference, Maximum-likelihood, and Neighbor-joining methods demonstrated that Hemibagrus is a non-monophyletic group within the family Bagridae. Conclusions Collectively, this study provides a detailed genetic characterization of H. velox and its seven congeners. The inferred matrilineal evolutionary pattern further strengthens earlier hypotheses regarding the delineation of genera within the broader Bagridae lineage. Furthermore, the findings underscore the urgent need to expand mitogenomic datasets for other bagrid catfishes to enhance the resolution of their systematics, evolutionary relationships, and biogeographic interpretations, thereby facilitating evidence-based conservation efforts and effective fisheries management. Supplementary Information The online version contains supplementary material available at 10.1186/s12864-026-12705-y. Keywords: Freshwater species, Bagrid catfishes, Mitochondrial genome, Cladistics, Evolution, Conservation Background In recent decades, mitogenomic studies have become an indispensable tool in biodiversity research, offering critical insights into the systematics and evolutionary relationships of diverse organisms, including fishes [ 1 , 2 ]. The mitogenome possesses several distinctive features, viz., maternal inheritance, relatively small genome size, high mutation rate, absence of recombination, and high cellular copy number, that make it an effective and comprehensive molecular marker for genomic characterization and phylogenetic reconstruction [ 3 , 4 ]. Moreover, mitogenomic data have been shown to significantly contribute to the conservation and sustainable management of fisheries genetic resources by facilitating the assessment of genetic diversity and the detection of cryptic speciation [ 5 ]. The typical structure of the fish mitogenome is similar to that of other vertebrates and consists of a circular DNA molecule approximately 15–20 kilobases (kb) in length, encoding 13 protein-coding genes (PCGs), 2 ribosomal RNA (rRNA) genes, 22 transfer RNA (tRNA) genes, and a control region (CR) [ 6 , 7 ]. Although this genomic approach is rapidly advancing worldwide, reference mitogenomic data for many fish species and lineages remain underrepresented in public repositories such as the GenBank database [ 3 , 8 ]. This underscores the urgent need to expand the taxonomic coverage of fish mitogenomes to facilitate more comprehensive phylogenetic, biogeographic, and conservation-oriented research. The ray-finned fishes, representing the most diverse vertebrate group with 37,520 valid species distributed under 5,335 genera [ 9 ], play fundamental roles in maintaining aquatic ecosystem function, support the global fisheries sustainability, and serve as critical model organisms in a wide range of scientific disciplines [ 10 , 11 ]. Among them, the systematic classification of Old-World catfishes has undergone substantial revisions over the past century, with the family Bagridae being particularly subject to repeated taxonomic re-evaluations [ 12 ]. Initially, Bagridae was recognized as a single family comprising two subfamilies (Chrysichthyinae and Bagrinae) [ 13 ]. Furthermore, the taxonomic classification was revised to include five subfamilies viz., Ritinae, Chrysichthyinae, Bagrinae, Bagroidinae, and Auchenoglaninae, based on osteological traits [ 14 ]. Subsequently, the bagrids was taxonomically restructured into three distinct monophyletic groups, Claroteidae (comprising the subfamilies Claroteinae and Auchenoglanidinae), Austroglanididae (a newly established family represented exclusively by the genus Austroglanis ), and Bagridae (encompassing the subfamilies Ritinae and Bagrinae). The first two families, Claroteidae and Austroglanididae, are restricted to the African continent, whereas a few species of Bagrus within the family Bagridae are found in both Africa and South America. Nonetheless, the majority of other bagrid genera are broadly distributed across Asia, including regions such as Syria, Pakistan, India, Myanmar, Thailand, the Malay Peninsula, Indonesia, China, Taiwan, Korea, and Japan [ 14 , 15 ]. Currently, these three families are taxonomically recognized within the order Siluriformes and the suborder Siluroidei, with Claroteidae includes 65 valid species in nine genera, Austroglanididae comprises three valid species in a single genus, and Bagridae includes 234 valid species across 17 genera, inhabiting both freshwater and brackish environments [ 9 , 15 ]. Within the family Bagridae, the genus Hemibagrus , comprising large-bodied catfishes, was initially classified as a synonym of Mystus but was later revised and recognized as a distinct genus based on several distinctive morphological characters, including a dorsoventrally flattened head, a thin plate-like metapterygoid, and additional features such as a rough cranial shield lacking skin coverage, a slender occipital process, and an elongated adipose fin [ 15 – 17 ]. Despite this taxonomic revision, the genus Hemibagrus continues to present numerous systematic challenges, comprising difficulties in species-level identification, limited availability of reliable diagnostic characters, and high interspecific phenotypic plasticity [ 18 ]. The most recent taxonomic updates recognize 33 valid species within the genus, exhibiting a broad geographical distribution across tropical and subtropical Asia. Notably, the highest species diversity is observed exclusively in South Asia (three species), mainland Southeast Asia (eight species), and shared between mainland and island Southeast Asia (four species). Additional occurrences include five species from mainland Southeast Asia and southern China, two species exclusively from southern China, six species endemic to Borneo, three species endemic to Sumatra, one species endemic to Java, and one species documented in the transitional zone between South and Southeast Asia [ 9 ]. This wide distribution of this catfish group, particularly in Southeast Asia reflects the considerable ecological adaptability and complex speciation dynamics, likely shaped by the biogeographical history of the Sundaland region during the Pleistocene epoch [ 18 , 19 ]. The Hemibagrus species hold significant value as high-quality food fishes, with several species being locally cultivated, traded in the ornamental fish market, and utilized in various scientific studies [ 20 , 21 ]. The bagrid catfish Hemibagrus velox endemic to Sumatra, Indonesia was originally described from its type locality in the Dareh River, Western Sumatra [ 22 , 23 ]. Based on prior academic records, this species is distributed across multiple riverine systems and lakes in Sumatra [ 17 , 18 ]. This species also typically inhabits demersal zones of fast-flowing upstream river habitats with substrates dominated by rocks, gravel, or coarse sand [ 22 ]. Although currently categorized as ‘Least Concern’ by the IUCN Red List of Threatened Species, H. velox faces potential threats from overfishing and habitat degradation due to logging-related deforestation and land conversion for agriculture [ 24 ]. Therefore, sustainable fisheries management of this species necessitates an integrative framework that combines morphological and molecular evidence for accurate species delimitation, genetic assessment, and phylogenetic resolution [ 25 ]. Although conventional taxonomic approaches have been widely employed to assess morphological variation [ 18 , 26 ], molecular frameworks based on mitochondrial markers ( COI , COIII , Cytb , 16 S rRNA , and 12 S rRNA ) and nuclear markers ( RAG1 and RAG2 ) provide enhanced resolution for resolving systematic relationships within Hemibagrus [ 27 – 32 ]. Furthermore, the phylogeographic investigations employing Cytb and microsatellite markers have also elucidated the influence of geological events and sea-level fluctuations on the population distribution and genetic variation within Hemibagrus in Asian countries [ 33 – 35 ]. Nonetheless, the systematic status of H. velox within the Bagridae lineage remains poorly understood due to limited genetic information, currently restricted to three sequences from three partial mito-nuclear loci ( COI , Cytb , and RAG2 ) [ 19 , 36 ]. In particular, the COI and RAG2 genetic data were previously generated and used as an outgroup taxon to investigate the phylogenetic relationships of the Asian hillstream catfish family Sisoridae, rather than to assess the phylogenetic relationships within the family Bagridae [ 36 ]. In the same year, a DNA barcoding–based evaluation of the genus Hemibagrus was also conducted exclusively using the Cytb gene, which limited phylogenetic resolution due to reliance on a single genetic marker [ 19 ]. Moreover, complete mitogenomic data for Hemibagrus are currently available for only five of the eight recognized species groups ( H. guttatus , H. menoda , H. nemurus , H. pluriradiatus , and H. wyckii ) [ 18 ]. This limited taxonomic coverage warrants further investigation of the remaining species groups, particularly the H. planiceps species group, which includes H. velox . This paucity of molecular information also underscores the need for additional mitogenomic data to reliably resolve the systematic position of Southeast Asian species, notably Sundaic endemics. Accordingly, the present study aims to sequence and characterize the novel mitogenome of H. velox and performing a detailed comparative analysis of the gene structures and variations with other Hemibagrus congeners. The current study also infers the phylogenetic relationships of Hemibagrus and other bagrid species to elucidate their evolutionary trajectories within a broader matrilineal lineage perspective. Overall, by integrating a novel mitogenome, its detail profiling, and cladistic analyses, this research makes a significant contribution to the systematics of Hemibagrus and advances the understanding of evolutionary history within Asian bagrid catfishes. The genetic information further constitutes a critical basis for future population genetic analyses and supports the formulation of evidence-based conservation strategies for this endemic species inhabited within the restricted insular habitat in Sumatra, Indonesia. Methods Sampling and morphological examination A single wild specimen of a bagrid catfish was obtained from Lake Singkarak, located in Sumatra, Indonesia (0.558164°S, 100.547640°E) (Fig. 1 ). The species identification was conducted based on key morphological traits consistent with H. velox , as outlined in previous taxonomic references [ 18 , 22 ]. This species was characterized by an elongated body with a soft-rayed dorsal fin, a relatively long snout, a moderate interorbital distance, and a pair of barbels on both the upper and lower jaws that were proportionate to head size. The dorsal surface of the head and body color was grey, with a dorsal profile that gradually rose from the tip of the snout to the origin of the dorsal fin and then gently sloped downward to the end of the caudal peduncle. The specimen was euthanized using 2-phenoxyethanol at a final concentration of 600 µL L⁻¹, applied directly to the aquarium, following the prior protocol [ 37 ]. After confirming cessation of movement, the specimen was rinsed three times with Milli-Q water in preparation for molecular procedures. The dorsal muscle tissue (~ 20 g) was aseptically dissected along the lateral line and immediately placed into 2 mL tubes containing 95% molecular-grade ethanol, then stored at − 20 °C to ensure DNA stability and prevent microbial proliferation. The specimen was catalogued as voucher ‘IDN2’ and deposited in the collection of Jakarta Technical University of Fisheries, Pariaman Campus, Ministry of Marine Affairs and Fisheries, Indonesia. The molecular work was performed at the Molecular Physiology Laboratory, Pukyong National University, Busan, Republic of Korea. All experimental procedures adhered to ethical standards approved by the institutional animal care and use committee of the Pukyong National University Busan, Republic of Korea (Approval No. PKNUIACUC-2025-16 dated 18 February 2025), and were conducted in compliance with the ARRIVE 2.0 guidelines ( https://arriveguidelines.org/ ) [ 38 ]. The geographic distribution of H. velox , acquired from IUCN shapefile data, was visualized through a map produced using ArcGIS version 10.6 (Fig. 1 ). Fig. 1. Open in a new tab Map showing the IUCN-defined biogeographic distribution of H. velox in Sumatra, with the sampling site at Lake Singkarak marked by a blue pin. The map was generated using ArcGIS version 10.6, utilizing global administrative boundary shapefiles obtained from the DIVA-GIS platform and the elevation data were derived from the 90-meter spatial resolution Shuttle Radar Topography Mission (SRTM) digital elevation model, available at the CGIAR-CSI portal ( http://srtm.csi.cgiar.org/srtmdata/ ) Genomic DNA extraction and COI gene-based species authentication The genomic DNA was extracted from approximately 30 mg of H. velox muscle tissue using the AccuPrep ® Genomic DNA Extraction Kit (Bioneer, Daejeon, South Korea) in accordance with the manufacturer’s instructions. The tissue was homogenized in 600 µL of 1× lysis buffer employing a TissueLyser II (Qiagen, Hilden, Germany) for 60 s. To facilitate effective cell disruption and protein digestion, the homogenate was supplemented with 100 µL of sodium dodecyl sulfate (SDS) and 20 µL of proteinase K, then incubated at 60 °C for 12 h. The DNA precipitation was achieved by adding 500 µL of GC buffer and 300 µL of isopropanol, followed by transferring the mixture to a spin column and centrifuging at 8,000 rpm for one minute. The DNA bound to the column was washed sequentially with Wash Buffer 1 and Wash Buffer 2 to remove contaminants, then eluted in 50 µL of TE buffer for downstream analysis. The DNA quantity and purity were measured using a NanoDrop spectrophotometer (Thermo Fisher Scientific, D1000, Waltham, MA, USA). Partial amplification of the COI gene was performed utilizing the universal primers Fish-BCH and Fish-BCL and bidirectionally sequenced on an ABI PRISM 3730XL DNA Analyzer (Macrogen, Daejeon, South Korea) [ 39 ]. The resulting COI sequences were verified through BLAST against ( https://blast.ncbi.nlm.nih.gov ) to confirm species identity and subsequently submitted to GenBank database (accession no. PX974664 ). Mitogenome sequencing and assembly To assemble the mitogenome of H. velox , paired-end sequencing (2 × 150 bp) was performed on the NovaSeq platform (Illumina, San Diego, CA, USA) at Macrogen (Daejeon, South Korea; https://dna.macrogen.com/ ). The genomic DNA (100 ng) was fragmented to an optimal size using a Covaris adaptive focused acoustics system (Covaris, Woburn, MA, USA), producing blunt-ended, double-stranded DNA with phosphorylated 5′ termini. Library preparation was conducted using the TruSeq Nano DNA High-Throughput Library Prep Kit (Illumina), following the manufacturer’s guidelines. The fragmented DNA was subjected to end-repair, size selection via magnetic beads, addition of 3’-adenine overhangs, and ligation with TruSeq DNA UD Index adapters. The prepared library was then enriched through PCR amplification and the quantification of the final library was carried out using quantitative PCR with the KAPA Library Quantification Kit, and library quality was assessed using the Agilent 4200 TapeStation system equipped with D1000 ScreenTape (Agilent Technologies, Santa Clara, CA, USA). The high-quality paired-end raw reads (12,608,490 bp) generated through next-generation sequencing (NGS) yielded an average sequencing depth of approximately 100×. These reads were assembled in Geneious Prime version 2023.0.1 [ 40 ] using the Hemibagrus nemurus mitogenome from China (GenBank accession no. KM454860 ) [ 41 ] as a reference for guided mapping. The final assembly produced a single circular mitochondrial contig with a contig N50 of 16,585 bp. The assembled mitogenome was double-checked and validated using MEGA version 12 to ensure sequence accuracy and the continuity of each gene [ 42 ]. The annotation of gene boundaries, coding sequences, and gene orientations was performed using two independent annotation platforms, specifically the MitoAnnotator web server available through Mitofish version 2025.06 ( https://mitofish.aori.u-tokyo.ac.jp/annotation/input/ ) and the MITOS2 de-novo annotation of metazoan mitochondrial genomes, implemented within the Galaxy version 2.1.10 web server ( https://usegalaxy.eu ) [ 7 , 43 , 44 ]. The PCGs were further validated by translating nucleotide sequences using the Open Reading Frame Finder (ORFfinder; https://www.ncbi.nlm.nih.gov/orffinder/ ) to verify reading frames and confirm coding regions. The mitogenome sequence of H. velox was submitted to the GenBank repository and assigned an accession number ( PP922174 ). Mitogenome profiling and comparative assessment In the present investigation, a circular representation of the H. velox mitogenome was constructed using the MitoAnnotator platform to facilitate visualization of its genomic organization. The overall mitogenomic architecture was analyzed and compared with those of other congeners, including H. nemurus ( KM454860 ), Hemibagrus guttatus ( KJ458934 ), H. macropterus ( JF834542 ), Hemibagrus pluriradiatus ( PQ846023 ), H. punctatus ( OR759762 ), Hemibagrus spilopterus ( JQ343983 ), and Hemibagrus wyckioides ( KJ624624 ) [ 41 , 45 – 49 ] (Supplementary Table 1). A comparative genomic analysis between the generated H. velox mitogenome and 41 species mitogenomes from the Bagridae lineage was conducted using the Circoletto platform ( https://bat.infspire.org/circoletto/ ) [ 50 ]. Specifically, this analysis employed the nucleotide BLAST algorithm with defined minimum and maximum e-value thresholds to assess sequence similarity and synteny, and implemented the 7-color rainbow query scheme to produce an informative and visually appealing circular representation. The intergenic regions and overlapping genes were manually assessed using Microsoft Excel version 16. Both start and termination codons for PCGs were annotated based on the combined outputs of MEGA version 12 and MITOS. The nucleotide composition was analyzed across all 13 PCGs, two rRNAs, 22 tRNAs, and the CR using MEGA version 12. Strand asymmetry was evaluated by calculating AT-skew and GC-skew values using the formulas AT-skew = (A − T)/(A + T) and GC-skew = (G − C)/(G + C), following the earlier method [ 51 ]. Nucleotide diversity (π) across the mitogenome of Hemibagrus species was estimated using the sliding window approach in DnaSP version 6.0, employing a 200 bp window size and a 25 bp step interval [ 52 ]. To assess codon saturation in PCGs, transition (s) and transversion (v) substitution patterns were analyzed using DAMBE version 6 [ 53 ]. Additional analyses included evaluating relative synonymous codon usage (RSCU), determining amino acid abundance, assessing codon distribution per thousand codons (CDsPT), and performing pairwise comparisons of synonymous (Ks) and nonsynonymous (Ka) substitution rates between H. velox and related Hemibagrus congeneric species using DnaSP version 6.0. The gene boundaries for rRNAs and tRNAs were confirmed using both tRNAscan-SE version 2.0 and ARWEN version 1.2 [ 54 , 55 ]. To investigate conserved structural elements within the CR, multiple sequence alignments were performed among species of the Hemibagrus genus using the CLUSTAL X algorithm aligned with earlier research [ 56 , 57 ]. The potential tandem repeat elements within the CR were identified using the Tandem Repeats Finder tool ( https://tandem.bu.edu/trf/trf.html ), which is commonly employed in the identification of repetitive motifs [ 58 ]. Mitogenome-based phylogenetic relationships The phylogenetic relationships within the family Bagridae were constructed based on complete mitochondrial genome sequences of 42 valid species, including 24 species of Tachysurus , eight of Hemibagrus , five of Mystus , two of Horabagrus , and one species each of Bagroides , Bagrus , and Sperata (Supplementary Table 1). These taxa represent approximately 17,95% of the currently recognized species and cover seven of the 17 valid genera within the family Bagridae, as documented in Eschmeyer’s Catalog of Fishes [ 9 ]. The mitogenome of Cyprinus acutidorsalis (GenBank accession no. OQ871460 ), a species belonging to the subfamily Cyprininae within the family Cyprinidae [ 59 ], was utilized as an outgroup to establish the phylogenetic trees. The Bayesian (BA), Maximum-likelihood (ML), and Neighbor-joining (NJ) approaches were employed to infer evolutionary relationships. A concatenated alignment of the 13 PCGs was generated using iTaxoTools version 0.1 [ 60 ]. The optimal nucleotide substitution model (GTR + G + I) was selected based on the lowest Bayesian Information Criterion (BIC) score = 239,589.05 using jModelTest version 2 [ 61 ] (Supplementary Table 2). The BA phylogenetic analysis was conducted in MrBayes version 3.1.2 using a Metropolis-coupled Markov Chain Monte Carlo (MCMC) approach with the nst = 6 model and one cold chain plus three heated chains. The MCMC chains were run for 10 million generations with sampling every 100 generations, and the initial 25% of trees were discarded as burn-in [ 62 ]. The MCMC analysis was run until convergence was attained, as evidenced by a standard deviation of split frequencies of 0.01 and Potential Scale Reduction Factor (PSRF) values for all parameters approaching 1.0. In contrast, the ML phylogenetic analysis was carried out using PhyML version 3.0 under the same substitution model [ 63 ]. The NJ phylogenetic tree was constructed in MEGA version 12 using the Kimura 2-Parameter (K2P) model with default settings, and node support was evaluated with 1,000 bootstrap replicates. The phylogenetic trees generated from the BA, ML, and NJ analyses were further visualized using the Interactive Tree of Life (iTOL) web platform (version 7) to enhance interpretability and presentation [ 64 ]. Results Mitogenome organization and structure The complete mitochondrial genome of H. velox was successfully characterized as a circular DNA molecule comprising 16,512 bp, and has been deposited in GenBank under the accession number PP922174 . This mitogenome retains the typical gene arrangement observed in vertebrates, consisting of 13 PCGs, two rRNA genes, 22 tRNA genes, and a single non-coding CR (Fig. 2 ). The comparative synteny analysis demonstrated a conserved gene order and a high degree of sequence similarity across the mitogenomes of H. velox and 41 other Bagridae species, with no detectable gene rearrangements. These observations were corroborated by BLASTn results, which yielded e-values ranging from 18.10 to 181.00, indicative of significant sequence homology among the analyzed mitogenomes (Fig. 3 A). In the H. velox mitogenome, most genes were encoded on the heavy strand (H-strand), except for the ND6 gene and eight tRNA genes ( tRNA-Tyr , tRNA-Ser , tRNA-Glu , tRNA-Pro , tRNA-Gln , tRNA-Ala , tRNA-Asn , and tRNA-Cys ), which were located on the light strand (L-strand) (Table 1 ). The nucleotide composition analysis revealed that the H. velox mitogenome comprised 31.47% adenine (A), 26.62% thymine (T), 15.24% guanine (G), and 26.67% cytosine (C), resulting in an overall A + T bias of 58.09%, with AT-skew and GC-skew values of 0.084 and − 0.273, respectively. The comparative analysis among Hemibagrus species showed that H. velox possessed the shortest mitogenome (16,512 bp), whereas H. macropterus had the longest (16,530 bp). The lowest A + T bias was found in H. nemurus (58.08%), while the highest was observed in H. punctatus (60.07%). Among the analyzed species, H. guttatus exhibited the lowest AT-skew (0.063) and the least negative GC-skew (–0.265), whereas H. spilopterus showed the highest AT-skew (0.088) and H. pluriradiatus recorded the most negative GC-skew (–0.283). (Table 2 ). Fig. 2. Open in a new tab The circular representation of the complete mitochondrial genome of H. velox (GenBank accession no. PP922174 ; 16,512 bp) was annotated using the MitoAnnotator tool. Colored arcs denote the locations of PCGs, rRNAs, tRNAs, and CR. The species photograph was provided by the third author (Hamdani from the Jakarta Technical University of Fisheries, Ministry of Marine Affairs and Fisheries, Indonesia) Fig. 3. Open in a new tab A Comparative homology analysis using a synteny-based approach revealed a high degree of conserved nucleotides and gene orientation among the mitogenomes of Bagridae species. The number denoted the species as per Supplementary Table 1. B – C The frequency of start and stop codon usage in the 13 PCGs of H. velox and other seven Hemibagrus species Table 1. Annotated mitogenome of H. velox , including gene boundaries, sequence lengths (bp), and intergenic nucleotide regions Genes Start Stop Strand Size (bp) Intergenic nucleotide Anti-codon Start codon Stop codon tRNA-Phe (F) 1 70 H 70 0 GAA 12 S rRNA 71 1022 H 952 0 tRNA-Val (V) 1023 1094 H 72 0 TAC 16 S rRNA 1095 2766 H 1672 0 tRNA-Leu (L2) 2767 2841 H 75 0 TAA ND1 2842 3813 H 972 1 ATG TAA tRNA-Ile (I) 3815 3886 H 72 -1 GAT tRNA-Gln (Q) 3886 3956 L 71 -1 TTG tRNA-Met (M) 3956 4025 H 70 0 CAT ND2 4026 5071 H 1046 0 ATG TA- tRNA-Trp (W) 5072 5142 H 71 3 TCA tRNA-Ala (A) 5146 5214 L 69 1 TGC tRNA-Asn (N) 5216 5288 L 73 31 GTT tRNA-Cys (C) 5320 5385 L 66 2 GCA tRNA-Tyr (Y) 5388 5457 L 70 1 GTA COI 5459 7009 H 1551 0 GTG TAA tRNA-Ser (S2) 7010 7080 L 71 4 TGA tRNA-Asp (D) 7085 7156 H 72 14 GTC COII 7171 7861 H 691 0 ATG T-- tRNA-Lys (K) 7862 7935 H 74 1 TTT ATP8 7937 8104 H 168 -10 ATG TAA ATP6 8095 8777 H 683 0 ATG TA- COIII 8778 9561 H 784 0 ATG T-- tRNA-Gly (G) 9562 9634 H 73 0 TCC ND3 9635 9983 H 349 0 ATG T-- tRNA-Arg (R) 9984 10,052 H 69 0 TCG ND4L 10,053 10,349 H 297 -7 ATG TAA ND4 10,343 11,723 H 1381 0 ATG T-- tRNA-His (H) 11,724 11,793 H 70 0 GTG tRNA-Ser (S1) 11,794 11,861 H 68 5 GCT tRNA-Leu (L1) 11,867 11,939 H 73 0 TAG ND5 11,940 13,766 H 1824 -4 ATG TAA ND6 13,763 14,278 L 516 0 ATG TAA tRNA-Glu (E) 14,279 14,347 L 69 2 TTC Cytb 14,350 15,487 H 1138 0 ATG T-- tRNA-Thr (T) 15,488 15,559 H 72 -2 TGT tRNA-Pro (P) 15,558 15,627 L 70 0 TGG Control region 15,628 16,512 885 Open in a new tab Table 2. Genome size and nucleotide composition of the mitogenomes from various Hemibagrus species, presenting the total length (bp) and the relative proportions of each nucleotide base, including adenine (A), thymine (T), guanine (G), and cytosine (C), as well as the overall A + T and G + C content percentages Species name Size (bp) A% T% G% C% A + T% AT-Skew GC-Skew Complete mitogenome Hemibagrus velox ( PP922174 ) 16,512 31.47 26.62 15.24 26.67 58.09 0.084 -0.273 Hemibagrus nemurus ( KM454860 ) 16,526 31.49 26.59 15.18 26.75 58.08 0.084 -0.276 Hemibagrus guttatus ( KJ458934 ) 16,528 31.79 28.01 14.77 25.42 59.81 0.063 -0.265 Hemibagrus macropterus ( JF834542 ) 16,530 31.62 27.76 14.78 25.85 59.37 0.065 -0.272 Hemibagrus pluriradiatus ( PQ846023 ) 16,520 31.97 27.62 14.49 25.92 59.58 0.073 -0.283 Hemibagrus punctatus ( OR759762 ) 16,517 32.14 27.93 14.65 25.28 60.07 0.070 -0.266 Hemibagrus spilopterus ( JQ343983 ) 16,521 31.68 26.55 15.01 26.77 58.23 0.088 -0.282 Hemibagrus wyckioides ( KJ624624 ) 16,525 31.47 26.62 15.19 26.72 58.09 0.083 -0.275 PCGs Hemibagrus velox ( PP922174 ) 11,403 29.62 28.40 14.89 27.09 58.02 0.021 -0.291 Hemibagrus nemurus ( KM454860 ) 11,403 29.65 28.48 14.78 27.09 58.13 0.020 -0.294 Hemibagrus guttatus ( KJ458934 ) 11,229 29.87 30.22 14.63 25.28 60.09 -0.006 -0.267 Hemibagrus macropterus ( JF834542 ) 11,406 29.90 29.93 14.40 25.78 59.83 -0.001 -0.283 Hemibagrus pluriradiatus ( PQ846023 ) 11,402 30.08 29.67 14.02 26.23 59.75 0.007 -0.304 Hemibagrus punctatus ( OR759762 ) 11,317 30.77 30.15 14.17 24.91 60.92 0.010 -0.275 Hemibagrus spilopterus ( JQ343983 ) 11,403 29.76 28.50 14.61 27.12 58.27 0.022 -0.300 Hemibagrus wyckioides ( KJ624624 ) 11,403 29.63 28.48 14.80 27.08 58.12 0.020 -0.293 rRNAs Hemibagrus velox ( PP922174 ) 2624 34.53 23.21 19.59 22.68 57.74 0.196 -0.073 Hemibagrus nemurus ( KM454860 ) 2626 34.35 23.00 19.65 23.00 57.35 0.198 -0.079 Hemibagrus guttatus ( KJ458934 ) 2632 33.97 23.02 19.76 23.25 56.99 0.192 -0.081 Hemibagrus macropterus ( JF834542 ) 2630 33.92 22.85 19.81 23.42 56.77 0.195 -0.084 Hemibagrus pluriradiatus ( PQ846023 ) 2630 34.37 23.16 19.51 22.97 57.53 0.195 -0.081 Hemibagrus punctatus ( OR759762 ) 2626 34.54 23.65 19.54 22.28 58.19 0.187 -0.066 Hemibagrus spilopterus ( JQ343983 ) 2631 34.55 22.92 19.46 23.07 57.47 0.202 -0.085 Hemibagrus wyckioides ( KJ624624 ) 2627 34.34 22.99 19.64 23.03 57.33 0.198 -0.079 tRNAs Hemibagrus velox ( PP922174 ) 1560 31.79 26.22 18.59 23.40 58.01 0.096 -0.115 Hemibagrus nemurus ( KM454860 ) 1562 29.45 28.10 22.28 20.17 57.55 0.023 0.050 Hemibagrus guttatus ( KJ458934 ) 1560 29.74 28.85 21.99 19.42 58.59 0.015 0.062 Hemibagrus macropterus ( JF834542 ) 1566 29.37 28.80 22.22 19.60 58.17 0.010 0.063 Hemibagrus pluriradiatus ( PQ846023 ) 1565 29.52 28.75 21.60 20.13 58.27 0.013 0.035 Hemibagrus punctatus ( OR759762 ) 1562 29.13 28.30 22.47 20.10 57.43 0.014 0.056 Hemibagrus spilopterus ( JQ343983 ) 1555 29.52 28.30 22.44 19.74 57.81 0.021 0.064 Hemibagrus wyckioides ( KJ624624 ) 1558 29.72 28.05 22.21 20.03 57.77 0.029 0.052 CRs Hemibagrus velox ( PP922174 ) 885 31.79 29.07 15.27 23.87 60.86 0.045 -0.220 Hemibagrus nemurus ( KM454860 ) 896 32.92 28.35 15.29 23.44 61.27 0.075 -0.210 Hemibagrus guttatus ( KJ458934 ) 891 34.34 30.98 12.35 22.33 65.32 0.052 -0.288 Hemibagrus macropterus ( JF834542 ) 892 33.30 30.83 13.00 22.87 64.13 0.038 -0.275 Hemibagrus pluriradiatus ( PQ846023 ) 886 34.76 29.80 13.77 21.67 64.56 0.077 -0.223 Hemibagrus punctatus ( OR759762 ) 887 32.81 29.99 14.66 22.55 62.80 0.045 -0.212 Hemibagrus spilopterus ( JQ343983 ) 892 33.18 28.48 15.02 23.32 61.66 0.076 -0.216 Hemibagrus wyckioides ( KJ624624 ) 897 32.78 28.65 15.38 23.19 61.43 0.067 -0.202 Open in a new tab Intergenic spacer and overlapping regions In the current study, the H. velox mitogenome was found to contain 11 intergenic spacers with a cumulative length of 65 bp and six overlapping regions totaling 25 bp between adjacent genes (Table 1 ; Supplementary Table 3). The longest intergenic spacer, measuring 31 bp, was located between the tRNA-Asn and tRNA-Cys genes. An additional intergenic spacer region included a 14 bp segment between tRNA-Asp and COII , a 5 bp spacer between tRNA-Ser (S1) and tRNA-Leu (L1), and a 4 bp spacer between tRNA-Ser (S2) and tRNA-Asp . Several shorter intergenic regions were also identified, including 3 bp between tRNA-Trp and tRNA-Ala , 2 bp spacers between tRNA-Cys and tRNA-Tyr as well as between tRNA-Glu and Cytb , and four 1 bp spacers at distinct loci. Conversely, the greatest gene overlap occurred between ATP8 and ATP6 , covering a length of 10 bp. Additional overlaps included 7 bp between ND4L and ND4 , as well as 4 bp between ND5 and ND6 . A minor overlap of 1–2 bp were also detected between tRNA-Ile and tRNA-Gln , tRNA-Gln and tRNA-Met , and tRNA-Thr and tRNA-Pro . The comparative analyses with the mitogenomes of other Hemibagrus species exhibited a conserved 30–32 bp intergenic region between tRNA-Asn and tRNA-Cys , a consistent 14 bp spacer between tRNA-Asp and COII , and a uniform 10 bp overlap between ATP8 and ATP6 across all sequences examined (Supplementary Table 3). Features of protein-coding genes The mitogenome of H. velox comprised 13 PCGs with a combined length of 11,403 bp, accounting for approximately 69.06% of the entire sequence. Among them, ATP8 was the shortest gene at 168 bp, while ND5 was the longest, spanning 1,824 bp (Table 1 ). The nucleotide composition of this PCGs displayed a notable A + T bias of 58.02%, with an AT-skew of 0.021 and a GC-skew of − 0.291. The total PCG length in H. velox was consistent with that of several congeners, including H. nemurus , H. spilopterus , and H. wyckioides . Among the Hemibagrus species examined, PCG lengths ranged from 11,229 bp in H. guttatus to 11,406 bp in H. macropterus . The lowest A + T bias was observed in H. velox (58.02%), while the highest was recorded in H. punctatus (60.92%). The AT-skew values ranged from − 0.006 in H. guttatus to 0.022 in H. spilopterus , whereas all sequences exhibited negative GC-skew values, ranging from − 0.304 in H. pluriradiatus to − 0.267 in H. guttatus (Table 2 ). Furthermore, the analysis of the 13 PCGs across Hemibagrus species revealed also a high degree of conserved start codon usage. Most genes were initiated by the canonical start codon ATG; however, the COI gene uniformly employed GTG across all species. Additionally, the alternative start codon ATA was uniquely observed in the ATP6 gene of H. guttatus (Fig. 3 B). Conversely, stop codons exhibited greater variability compared to start codons (Fig. 3 C). In H. velox , six genes ( ND1 , COI , ATP8 , ND4L , ND5 , and ND6 ) terminated with the complete stop codon TAA, while ND2 and ATP6 ended with the incomplete stop codon TA-. The remaining five genes ( COII , COIII , ND3 , ND4 , and Cytb ) possessed incomplete termination codons represented as T–. The comparative analysis displayed that the TAA stop codon was commonly found in ND1 , COI , ATP8 , ATP6 , ND4L , and ND5 in H. nemurus , H. guttatus , H. spilopterus , and H. wyckioides . The TAG stop codon was consistently identified in the ND6 gene across all species, with the exception of H. velox , which employed TAA. The incomplete stop codon TA- in ND1 was exclusive to H. pluriradiatus and H. punctatus , whereas the TAG termination in ND5 was unique to H. macropterus . Notably, the incomplete TA- stop codon in ATP6 was observed only in H. pluriradiatus and H. velox (Supplementary Table 4). Substitution’s pattern and relative synonymous codon usage The sliding window approach revealed an average nucleotide diversity (π) of 0.13641 across the PCGs, with 3,538 polymorphic sites detected in all investigated Hemibagrus species (Fig. 4 A). Substitution saturation analysis showed no evidence of saturation for either transition or transversion substitutions, as indicated by the increasing pattern of genetic divergence values based on the TN84 model across the entire mitochondrial PCGs of Hemibagrus (Fig. 4 B). The evolutionary rates of homologous gene pairs in H. velox were evaluated by calculating the Ka/Ks ratios and comparing them with other Hemibagrus species. The current analysis revealed that all PCGs experienced varying degrees of selective pressure, with values ranging from 0.00509 ± 0.00221 for COI to 0.26747 ± 0.03566 for Cytb , following the order COI < ATP6 < COII < ND4L < COIII < ND5 < ND4 < ND6 < ND1 < ND3 < ND2 < ATP8 < Cytb (Fig. 4 C; Supplementary Table 5). All examined Hemibagrus species exhibited an abundance of amino acids, with leucine, serine, and arginine being the most frequent, while methionine and tryptophan were the least frequent (Fig. 4 D; Supplementary Table 6). Conversely, the CDsPT indicated that leucine, serine, proline, and isoleucine consistently had the highest proportions in the PCGs across all analyzed Hemibagrus species. In particular, H. velox displayed CDsPT values ranging from 11.9 for methionine to 113.9 for leucine (Supplementary Fig. 1; Supplementary Table 6). Notably, the mitochondrial codon usage analysis of H. velox revealed a dominant bias toward codons ending with adenine (A) or uracil (U), particularly the codons CUU (leucine), CUA (leucine), and AUU (isoleucine), which showed high RSCU values (> 1.5) and were the most frequently used codons. Conversely, the codons GCG (alanine), ACG (threonine), and AAG (lysine) demonstrated low frequencies with RSCU values below 0.4. The significant differences were also observed in the stop codon UAA, where H. velox had an RSCU value of 1.39, comparable to H. punctatus , while other Hemibagrus species showed lower values ranging from 1.22 to 1.35 (Fig. 5 ; Supplementary Table 7). Fig. 4. Open in a new tab A Nucleotide diversity (π) across mitochondrial PCGs among Hemibagrus species. B Scatter plot depicting the relationship between transitions (s) and transversions (v) with genetic divergence among PCGs, based on TN84 substitution distances. C Boxplot illustrating pairwise Ka/Ks ratio for each mitochondrial PCG among Hemibagrus species. D Codon usage abundance across the PCGs of eight Hemibagrus species Fig. 5. Open in a new tab Relative synonymous codon usage (RSCU) patterns among the PCGs of eight Hemibagrus species. The y-axis represents RSCU values, while the x-axis represents codons grouped by their corresponding amino acids Components of ribosomal and transfer RNA genes The rRNA genes of H. velox measured a total of 2,624 bp, comprising the 12 S rRNA (952 bp) and the 16 S rRNA (1,672 bp), and accounted for approximately 15.89% of the mitogenome (Tabel 1). The nucleotide composition exhibited an A + T bias of 57.74%, with an AT-skew of 0.196 and a GC-skew of − 0.073. The comparative analysis among congeneric species revealed that rRNA lengths were relatively conserved, ranging from 2,624 bp in H. velox to 2,632 bp in H. guttatus . The lowest A + T content was recorded in H. macropterus (56.77%), while the highest was observed in H. punctatus (58.19%). The AT-skew values ranged from 0.187 in H. punctatus to 0.202 in H. spilopterus , whereas the GC-skew was most negative in H. spilopterus (–0.085) and least negative in H. punctatus (–0.066). For tRNA genes, H. velox possessed a total length of 1,560 bp, accounting for 9.45% of the mitogenome. The A + T bias of the tRNAs was slightly higher than that of the rRNAs, reaching 58.01%, with an AT-skew of 0.096 and a GC-skew of − 0.115. The length of tRNA genes exhibited limited variation among species, ranging from 1,555 bp in H. spilopterus to 1,566 bp in H. macropterus . The lowest A + T bias was found in H. punctatus (57.43%), while the highest was detected in H. guttatus (58.59%). The AT-skew values varied from 0.010 in H. macropterus to 0.096 in H. velox , whereas the GC-skew ranged from − 0.115 in H. velox to a slightly positive value of 0.064 in H. spilopterus (Table 2 ). Furthermore, all 22 typical tRNAs were successfully identified in H. velox . The secondary structure predictions revealed that the majority of tRNA molecules adopted the conventional cloverleaf structure. Each tRNA displayed canonical structural features, including the acceptor stem, dihydrouridine (DHU) arm, anticodon loop, and TΨC arm. Notably, tRNA-Ser (S1) exhibited a simplified secondary structure due to the absence of base pairing in the DHU arm. Conversely, tRNA-Leu (L2), tRNA-Lys , and tRNA-Gly possessed elongated DHU arms with expanded loop regions. The presence of canonical Watson–Crick base pairs (A–T, G–C), along with non-canonical wobble base pairs (G–U), contributed to a structurally flexible yet functionally stable tRNA architecture. Specifically, G–U wobble pairings were detected in 16 tRNAs of H. velox , including tRNA-Tyr , tRNA-Ser (S2), tRNA-Asp , tRNA-Lys , tRNA-Gly , tRNA-His , tRNA-Glu , tRNA-Pro , tRNA-Val , tRNA-Leu (L2), tRNA-Gln , tRNA-Met , tRNA-Trp , tRNA-Ala , tRNA-Asn , and tRNA-Cys . These G–U pairings were distributed across various structural regions, such as the acceptor stem, DHU arm, anticodon arm, and TΨC arm (Fig. 6 ). Further comparative analysis of the anticodon revealed a high level of conservation among H. velox and seven other congeneric species within the Hemibagrus genus, with 21 of the 22 tRNAs exhibiting identical sequences. The only exception was a substitution to TGC in the anticodon of tRNA-Ser (S2) observed in H. wyckioides (Supplementary Table 8). Fig. 6. Open in a new tab The secondary structures of the 22 transfer RNAs (tRNAs) in the H. velox mitogenome exhibit variability in nucleotide composition and structural pattern. Each tRNA is annotated with its full name and corresponding single-letter amino acid code, following the IUPAC-IUB terminology Characteristics of control region The CR of H. velox measured 885 bp in length, corresponding for around 5.36% of the total mitogenome (Table 1 ). The A + T bias in this area displayed a bias of 60.86%, with AT-skew and GC-skew values of 0.045 and − 0.220, respectively. The comparative analysis of the CR among the examined Hemibagrus species revealed that H. velox possessed a relatively shorter CR compared to H. wyckioides , which exhibited the longest CR at 897 bp. In terms of A + T bias, H. velox showed the lowest proportion (60.86%), while the highest was recorded in H. guttatus (65.32%). The AT-skew values were consistently positive across all species, ranging from 0.038 in H. macropterus to 0.077 in H. pluriradiatus . Conversely, GC-skew values were uniformly negative, ranging from − 0.288 in H. guttatus to − 0.202 in H. wyckioides (Table 2 ). A comprehensive CRs investigation of H. velox , alongside seven other species within the genus Hemibagrus , identified four conserved sequence blocks (CSBs), specifically designated as CSB-D, CSB-1, CSB-2, and CSB-3. Although these CSBs are typically considered highly conserved elements, comparative analysis in this study showed notable nucleotide length variations among them. The CSB-2 was the longest, consisting of 51 bp, followed by CSB-1 with 37 bp, CSB-3 with 31 bp, and CSB-D as the shortest, comprising 27 bp. Significantly, tandem repeats were exclusively detected in H. guttatus within the extended termination-associated sequences (ETAS) region, comprising 1.9 copies of the 21 bp consensus sequence ‘TAGTCCATATAATGCATGTAT’ (Fig. 7 ). Fig. 7. Open in a new tab Schematic representation of conserved sequence blocks within the CR of H. velox and other seven congeners. A conceptual linear overview of the CR is shown vertically on the top right side. Conserved nucleotide positions across Hemibagrus species are indicated by black stars, while a detailed depiction of the tandem repeats unique to H. guttatus is presented on the lower right Major phylogenetic relationships of Bagridae The phylogenetic analyses conducted using the BA, ML, and NJ approaches provided parallel and comprehensive insights into the evolutionary relationships within the family Bagridae. The present mitogenomic dataset further indicates that the eight Hemibagrus species do not form a monophyletic group under any of the three cladistic methods, despite high posterior probability and bootstrap support values (Fig. 8 ; Supplementary Figs. 2 and 3). Notably, the mitogenomic phylogenies revealed a close evolutionary affinity between the focal species H. velox ( H. planiceps species group) and a clade comprising three congeners, viz., H. spilopterus and H. nemurus ( H. nemurus species group), as well as H. wyckioides ( H. wyckii species group). In contrast, the two remaining Hemibagrus species belonging to the H. guttatus species group ( H. guttatus and H. macropterus ) formed a distinct clade, suggesting independent evolutionary trajectories within the genus. A well-supported monophyletic clade comprising 24 Tachysurus species and five Mystus species was also recovered, with high posterior probability and bootstrap values further reinforcing the robustness and stability of the inferred phylogenetic topologies. The current investigation also highlights a potential basal placement of Horabagrus nigricollaris , an endemic species from the middle Chalakudy River basin in central Kerala, India, indicating its possible role as an ancestral lineage within Bagridae (Fig. 8 ; Supplementary Figs. 2 and 3). Fig. 8. Open in a new tab The Bayesian phylogenetic tree constructed using concatenated sequences of 13 PCGs, clearly distinguishing H. velox (black star) from other species within the family Bagridae. The non-monophyletic clustering of Hemibagrus species is highlighted with blue boxes. The posterior probability support values are shown in blue at each corresponding node. The small boxes of different colors next to each Hemibagrus species name indicate their respective species-group assignments Discussion Mitogenomic insights of Hemibagrus Over the past two to three decades, ichthyological research, particularly studies concerning the Bagridae family has made extensive use of complete mitochondrial genome information, mainly for species-level identification and genetic content characterization [ 12 ]. Nevertheless, most mitogenomic investigations within this family have been predominantly descriptive, with limited emphasis on comparative analyses of gene structure and variation, as well as on elucidating their matrilineal evolutionary relationships. Hence, the present study contributes to a broader understanding of the structural characteristics of H. velox , providing a foundation for illuminating the biological functions regulated by the mitogenome and its associated genes, consistent with findings from previous researchs [ 65 – 67 ]. The intergenic spacers and overlapping gene regions, including those in Hemibagrus species, play crucial roles in regulating mitochondrial transcription and replication, while also reflecting evolutionary optimization in the organization of genetic information [ 57 , 68 ]. The consistently observed longest intergenic spacer between the tRNA-Asn and tRNA-Cys genes across all Hemibagrus species examined in this study serves as the origin of replication for the light strand, a fundamental element essential for mitochondrial DNA duplication [ 69 ]. Conversely, the conserved 10 bp overlap between the ATP8 and ATP6 genes observed across all Hemibagrus species represents a common characteristic of fish mitogenomes, reflecting evolutionary selective pressure to preserve efficient and stable gene architecture, as documented in previous studies on various teleosts [ 70 , 71 ]. Further, the investigation of initiation and termination codons in the PCGs of Hemibagrus mitogenomes offers important insights into translational regulation and evolutionary adaptations within this genus. Thus, this study demonstrates a high level of conservation in initiation codons across Hemibagrus mitogenomes, reflecting the conserved and efficient nature of early translational processes and consistent with observations reported in previous fish mitogenome study [ 72 ]. The occurrence of the alternative start codon GTG in the COI gene is hypothesized to correspond to lineage-specific functional adaptations unique to Hemibagrus species [ 73 ]. Notably, the presence of the ATA initiation codon in the ATP6 gene of H. guttatus , an infrequent alternative start codon, indicates a subtle variation in translation initiation signal recognition within this species, in line with prior reports of the ATA start codon in the NAD3 gene of other fishes [ 74 ]. Additionally, the presence of incomplete termination codons in several Hemibagrus mitochondrial genes corroborates a post-transcriptional polyadenylation mechanism at the 3’ end of mRNA, which completes these codons into functional stop codons (TAA) during mitogenomic translation [ 66 , 67 ]. The variation in termination codon usage among closely related Hemibagrus species underscores the dynamic evolution of mitogenomes and reflects potential ecological and physiological adaptations [ 1 , 75 ]. The sliding window-based nucleotide diversity conducted in this observation identified highly variable regions within the Hemibagrus mitogenomes, designating them as mutation hotspots. These findings provide important insights into the mechanisms of evolutionary adaptation and genetic differentiation within the genus, consistent with previous studies [ 76 , 77 ]. Moreover, substitution saturation analysis in Hemibagrus species showed no evidence of mutational saturation, confirming that the mitochondrial markers used remain valid and effective for phylogenetic inference [ 78 ]. The RSCU profile in the Hemibagrus mitogenomes indicated leucine as the most frequently used amino acid. This distribution pattern reflects a preference for leucine, a branched-chain amino acid essential for mitochondrial function via various signaling pathways [ 79 ]. The codon usage bias in H. velox displayed an affinity for codons ending in adenine (A) or uracil (U), likely associated with translation efficiency [ 80 ]. The observed variation in RSCU values among Hemibagrus species reflects the interplay between molecular factors and evolutionary processes shaping codon usage patterns across populations [ 81 ]. The use of CDsPT in fish mitogenomes serves as an important tool for assessing codon usage efficiency and preference in PCGs, potentially reflecting selective pressures and adaptation at the translational level [ 82 ]. The present study also highlights that H. velox exhibits the highest CDsPT value for leucine, underscoring its crucial role in maintaining the stability and efficiency of mitochondrial protein translation, consistent with other teleost species [ 70 ]. Moreover, the Ka/Ks ratio of PCGs is widely used to infer selective pressures and patterns of adaptive molecular evolution across both genetically homogeneous and diverse taxa, including fishes [ 83 , 84 ]. The consistently low mean Ka/Ks ratios (< 1) observed in Hemibagrus species indicate that most PCGs are subject to strong purifying selection, highlighting a predominance of synonymous substitutions and stringent functional constraints on mitochondrial genes [ 65 , 85 ]. The purifying selection identified in this study is also pivotal for preserving mitochondrial integrity and ensuring the proper functioning of oxidative phosphorylation and cellular energy metabolism [ 86 ]. Despite this overall configuration, ATP8 and Cytb exhibit relatively elevated Ka/Ks ratios compared with other PCGs in Hemibagrus , suggesting relaxed selective constraints or localized adaptive evolution [ 87 ]. Specifically, ATP8 , a key subunit of Complex V, plays a central role in ATP synthesis and is among the fastest-evolving mitochondrial genes in fishes, likely reflecting its functional flexibility and exposure to lineage-specific selective pressures [ 88 , 89 ]. In contrast, Cytb remains highly conserved due to its essential function in electron transport, permitting only limited adaptive variation [ 87 ]. Together, these observations further suggest that while PCGs in Hemibagrus species are predominantly constrained by purifying selection, certain genes may undergo localized adaptive changes in response to ecological or physiological demands [ 84 ].The rRNA in fish mitogenomes plays a substantial contribution in regulating the synthesis of proteins required for cellular respiration, whereas tRNA functions as a molecular adaptor that delivers specific amino acids to the ribosome during the protein translation [ 90 , 91 ]. Both mitochondrial RNA genes are vital for maintaining the efficiency and accuracy of gene expression, supporting metabolic functions in fish cells, including species within the genus Hemibagrus [ 1 ]. Furthermore, the absence of the DHU arm in one of the tRNA genes represents a characteristic feature of vertebrate mitogenomes, including that of H. velox analyzed in this study. Although exhibiting an imperfect secondary structure, this tRNA retains its functionality in protein translation, indicating an evolutionary adaptation toward a streamlined and efficient mitogenome system [ 92 ]. As observed in many other fishes, the mitogenome of H. velox exhibits canonical Watson–Crick base pairings, which contribute to molecular stability, alongside non-canonical G–U wobble pairings that confer structural flexibility and accommodate sequence variation. This balance enables mitochondrial tRNAs to function optimally under selective pressures and the dynamic conditions of freshwater environments [ 93 ]. In addition, the CR in the mitogenomes of H. velox and its congeners plays a pivotal role in regulating the transcription and initiation of DNA synthesis, containing essential elements such as the replication origin and promoters [ 94 ]. The CR of Hemibagrus species contains four sequence blocks consistent with the conserved domain architecture observed in the mitogenomes of other teleosts, including members of the Bagridae family [ 57 ]. Among these, CSB-1, CSB-2, and CSB-3 are recognized as core elements associated with replication initiation and transcriptional regulation, whereas CSB-D is typically linked to the ETAS region and may also contribute to replication termination or regulatory stability in Hemibagrus species [ 57 , 95 ]. The length variation detected across all four CSBs among Hemibagrus species suggests their potential utility as informative markers for population-level investigations [ 66 ]. Moreover, tandem repeats are a commonly described feature of the CR; however, their absence is also frequently observed and is considered biologically plausible. This pattern reflects the relatively rapid and lineage-specific evolutionary rate of the CR, in which tandem repeats can be readily gained or lost through slipped-strand mispairing mechanisms, resulting in substantial inter- and intraspecific variation [ 96 ]. In several freshwater fishes, variation in the presence or absence of tandem repeats within the CR has been tentatively linked to historical evolutionary processes and population structure, suggesting that lineage divergence and geographic differentiation may shape mitogenome organization [ 97 ]. In the present study, tandem repeats detected exclusively in the CR of H. guttatus , particularly within the hypervariable region, indicate their potential utility as molecular diagnostic characters for distinguishing this species from other Hemibagrus taxa. Nevertheless, functional and evolutionary interpretations of these species-specific repeats require validation through broader sampling and population-level analyses, although they may also serve as informative molecular markers for future phylogeographic and population studies of different Hemibagrus species [ 98 ]. Matrilineal evolutionary relationships within the Bagridae lineage The classical taxonomy continued to be applied in the revision of Hemibagrus species in Southeast Asia based on diagnostic characters [ 18 ]; however, it was criticized for potentially failing to accurately represent true monophyletic lineages [ 19 ]. The shared morphological traits frequently pose challenges in species identification, as their widespread occurrence may result from environmental influences or convergent evolution rather than common ancestry [ 99 ]. Accordingly, the molecular analyses have provided more accurate insights into evolutionary relationships, including among bagrid catfish, by revealing cryptic genetic divergence [ 100 ]. Prior to this study, mitogenome data were available for seven species of the genus Hemibagrus , including five species widely distributed across Southeast and East Asia, and two endemic species, H. punctatus and H. macropterus restricted to the Cauvery River and its tributaries in India, and to the Yangtze and Pearl River basins in China, respectively. Hence, the present phylogenetic analyses based on the newly generated mitogenomic data together with publicly available mitogenomes of congeners strongly support the non-monophyly of the genus Hemibagrus , thereby reinforcing findings from previous molecular investigation [ 48 ]. This observation also serves as an initial mitogenome-based assessment of six out of eight valid species groups within the Hemibagrus lineage in Southeast Asia, confirming the validity of the H. guttatus species group, which includes H. guttatus and H. macropterus [ 18 , 19 ]. Nevertheless, the current study indicates that the focal species, H. velox (belonging to the H. planiceps species group), is more closely related to the H. nemurus and H. wyckii species groups, in contrast to previous research that placed it near the Hemibagrus baramensis species group [ 19 ]. This discrepancy may reflect a different cladistic pattern due to the lack of mitogenomic data for H. baramensis species group ( H. baramensis , H. sabanus , and H. semotus ) [ 18 , 19 ]. Conversely, the H. nemurus species group exhibits a non-monophyletic topology, encompassing both H. nemurus and H. spilopterus , underscoring the need for further in-depth investigation to validate this issue. From a biogeographic perspective based on the current dataset, the target species H. velox shows close phylogenetic affinities with species from mainland Southeast Asia ( H. spilopterus ), H. nemurus (from both mainland and islands of Southeast Asia), and H. wyckioides (from both mainland and southern China). This configuration contrasts with an earlier partial mitochondrial Cytb study, which suggested a close relationship between the Sumatran endemic species ( H. velox ) and the Peninsular Malaysian species ( Hemibagrus gracilis ) [ 19 ]. Moreover, the phylogenetic topologies obtained in this study further validate the earlier report, which indicated that species previously classified under the genera Leiocassis , Pelteobagrus , and Pseudobagrus belong to a single genus, Tachysurus , as supported by their placement within a well-supported monophyletic clade [ 12 , 100 ]. Collectively, the matrilineal phylogenetic analyses in this investigation confirm that H. velox is genetically distinct from its congeners. Limitations and recommendations Although this study provides an important contribution to the genomic understanding of H. velox , several significant limitations must be acknowledged. The mitogenome analyzed was derived from a single specimen, preventing a robust assessment of intraspecific genetic variation and subsequent interpretation. Furthermore, the lack of partial mitochondrial or nuclear marker sequences in global databases constrains meaningful population genetic structure analyses and limits the ability to assess phylogeographic patterns or demographic history. Thus, priority should be given to the collection of additional specimens across the species’ geographic range in Sumatra, Indonesia, and to the development of multi-locus genetic markers, particularly nuclear genes. This proposed framework can be combined with our current mitogenomic data to perform integrated phylogenomic analyses and to verify matrilineal phylogenetic relationships. Moreover, the mitogenome-based phylogeny presented in this study encompasses only 17.95% of species within the family Bagridae and should be regarded as an initial step toward resolving maternal evolutionary relationships within this lineage. From the perspective of the genus Hemibagrus , only eight of 33 valid species were included in these analyses, highlighting the need for additional genomic data from both mainland and island ecosystems. Notably, the present study lacks representation from two additional recognized Hemibagrus species groups in Southeast Asia, namely the H. baramensis species group and the H. olyroides species group. Moreover, within the H. planiceps species group, only H. velox was included, leaving H. bongan , H. divaricatus , H. gracilis , and H. planiceps unrepresented. Consequently, targeted sampling and comprehensive sequencing of representative taxa from these species groups are strongly recommended, particularly from their native Sundaic region, encompassing both Peninsular Malaysia and the Indonesian islands. Hence, future studies should further investigate whether dispersal patterns within the H. planiceps species group were influenced by Pleistocene palaeodrainage connectivity by integrating divergence time estimates derived from both mitogenomic and phylogenomic datasets. Such efforts will enhance classification accuracy, clarify evolutionary relationships, and improve biogeographic interpretations. Furthermore, considering the unique tandem repeats identified in the CR of H. guttatus , which are absent in other examined Hemibagrus species, a more comprehensive assessment of complete mitogenomic structure and variation across all extant species is warranted. Given the critical role of the CR in mitochondrial genome regulation and its potential utility as a genetic marker for phylogeographic studies, expanded comparative analyses may provide deeper insights into evolutionary dynamics at both the genomic and species levels within the genus. Conclusions This study presents the first complete mitochondrial genome of H. velox , offering novel insights into its genomic architecture, gene structure variation, and phylogenetic placement. The mitogenomic characteristics, such as genome size, nucleotide composition, codon usage, and gene arrangement were found to be highly conserved and largely congruent with those of other Hemibagrus species. The comparative analysis of conserved sequence blocks within the CR of Hemibagrus species revealed variation in both length and nucleotide composition, highlighting their potential utility as informative markers for population genetic studies. Based on mitogenomic data, phylogenetic analyses clearly placed H. velox within the family Bagridae and further strengthened earlier findings indicating that the genus Hemibagrus is not monophyletic. Nevertheless, to advance these findings, broader and more representative sampling of this bagrid catfish and its congeners from diverse freshwater systems across Southeast Asia is imperative. Such efforts will enable a more robust assessment of fine-scale genetic diversity, evolutionary relationship, population structure, and phylogeographic patterns of Hemibagrus species within the Sundaic region. This knowledge is crucial for informing effective conservation strategies and for advancing our understanding of evolutionary processes and freshwater ichthyological diversity in this tropical biodiversity hotspot. Supplementary Information Supplementary Material 1. (1.3MB, docx) Acknowledgements The authors express their sincere gratitude to the Government of Solok Regency, West Sumatra Province, Republic of Indonesia, for their invaluable support and facilitation during field sampling and the implementation of this research. Special appreciation is extended to Zaitul Ikhlas and Yossi Agusta for their generous assistance and collaboration during fieldwork. The authors also thank Imon Abedin for his contribution to the preparation of the research map presented in this article. In addition, the authors (A.P. and S.A.) gratefully acknowledge the Interdisciplinary Program of Marine and Fisheries Sciences and Convergent Technology at Pukyong National University, Busan, Republic of Korea, for providing academic support throughout their Ph.D. programs. Authors’ contributions H-WK, H-EK, and SK conceived and designed the study. AP, SA, Hamdani, conducted the molecular work, data analysis, and drafted the manuscript. SRL, ARK, TY coordinated the study and helped to draft the manuscript. SVV, JHC, and W-KJ contributed to the development of the project and edited the manuscript. All authors have read and approved the final manuscript. Funding This research was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (RS-2021-NR060118). Data availability The partial COI sequences (accession number PX974664 ) and the complete mitogenome (accession number PP922174 ) of H. velox generated in this study have been deposited in the GenBank database ( https://www.ncbi.nlm.nih.gov ) and are publicly available. Declarations Ethics approval and consent to participate All experimental procedures were conducted in accordance with the ethical standards approved by the Institutional Animal Care and Use Committee (IACUC) of Pukyong National University, Busan, Republic of Korea (Approval No. PKNUIACUC-2025-16, dated 18 February 2025). The study was performed in compliance with the ARRIVE 2.0 guidelines ( https://arriveguidelines.org/ ). All authors provided their consent to participate in this manuscript. Consent for publication Not applicable. Competing interests The authors declare no competing interests. Footnotes Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Angkasa Putra and Sarifah Aini contributed equally to this work. Contributor Information Hye-Eun Kang, Email: [email protected]. Shantanu Kundu, Email: [email protected], Email: [email protected]. References 1. Brown KH. Fish mitochondrial genomics: Sequence, inheritance, and functional variation. J Fish Biol. 2008;72:355–74. 10.1111/j.1095-8649.2007.01690.x. [ Google Scholar ] 2. Tan S, Wang W, Li J, Sha Z. Comprehensive analysis of 111 Pleuronectiformes mitochondrial genomes: Insights into structure, conservation, variation, and evolution. BMC Genomics. 2025;26:50. 10.1186/s12864-025-11204-w. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 3. Alvarenga M, D’Elia AKP, Rocha G, Arantes CA, Henning F, de Vasconcelos ATR, Solé-Cava AM. Mitochondrial genome structure and composition in 70 fishes: A key resource for fisheries management in the South Atlantic. BMC Genomics. 2024;25:215. 10.1186/s12864-024-10035-5. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 4. Xing B, Lin L, Wu Q. Application of mitochondrial genomes to species identification and evolution. Electron J Biotechnol. 2025;76:39–48. 10.1016/j.ejbt.2025.04.001. [ Google Scholar ] 5. Jiménez-Segura LF, Restrepo-Santamaria D, Ospina-Pabón JG, Castellanos-Mejía MC, Valencia-Rodríguez D, Galeano-Moreno AF, Londoño-López JL, Herrera-Pérez J, Medina-Ríos VM, Álvarez-Bustamante J, Mejía-Estrada M, Hernández-Zapata M, García-Melo LJ, Campo-Nieto O, Soto-Calderón ID, DoNascimiento C. Fish databases for improving their conservation in Colombia. Sci Data. 2025;12:262. 10.1038/s41597-024-04352-3. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 6. Miya M, Kawaguchi A, Nishida M. Mitogenomic exploration of higher teleostean phylogenies: A case study for moderate-scale evolutionary genomics with 38 newly determined complete mitochondrial DNA sequences. Mol Biol Evol. 2001;18:1993–2009. 10.1093/oxfordjournals.molbev.a003741. [ DOI ] [ PubMed ] [ Google Scholar ] 7. Iwasaki W, Fukunaga T, Isagozawa R, Yamada K, Maeda Y, Satoh TP, Sado T, Mabuchi K, Takeshima H, Miya M, Nishida M. MitoFish and MitoAnnotator: A mitochondrial genome database of fish with an accurate and automatic annotation pipeline. Mol Biol Evol. 2013;30:2531–40. 10.1093/molbev/mst141. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 8. Sayers EW, Bolton EE, Brister JR, Canese K, Chan J, Comeau DC, Farrell CM, Feldgarden M, Fine AM, Funk K, Hatcher E, Kannan S, Kelly C, Kim S, Klimke W, Landrum MJ, Lathrop S, Lu Z, Madden TL, Malheiro A, Marchler-Bauer A, Murphy TD, Phan L, Pujar S, Rangwala SH, Schneider VA, Tse T, Wang J, Ye J, Trawick BW, Pruitt KD, Sherry ST. Database resources of the National Center for Biotechnology Information in 2023. Nucleic Acids Res. 2023;51:D29–38. 10.1093/nar/gkac1032. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 9. Fricke R, Eschmeyer WN, Van der Laan R, editors. Eschmeyer’s Catalog of Fishes: Genera, Species, References. 2026. Available at: https://researcharchive.calacademy.org/research/ichthyology/catalog/fishcatmain.asp . Accessed on 10 February 2026. 10. Nelson JS, Grande TC, Wilson MVH. Fishes of the World. 5th ed. Hoboken, NJ: Wiley; 2016. 10.1002/9781119174844. [ Google Scholar ] 11. Mayer I, Pšenička M. Conservation of teleost fishes: Application of reproductive technologies. Theriogenology Wild. 2024;4:100078. 10.1016/j.therwi.2024.100078. [ Google Scholar ] 12. Zhang R, Deng L, Lv X, Tang Q. Complete mitochondrial genomes of two catfishes (Siluriformes, Bagridae) and their phylogenetic implications. ZooKeys. 2022;1115:103–16. 10.3897/zookeys.1115.85249. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 13. Regan CT. LXV.—The classification of the teleostean fishes of the order Ostariophysi.—2. Siluroidea. Ann Mag Nat Hist. 1911;8:553–77. 10.1080/00222931108693067. [ Google Scholar ] 14. Jayaram KC. Contributions to the study of bagrid fishes (Siluroidea: Bagridae). 3. A systematic account of the Japanese, Chinese, Malayan, and Indonesian genera. Treubia. 1968;27:287–386. 10.14203/treubia.v27i2-3.1560. [ Google Scholar ] 15. Mo T. Anatomy, relationships, and systematics of the Bagridae (Teleostei: Siluroidei) with a hypothesis of siluroid phylogeny. Koenigstein: Koeltz Scientific Books; 1991. pp. 1–216. [ Google Scholar ] 16. Ng HH, Ferraris CJ Jr. A review of the genus Hemibagrus in southern Asia, with descriptions of two new species. Proc Calif Acad Sci. 2000;52:125–42. https://biostor.org/reference/3241 . [ Google Scholar ] 17. Ng HH, Wirjoatmodjo S, Hadiaty RK. Hemibagrus caveatus , a new species of bagrid catfish (Teleostei: Siluriformes) from northern Sumatra. Raffles Bull Zool. 2001;49:359–61. [ Google Scholar ] 18. Ng HH, Kottelat M. Revision of the Asian catfish genus Hemibagrus Bleeker, 1862 (Teleostei: Siluriformes: Bagridae). Raffles Bull Zool. 2013;61:205–91. [ Google Scholar ] 19. Dodson JJ, Lecomte F. A DNA barcode-based evaluation of the Southeast Asian catfish genus Hemibagrus Bleeker, 1862 (Teleostei: Siluriformes; Bagridae). Adv Evol Biol. 2015;2015:1–21. 10.1155/2015/490158. [ Google Scholar ] 20. Ng WK, Lu KS, Hashim R, Ali A. Effects of feeding rate on growth, feed utilization, and body composition of a tropical bagrid catfish. Aquac Int. 2000;8:19–29. 10.1023/A:1009216831360. [ Google Scholar ] 21. Hasan B, Iriani D, Warningsih T, Caipang CMA, Muchlisin ZA, Suharman I. Growth and carcass quality of on-growing river catfish Hemibagrus nemurus fed with dietary salted by-catch and fish viscera meal mixtures as fishmeal substitute. Aquac Rep. 2022;27:101343. 10.1016/j.aqrep.2022.101343. [ Google Scholar ] 22. Tan HH, Ng HH. The catfishes (Teleostei: Siluriformes) of central Sumatra. J Nat Hist. 2000;34:267–303. [ Google Scholar ] 23. Kottelat M. The fishes of the inland waters of Southeast Asia: A catalogue and core bibliography of the fishes known to occur in freshwaters, mangroves, and estuaries. Raffles Bull Zool. 2013;27:1–663. [ Google Scholar ] 24. Ng HH. Hemibagrus velox. IUCN Red List Threatened Species. 2020;2020(eT91181052A91181060). 10.2305/IUCN.UK.2020-1.RLTS.T91181052A91181060.en. Accessed on 10 February 2026. 25. Cuéllar-Pinzón J, Presa P, Hawkins SJ, Pita A. Genetic markers in marine fisheries: Types, tasks, and trends. Fish Res. 2016;173:194–205. 10.1016/j.fishres.2015.10.019. [ Google Scholar ] 26. Aryani N, Hasibuan S, Mardiah A, Syandri H. Morphometric characteristics of Asian catfish, Hemibagrus wyckii (Bleeker, 1858) (Bagridae), from the Riau Province of Indonesia. Pak J Biol Sci. 2017;20:382–9. 10.3923/pjbs.2017.382.389. [ DOI ] [ PubMed ] [ Google Scholar ] 27. Sullivan JP, Lundberg JG, Hardman M. A phylogenetic analysis of the major groups of catfishes (Teleostei: Siluriformes) using RAG1 and RAG2 nuclear gene sequences. Mol Phylogenet Evol. 2006;41:636–62. 10.1016/j.ympev.2006.05.044. [ DOI ] [ PubMed ] [ Google Scholar ] 28. Vu Q, Thi OT, Lan PTT, Linh TT, Thuy BD. Molecular phylogeny of catfishes (Teleostei: Siluriformes) inferred from mitochondrial markers—implications for lower Mekong River basin. Eur J Adv Res Biol Life Sci. 2018;6:1–12. [ Google Scholar ] 29. Widayanti R, Haryanto A, Artama WT, Pakpahan S. Genetic variation and phylogenetic analysis of Indonesian indigenous catfish based on mitochondrial cytochrome oxidase subunit III gene. Vet World. 2019;12:896–900. 10.14202/vetworld.2019.896-900. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 30. Megarani DV, Nugroho HA, Andarini ZP, Surbakti YDRBR, Widayanti R. Genetic characterization and phylogenetic study of Indonesian indigenous catfish based on mitochondrial cytochrome B gene. Vet World. 2020;13:96–103. 10.14202/vetworld.2020.96-103. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 31. Widayanti R, Kusumaastuti KA, Novi JM, Adani FK, Gultom CRP, Prastiti AD, Nugroho HA, Pakpahan S. Genetic variation and phylogenetic analysis of Indonesian indigenous catfish (baung fish) based on mitochondrial 12S rRNA gene. Vet World. 2021;14:751–7. 10.14202/vetworld.2021.751-757. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 32. Yuanawati D, Farizky HS, Santanumurti MB, Jamal MT, Iqbal Sani LM, Madduppa H, Sari PDW. The newest COI molecular detection of Asian redtail catfish Hemibagrus nemurus (Valenciennes, 1840) in Progo River, Magelang, Central Java, Indonesia. J Adv Vet Anim Res. 2022;9:591–600. 10.5455/javar.2022.i628. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 33. Yang L, He S. Phylogeography of the freshwater catfish Hemibagrus guttatus (Siluriformes, Bagridae): Implications for South China biogeography and influence of sea-level changes. Mol Phylogenet Evol. 2008;49:393–8. 10.1016/j.ympev.2008.05.032. [ DOI ] [ PubMed ] [ Google Scholar ] 34. Yang L, Mayden RL, He S. Population genetic structure and geographical differentiation of the Chinese catfish Hemibagrus macropterus (Siluriformes, Bagridae): Evidence for altered drainage patterns. Mol Phylogenet Evol. 2009;51:405–11. 10.1016/j.ympev.2009.01.004. [ DOI ] [ PubMed ] [ Google Scholar ] 35. Hou Y, Ye H, Yue H, Li J, Huang L, Qu Z, Ruan R, Lin D, Liang Z, Xie Y, Li C. Genetic diversity and population structure of largefin longbarbel catfish ( Hemibagrus macropterus ) inferred by mtDNA and microsatellite DNA markers. Anim (Basel). 2025;15:770. 10.3390/ani15060770. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 36. Ng HH, Jiang W. Intrafamilial relationships of the Asian hillstream catfish family Sisoridae (Teleostei: Siluriformes) inferred from nuclear and mitochondrial DNA sequences. Ichthyol Explor Freshwaters. 2015;26:229–40. [ Google Scholar ] 37. Nahon S, Séité S, Kolasinski J, Aguirre P, Geurden I. Effects of euthanasia methods on stable carbon (δ13C value) and nitrogen (δ15N value) isotopic compositions of fry and juvenile rainbow trout Oncorhynchus mykiss . Rapid Commun Mass Spectrom. 2017;31:1742–8. 10.1002/rcm.7958. [ DOI ] [ PubMed ] [ Google Scholar ] 38. Percie du Sert N, Hurst V, Ahluwalia A, Alam S, Avey MT, Baker M, Browne WJ, Clark A, Cuthill IC, Dirnagl U, Emerson M, Garner P, Holgate ST, Howells DW, Karp NA, Lazic SE, Lidster K, MacCallum CJ, Macleod M, Pearl EJ, Petersen OH, Rawle F, Reynolds P, Rooney K, Sena ES, Silberberg SD, Steckler T, Würbel H. The ARRIVE guidelines 2.0: Updated guidelines for reporting animal research. PLoS Biol. 2020;18:e3000410. 10.1371/journal.pbio.3000410. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 39. Baldwin CC, Mounts JH, Smith DG, Weigt LA. Genetic identification and color descriptions of early life-history stages of Belizean Phaeoptyx and Astrapogon (Teleostei: Apogonidae) with comments on identification of adult Phaeoptyx . Zootaxa. 2009;2008:1–22. 10.11646/zootaxa.2008.1.1. [ Google Scholar ] 40. Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 2012;28:1647–9. 10.1093/bioinformatics/bts199. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 41. Wu YP, He QS, Xie JL, Guo XF, Li HY. The complete mitochondrial genome sequence of Hemibagrus nemurus (Siluriformes: Bagridae). Mitochondrial DNA DNA Mapp Seq Anal. 2016;27:1829–30. 10.3109/19401736.2014.971245. [ DOI ] [ PubMed ] [ Google Scholar ] 42. Kumar S, Stecher G, Suleski M, Sanderford M, Sharma S, Tamura K. MEGA12: Molecular Evolutionary Genetic Analysis Version 12 for Adaptive and Green Computing. Mol Biol Evol. 2024;41:msae263. 10.1093/molbev/msae263. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 43. Al Arab M, Höner Zu Siederdissen C, Tout K, Sahyoun AH, Stadler PF, Bernt M. Accurate annotation of protein-coding genes in mitochondrial genomes. Mol Phylogenet Evol. 2017;106:209–16. 10.1016/j.ympev.2016.09.024. [ DOI ] [ PubMed ] [ Google Scholar ] 44. Donath A, Jühling F, Al-Arab M, Bernhart SH, Reinhardt F, Stadler PF, Middendorf M, Bernt M. Improved annotation of protein-coding gene boundaries in metazoan mitochondrial genomes. Nucleic Acids Res. 2019;47:10543–52. 10.1093/nar/gkz833. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 45. Tian H, Que Y, Zhao N, Chen F, Zhu B, Huang D, Chang J, Liao X. The complete mitochondrial genome of the spotted longbarbel catfish, Hemibagrus guttatus (Siluriformes, Bagridae). Mitochondrial DNA A DNA Mapp Seq Anal. 2016;27:467–8. 10.3109/19401736.2014.900670. [ DOI ] [ PubMed ] 46. Zeng Q, Ye H, Peng Z, Wang Z. Mitochondrial genome of Hemibagrus macropterus (Teleostei, Siluriformes). Mitochondrial DNA DNA Mapp Seq Anal. 2012;23:355–7. 10.3109/19401736.2012.690755. [ DOI ] [ PubMed ] [ Google Scholar ] 47. Chowdhury LM, Pr D, Mandal S, Ravi C, Mohindra V, Sarkar UK. Complete mitochondrial genome of critically endangered catfish Hemibagrus punctatus (Jerdon, 1849) and comparative analysis for insights into the phylogeny of hemibagrids through mitogenomic approach. Mol Biol Rep. 2024;51:601. 10.1007/s11033-024-09490-w. [ DOI ] [ PubMed ] [ Google Scholar ] 48. Htun KK, Pan H, Peng Z. The complete mitochondrial genome of Hemibagrus spilopterus (Teleostei: Siluriformes). Mitochondrial DNA B Resour. 2019;4:1566–7. 10.1080/23802359.2019.1601526. [ Google Scholar ] 49. Yang H, Zhao H, Sun J, Zhang Y, Yang Z, Liu L. The complete mitochondrial genome of the Hemibagrus wyckioides (Siluriformes, Bagridae). Mitochondrial DNA DNA Mapp Seq Anal. 2016;27:766–8. 10.3109/19401736.2014.915531. [ DOI ] [ PubMed ] [ Google Scholar ] 50. Darzentas N, Circoletto. Visualizing sequence similarity with Circos. Bioinformatics. 2010;26:2620–1. 10.1093/bioinformatics/btq484. [ DOI ] [ PubMed ] [ Google Scholar ] 51. Perna NT, Kocher TD. Patterns of nucleotide composition at fourfold degenerate sites of animal mitochondrial genomes. J Mol Evol. 1995;41:353–8. 10.1007/BF00186547. [ DOI ] [ PubMed ] [ Google Scholar ] 52. Rozas J, Ferrer-Mata A, Sánchez-DelBarrio JC, Guirao-Rico S, Librado P, Ramos-Onsins SE, Sánchez-Gracia A. Mol Biol Evol. 2017;34:3299–302. 10.1093/molbev/msx248 [ DOI ] [ PubMed ] 53. Xia X. DAMBE6: New tools for microbial genomics, phylogenetics, and molecular evolution. J Hered. 2017;108:431–7. 10.1093/jhered/esx033. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 54. Laslett D, Canbäck B. ARWEN: A program to detect tRNA genes in metazoan mitochondrial nucleotide sequences. Bioinformatics. 2008;24:172–5. 10.1093/bioinformatics/btm573. [ DOI ] [ PubMed ] [ Google Scholar ] 55. Chan PP, Lin BY, Mak AJ, Lowe TM. tRNAscan-SE 2.0: Improved detection and functional classification of transfer RNA genes. Nucleic Acids Res. 2021;49:9077–96. 10.1093/nar/gkab688. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 56. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997;25:4876–82. 10.1093/nar/25.24.4876. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 57. Satoh TP, Miya M, Mabuchi K, Nishida M. Structure and variation of the mitochondrial genome of fishes. BMC Genomics. 2016;17:719. 10.1186/s12864-016-3054-y. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 58. Benson G. Tandem repeats finder: A program to analyze DNA sequences. Nucleic Acids Res. 1999;27:573–80. 10.1093/nar/27.2.573. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 59. Zhang Q, Li F, Dong Y, Cai X, Gu Y, Wang Z, Shen Z. Phylogenetic analysis of Cyprinus acutidorsalis (Wang, 1979) from the Hainan population using complete mitochondrial genome. Mitochondrial DNA B Resour. 2024a;9:841–4. 10.1080/23802359.2024.2323004. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 60. Vences M, Miralles A, Brouillet S, Ducasse J, Fedosov A, Kharchev V, Kostadinov I, Kumari S, Patmanidis S, Scherz MD, Puillandre N. iTaxoTools 0.1: Kickstarting a specimen-based software toolkit for taxonomists. Megataxa. 2021;6:77–92. 10.11646/megataxa.6.2.1. [ Google Scholar ] 61. Darriba D, Taboada GL, Doallo R, Posada D. jModelTest 2: More models, new heuristics, and parallel computing. Nat Methods. 2012;9:772. 10.1038/nmeth.2109. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 62. Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst Biol. 2012;61:539–42. 10.1093/sysbio/sys029. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 63. Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O. New algorithms and methods to estimate maximum-likelihood phylogenies: Assessing the performance of PhyML 3.0. Syst Biol. 2010;59:307–21. 10.1093/sysbio/syq010. [ DOI ] [ PubMed ] [ Google Scholar ] 64. Letunic I, Bork P. Interactive Tree of Life (iTOL) v6: Recent updates to the phylogenetic tree display and annotation tool. Nucleic Acids Res. 2024;52:W78–82. 10.1093/nar/gkae268. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 65. Aini S, Rina R, Sektiana SP, Lee SR, Kim AR, Kang HE, Amin MHF, Jung WK, Putra A, Suyasa IN, Kundu S, Kim HW. Mitogenomic characterization and phylogenetic insights of the ornamental sail-fin molly ( Poecilia velifera ) in non-native Indonesian waters. Biochem Genet. 2025. 10.1007/s10528-025-11093-4. [ DOI ] [ PubMed ] [ Google Scholar ] 66. Izaki AF, Aini S, Putra A, Kang HE, Kim AR, Lee SR, Mulyono M, Amin MHF, Kim HW, Kundu S. Mitogenomic profiling of Cyclocheilichthys repasson (Cypriniformes: Cyprinidae) and its phylogenetic placement within the clade Poropuntiinae. Ecol Evol. 2025;15:e71990. 10.1002/ece3.71990. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 67. Aini S, Putra A, Kang HE, Maulita M, Vu SV, Kim HW, Kang K, Kundu S. Mitogenomic characterization, genetic diversity, and matrilineal phylogenetic insights of the marbled goby ( Oxyeleotris marmorata ) from its native range in Indonesia. Int J Mol Sci. 2026;27:140. 10.3390/ijms27010140. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 68. Huvet M, Stumpf MP. Overlapping genes: A window on gene evolvability. BMC Genomics. 2014;15:721. 10.1186/1471-2164-15-721. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 69. Jørgensen TE, Bakke I, Ursvik A, Andreassen M, Moum T, Johansen SD. An evolutionary preserved intergenic spacer in gadiform mitogenomes generates a long noncoding RNA. BMC Evol Biol. 2014;14:182. 10.1186/s12862-014-0182-3. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 70. Kundu S, Kang HE, Go Y, Bang G, Jang Y, Htoo H, Aini S, Kim HW. Mitogenomic architecture of Atlantic emperor Lethrinus atlanticus (Actinopterygii: Spariformes): Insights into the lineage diversification in Atlantic Ocean. Int J Mol Sci. 2024a;25:10700. 10.3390/ijms251910700. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 71. Yoon TH, Kang HE, Aini S, Wujdi A, Kim HW, Kundu S. Mitogenomic analysis reveals the phylogenetic placement of monotypic Parachelon grandisquamis and distinctive structural features of control regions in mullets. Front Mar Sci. 2024;11:1484198. 10.3389/fmars.2024.1484198. [ Google Scholar ] 72. Kundu S, Kang HE, Kim AR, Lee SR, Kim EB, Amin MHF, Andriyono S, Kim HW, Kang K. Mitogenomic characterization and phylogenetic placement of African hind, Cephalopholis taeniops : Shedding light on the evolution of groupers (Serranidae: Epinephelinae). Int J Mol Sci. 2024b;25:1822. 10.3390/ijms25031822. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 73. Wang F, Jia C, Gao T, Guo X, Zhang X. Characterization of complete mitochondrial genome and phylogeny of three Echeneidae species. Animals. 2025;15:81. 10.3390/ani15010081. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 74. Xu T, Zhang W, Li Y, Wang J, Bai Y, Liu H. The complete mitogenomes of two species of snakehead fish (Perciformes: Channidae): Genome characterization and phylogenetic analysis. Diversity. 2024;16:346. 10.3390/d16060346. [ Google Scholar ] 75. Boore JL. Animal mitochondrial genomes. Nucleic Acids Res. 1999;27:1767–80. 10.1093/nar/27.8.1767. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 76. Wujdi A, Putra A, Aini S, Bang G, Go Y, Kim AR, Lee SR, Kang K, Kim HW, Kundu S. Mitogenomic insights into the Hampala barb ( Hampala macrolepidota ) from Sumatra, Indonesia: Characterization, phylogenetic placement, and genetic diversity. Biomolecules. 2026;16:185. 10.3390/biom16020185. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 77. Martinez AS, Willoughby JR, Christie MR. Genetic diversity in fishes is influenced by habitat type and life-history variation. Ecol Evol. 2018;8:12022–31. 10.1002/ece3.4661. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 78. Duchêne DA, Mather N, Van Der Wal C, Ho SYW. Excluding loci with substitution saturation improves inferences from phylogenomic data. Syst Biol. 2022;71:676–89. 10.1093/sysbio/syab075. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 79. Morio A, Tsutsumi R, Kondo T, Miyoshi H, Kato T, Narasaki S, Satomi S, Nakaya E, Kuroda M, Sakaue H, Kitamura T, Tsutsumi YM. Leucine induces cardioprotection in vitro by promoting mitochondrial function via mTOR and Opa-1 signaling. Nutr Metab Cardiovasc Dis. 2021;31:2979–86. 10.1016/j.numecd.2021.06.025. [ DOI ] [ PubMed ] [ Google Scholar ] 80. Sharp PM, Tuohy TMF, Mosurski KR. Codon usage in yeast: Cluster analysis clearly differentiates highly and lowly expressed genes. Nucleic Acids Res. 1986;14:5125–43. 10.1093/nar/14.13.5125. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 81. Hershberg R, Petrov DA. Selection on codon bias. Annu Rev Genet. 2008;42:287–99. 10.1146/annurev.genet.42.110807.091442. [ DOI ] [ PubMed ] [ Google Scholar ] 82. Zhang Z, Cheng Q, Ge Y. The complete mitochondrial genome of Rhynchocypris oxycephalus (Teleostei: Cyprinidae) and its phylogenetic implications. Ecol Evol. 2019;9:7819–37. 10.1002/ece3.5369. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 83. Yang Z, Nielsen R. Estimating synonymous and nonsynonymous substitution rates under realistic evolutionary models. Mol Biol Evol. 2000;17:32–43. 10.1093/oxfordjournals.molbev.a026236. [ DOI ] [ PubMed ] [ Google Scholar ] 84. Zhao D, Guo Y, Gao Y. Natural selection drives the evolution of mitogenomes in Acrossocheilus . PLoS ONE. 2022;17:e0276056. 10.1371/journal.pone.0276056. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 85. Nei M, Kumar S. Molecular Evolution and Phylogenetics. New York: Oxford University Press; 2000. [ Google Scholar ] 86. Kundu S, Kim HW, Lee J, Chung S, Lee SR, Gietbong FZ, Wibowo A, Kang K. Mitogenomic architecture and phylogenetic relationship of European barracuda, Sphyraena sphyraena (Teleostei: Sphyraenidae) from the Atlantic Ocean. Fishes. 2023;8:573. 10.3390/fishes8120573. [ Google Scholar ] 87. Zhang R-Q, Bai Y-W, Hu J-T, Wang P-Y, Qi Y, Zhang T-X, Jiao H-Y, Lin X-L, Yan Z-G. Complete mitochondrial genomes and phylogenetic analysis of native and non-native fishes in a national key wetland of China. Front Environ Sci. 2024b;12:1415150. 10.3389/fenvs.2024.1415150. [ Google Scholar ] 88. Vercellino I, Sazanov LA. The assembly, regulation, and function of the mitochondrial respiratory chain. Nat Rev Mol Cell Biol. 2022;23:141–61. 10.1038/s41580-021-00415-0. [ DOI ] [ PubMed ] [ Google Scholar ] 89. Ragauskas A, Ignatavičienė I, Rakauskas V, Grauda D, Prakas P, Butkauskas D. Trends of Eurasian perch ( Perca fluviatilis ) mtDNA ATP6 region genetic diversity within the hydro-systems of the eastern part of the Baltic Sea in the Anthropocene. Anim (Basel). 2023;13:3057. 10.3390/ani13193057. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 90. Lee KW, Okot-Kotber C, LaComb JF, Bogenhagen DF. Mitochondrial ribosomal RNA (rRNA) methyltransferase family members are positioned to modify nascent rRNA in foci near the mitochondrial DNA nucleoid. J Biol Chem. 2013;288:31386–99. 10.1074/jbc.M113.515692. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 91. Schuntermann DB, Jaskolowski M, Reynolds NM, Vargas-Rodriguez O. The central role of transfer RNAs in mistranslation. J Biol Chem. 2024;300:107679. 10.1016/j.jbc.2024.107679. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 92. Jühling F, Pütz J, Bernt M, Donath A, Middendorf M, Florentz C, Stadler PF. Improved systematic tRNA gene annotation allows new insights into the evolution of mitochondrial tRNA structures and into the mechanisms of mitochondrial genome rearrangements. Nucleic Acids Res. 2012;40:2833–45. 10.1093/nar/gkr1131. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 93. Fonseca MM, Rocha S, Posada D. Base-pairing versatility determines wobble sites in tRNA anticodons of vertebrate mitogenomes. PLoS ONE. 2012;7:e36605. 10.1371/journal.pone.0036605. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 94. Ho Y, Elefant F, Liebhaber SA, Cooke NE. Locus control region transcription plays an active role in long-range gene activation. Mol Cell. 2006;23:365–75. 10.1016/j.molcel.2006.05.041. [ DOI ] [ PubMed ] [ Google Scholar ] 95. Sun Y, Yang T. Unraveling the mitogenomic characteristics and phylogenetic implications of Leuciscus merzbacheri (Zugmayer, 1912), an endangered fish in the Junggar Basin of Xinjiang, Northwest China. Genes. 2024;15:1284. 10.3390/genes15101284. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 96. Lunt DH, Whipple LE, Hyman BC. Mitochondrial DNA variable number tandem repeats (VNTRs): Utility and problems in molecular ecology. Mol Ecol. 1998;7:1441–55. 10.1046/j.1365-294x.1998.00495.x. [ DOI ] [ PubMed ] [ Google Scholar ] 97. Padhi A. Geographic variation within a tandemly repeated mitochondrial DNA D-loop region of a North American freshwater fish, Pylodictis olivaris . Gene. 2014;538:63–8. 10.1016/j.gene.2014.01.020. [ DOI ] [ PubMed ] [ Google Scholar ] 98. Terencio ML, Schneider CH, Gross MC, Feldberg E, Porto JIR. Structure and organization of the mitochondrial DNA control region with tandemly repeated sequence in the Amazon ornamental fish. Mitochondrial DNA DNA Mapp Seq Anal. 2013;24:74–82. 10.3109/19401736.2012.717934. [ DOI ] [ PubMed ] [ Google Scholar ] 99. Bridge TCL, Luiz OJ, Coleman RR, Kane CN, Kosaki RK. Ecological and morphological traits predict depth-generalist fishes on coral reefs. Proc Biol Sci. 2016;283:20152332. 10.1098/rspb.2015.2332. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 100. Shao WH, Cheng JL, Zhang E. Eight in one: Hidden diversity of the bagrid catfish Tachysurus albomarginatus s.l. (Rendhal, 1928) widespread in lowlands of South China. Front Genet. 2021;12:713793. 10.3389/fgene.2021.713793. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Associated Data This section collects any data citations, data availability statements, or supplementary materials included in this article. Supplementary Materials Supplementary Material 1. (1.3MB, docx) Data Availability Statement The partial COI sequences (accession number PX974664 ) and the complete mitogenome (accession number PP922174 ) of H. velox generated in this study have been deposited in the GenBank database ( https://www.ncbi.nlm.nih.gov ) and are publicly available. Articles from BMC Genomics are provided here courtesy of BMC ACTIONS View on publisher site PDF (9.3 MB) Cite Collections Permalink PERMALINK Copy RESOURCES Similar articles Cited by other articles Links to NCBI Databases Cite Copy Download .nbib .nbib Format: AMA APA MLA NLM Add to Collections Create a new collection Add to an existing collection Name your collection * Choose a collection Unable to load your collection due to an error Please try again Add Cancel Follow NCBI NCBI on X (formerly known as Twitter) NCBI on Facebook NCBI on LinkedIn NCBI on GitHub NCBI RSS feed Connect with NLM NLM on X (formerly known as Twitter) NLM on Facebook NLM on YouTube National Library of Medicine 8600 Rockville Pike Bethesda, MD 20894 Web Policies FOIA HHS Vulnerability Disclosure Help Accessibility Careers NLM NIH HHS USA.gov Back to Top

Record · ID 25712 · SHA-256 8c7ee12cd65be7e9
Retrieved via Conceptio — every document is proof-bundled with source, license, and retrieval metadata.