Cerebrolysin-loaded platelet-rich plasma exosomes: Restoring immune homeostasis via TNF-α/IL-10 modulation and apoptosis targeting for spinal cord injury repair.

Cerebrolysin-loaded platelet-rich plasma exosomes: Restoring immune homeostasis via TNF-α/IL-10 modulation and apoptosis targeting for spinal cord injury repair - PMC Skip to main content An official website of the United States government Here's how you know Here's how you know Search Log in Primary site navigation Search Log in Search PMC Full-Text Archive Search in PMC Journal List User Guide As a library, NLM provides access to scientific literature. Inclusion in an NLM database does not imply endorsement of, or agreement with, the contents by NLM or the National Institutes of Health. Learn more: PMC Disclaimer | PMC Copyright Notice J Spinal Cord Med . 2025 Jun 5;49(2):375–387. doi: 10.1080/10790268.2025.2503053 Cerebrolysin-loaded platelet-rich plasma exosomes: Restoring immune homeostasis via TNF-α/IL-10 modulation and apoptosis targeting for spinal cord injury repair Naeimeh Akbari-Gharalari 1, 2 , Zeinab Aliyari-Serej 3, 4 , Maryam Ghahremani-Nasab 5 , Hamid Soltani Zangbar 2 , Yahya Yahyavi 6 , Farshad Nezhadshahmohammad 7 , Abbas Ebrahimi-Kalan 2, 4, ✉ Author information Article notes Copyright and License information 1 Neurophysiology Research Center, Cellular and Molecular Medicine Research Institute, Urmia University of Medical Sciences, Urmia, Iran 2 Department of Neuroscience and Cognition, Faculty of Advanced Medical Sciences, Tabriz University of Medical Sciences, Tabriz, Iran 3 Department of Applied Cell Sciences, School of Advanced Medical Sciences, Tabriz University of Medical Sciences, Tabriz, Iran 4 Stem Cell Research Center, Tabriz University of Medical Sciences, Tabriz, Iran 5 Stem Cells and Regenerative Medicine Institute, Tabriz University of Medical Sciences, Tabriz, Iran 6 Department of Molecular Medicine, Faculty of Advanced Medical Sciences, Tabriz University of Medical Sciences, Tabriz, Iran 7 Department of Mining Engineering, Faculty of Engineering, Urmia University, Urmia, Iran ✉ Correspondence to: Abbas Ebrahimi-Kalan, Department of Neuroscience and Cognition, Faculty of Advanced Medical Sciences, Tabriz University of Medical Sciences, Tabriz, Iran. Email: abbasebra@gmail.com Collection date 2026. © The Academy of Spinal Cord Injury Professionals, Inc. 2025 PMC Copyright notice PMCID: PMC12931343  PMID: 40470992 Abstract Context/objective Spinal cord injury (SCI) is a severe condition characterized by neuronal apoptosis and inflammation, with limited therapeutic options. This study aimed to assess the effects of platelet-rich plasma (PRP)-derived exosomes (Exo), Cerebrolysin (CBL), and Cerebrolysin-loaded exosomes (CLE) on inflammation, apoptosis, tissue organization, and motor function recovery in a mouse model of compression SCI. Design An experimental study using a mouse model of SCI, investigating the effects of Exo, CBL, and CLE treatments. Setting Laboratory-based research in a controlled environment. Participants Sixty healthy adult female BALB/c mice, aged 8–10 weeks, weighing 24 ± 2 g were used. SCI was induced via compression to model SCI. Interventions Mice with induced SCI were treated with Exo, CBL, or CLE. Apoptosis was assessed by Bax and Bcl2 expression. Inflammatory markers TNF-α and IL-10 were measured. Histological analysis examined tissue organization, and motor function recovery was evaluated using the Basso-Beattie-Bresnahan (BBB) locomotor scale. Outcome measures The study measured Bax and Bcl2 expression, TNF-α and IL-10 levels, tissue organization, and motor function recovery. Results CLE treatment significantly modulated Bax and Bcl2 expression, reducing apoptosis and enhancing neuronal survival. TNF-α levels decreased, indicating reduced inflammation, while IL-10 levels increased, showing anti-inflammatory effects. Histological assessment revealed improved tissue organization, and motor function recovery was significantly enhanced as measured by BBB scores. Conclusion CLE showed neuroprotective and anti-inflammatory effects, reducing apoptosis and inflammation while promoting tissue repair and motor function recovery in SCI, making it a promising therapeutic candidate. Keywords: Spinal cord injury, PRP-Derived exosomes, Cerebrolysin, Drug delivery, Target therapy Introduction Spinal cord injury (SCI) is a severe disease that causes physical dependence, morbidity, psychological stress, and financial burden and affects between 250,000 and 500,000 people annually worldwide ( 1 ). The complexity of SCI, which is characterized by a variety of variables, contradictions, and complicated pathophysiological consequences, has impeded the development of thorough knowledge and efficient treatments ( 2 ). Spinal cord physiology involves intricate interactions between various cell types, including astrocytes, neurons, microglia, and oligodendrocytes, which can be disrupted after injury, affecting spinal cord healing ( 3 ). Animal trials have demonstrated the effectiveness of current SCI therapies, including medications, neural implants, and stem cells, in promoting axonal growth, reducing neuroinflammation, enhancing myelination, and reducing cavity size ( 4 , 5 ). Severe trauma often leads to acute SCI, resulting in vertebral fractures and dislocations, with common signs in the initial injury phase following the accident ( 4 ). The secondary injury phase, a complex pathological process lasting several weeks after initial trauma, involves excessive intracellular calcium buildup, increased reactive oxygen species, and increased glutamate levels, leading to neuronal excitotoxicity, protein damage, phospholipid damage, and nucleic acid dysfunction ( 6 , 7 ). With these challenges, it is clear that treating SCI is still a difficult endeavor, and additional studies are needed to develop more potent treatment plans. Almost all cell types release exosomes, a type of extracellular vesicle, which are effective delivery vehicles with unique biochemical and biophysical characteristics that ensure stable circulation ( 8 ). Exosomes may travel great distances throughout the body in both healthy and pathological settings because of their stability. Lipophilic and hydrophilic medicines can be transported by exosomes due to their lipid bilayer membrane and watery core ( 9 , 10 ). Exosomes are valuable in biomedicine due to their ability to transfer signals across species without unique characteristics, and they can be derived and modified for medicinal purposes ( 11 ). Within the framework of SCI, exosomes are essential for reducing secondary damage. By interacting with cytokines and activated microglia, they inhibit the synthesis of proinflammatory chemicals, thus mitigating inflammation ( 5 ). Inhibiting the proinflammatory environment is the main treatment approach for SCI. This strategy is supported by data showing a decrease in tumor necrosis factor-α (TNF-α) in the inflammatory response and a correlation between the cytokine IL-10 and improved motor functional recovery in SCI patients ( 12 , 13 ). Exosomes have been shown to improve the recovery of neural function by upregulating the antiapoptotic protein Bcl2 and downregulating the proapoptotic protein Bax ( 14 ). Because they include growth factors, exosomes generated from platelet-rich plasma have demonstrated promise in the treatment of chronic injuries ( 15 ). Further research is needed to fully understand exosome functions in SCI therapy and medicinal applications. The potential of endogenous biomolecules, such as neurotrophins, to enhance the survival, proliferation, and sprouting of corticospinal pathways in neuronal cells after SCI has been investigated in recent research. To restore neural network functioning, neurotrophins play a critical role in improving electrical and cell-to-cell communication ( 16 ). Because of the capacity of these biomolecules to regenerate in SCI, they have been used. The development, growth, survival, and network repair of neurons are regulated by classical neurotrophins, which include brain-derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3), nerve growth factor (NGF), and neurotrophin-4/5 ( 17 , 18 ). In abnormalities of the CNS and after trauma, Cerebrolysin (EVER NeuroPharma Austria) (CBL), a well-balanced blend of neurotrophins and peptides, improves neuronal plasticity, neuroregeneration, and neuroprotection ( 19 ). CBL has emerged as a promising therapeutic agent for SCI due to its multifaceted neuroprotective and neuroregenerative properties. Unlike individual neurotrophins, CBL is a unique peptide mixture derived from the biochemical and enzymatic processing of porcine brain proteins ( 20 ). Its low molecular weight allows it to efficiently cross the blood–brain barrier, facilitating targeted delivery to the central nervous system. Studies have shown that CBL enhances neuronal survival, plasticity, and functional recovery while reducing lesion size, spinal cord edema, and blood-spinal cord barrier (BSCB) disruption. Given its comprehensive neuroprotective effects, CBL holds significant potential as a treatment for SCI, and its integration with nanotechnology-based delivery systems may further enhance its clinical efficacy ( 21 ). Rats with SCI that received an intrathecal injection of CBL had much better motor neuron survival and function ( 22 ). External supplementation with CBL improves spinal cord function, promotes neuronal regeneration, and reduces lesion site damage, spinal cord edema, and BSCB disruption in individuals with SCI ( 19 ). Furthermore, CBL may reduce morphine withdrawal and dependency by lowering cellular stress, decreasing apoptosis, and reducing intracellular Ca2+ buildup, thereby increasing cell survival ( 23 ). Overall, CBL shows great promise as a neuroprotective drug, and its administration via nanotechnology may offer even better neuroprotection in SCI. While both exosomes and CBL have shown promise in SCI treatment, their combination as Cerebrolysin-Loaded Exosomes (CLE) offers a novel therapeutic strategy that may enhance recovery more effectively than either therapy alone. CLE leverages the neuroregenerative and neuroprotective properties of CBL while utilizing exosomes as a targeted delivery system, ensuring stable circulation and efficient transport across the BSCB. This dual approach may amplify neurotrophic support, reduce neuroinflammation, and enhance neuronal survival by synergistically modulating the Bax/Bcl2 pathway and regulating TNF-α and IL-10 levels. Given these potential advantages, CLE could represent a more potent intervention for SCI, warranting further investigation into its mechanisms and therapeutic efficacy. This study explored the effects of exosomes, CBL, and CLE on a mouse model of SCI, focusing on manipulating the Bax/Bcl2 pathway and regulating TNF-α and IL-10 levels to enhance spinal cord recovery and improve SCI patient outcomes. Experimental procedures Preparation, isolation and characterization of PRP-derived exosomes In this study, venous blood samples totaling 100 ml were collected from ten asymptomatic male participants aged 35 to 45 years for the preparation of platelet-rich plasma (PRP). We utilized an extraction method for exosomes that was employed in our previous research ( 5 ). These exosomes were then stored at −80°C for subsequent treatment and analysis ( 24 ), and the extracted exosomes were used within less than one month. Dynamic light scattering (DLS) was employed to assess the size distribution and zeta potential of the exosomes using a Malvern Zetasizer Nano ZS-UK instrument under controlled conditions at 25°C. The total protein concentration within the samples was determined using the Bradford protein assay, which involves measuring the absorbance at 595 nm with a spectrophotometer (CE7250). Additionally, the size and structure of the exosomes were analyzed using field emission scanning electron microscopy (MIRA3 FEG-SEM Tescan). Encapsulation and release kinetics of CBL In this study, we utilized the sonication technique outlined by Wan et al. ( 25 ) to encapsulate CBL within exosomes. This process involved combining a specified amount of CBL with 20 μg of exosomes in a total volume of 100 µl at 37°C for 20 minutes. The mixture was then subjected to sonication in a water bath sonicator (WUC-D10H) with the following settings: 20% amplitude, 6 cycles of 30 s on/off for a total of 3 minutes, and a 2-minute cooling period between cycles. After sonication, the sample was incubated at 37°C for 60 minutes and subsequently ultracentrifuged at 100,000×g for 2 hours to allow exosome sedimentation. Immediately after CBL loading, the freshly prepared exosomes were administered to the mice to ensure optimal therapeutic efficacy. The loading of CBL into exosomes was quantified via UV spectrophotometry by measuring the absorbance of the supernatant at the intended λ max of 280 nm. To analyze the drug release profile from the exosomes, spectrophotometry was conducted over a span of 72 hours. Exosomes were dissolved in PBS and placed inside a 10 kDa dialysis bag, which was then immersed in PBS. Absorption wavelength measurements were taken periodically to monitor the release. Animals and surgical procedure For this study, sixty healthy adult female BALB/c mice aged 8–10 weeks and weighing an average of 24 ± 2 g were obtained from Tabriz University of Medical Sciences. Female BALB/c mice were selected for this study due to their reported better neuroprotection and recovery post-SCI, as well as the ease of manual bladder emptying, which reduces the risk of urinary tract infections and lowers mortality rates. The mice were maintained under standard laboratory conditions, and the experimental protocols received approval from the Experimental Animal Care and Ethics Committee of the university (registration no. IR.TBZMED.VCR.REC.1399.471). The study involved six groups of ten mice each: control, laminectomy, SCI, Exo, CBL, and CLE. Compression of SCI was induced under ketamine (80 mg/kg) and xylazine (20 mg/kg) anesthesia via the IP route ( 26 ). Presurgical preparations included the application of vitamin A ointment to prevent corneal dryness. A longitudinal incision was made on the thoracic vertebrae after shaving and sterilizing the surgical site. The fascia and paravertebral muscles were dissected from the T9-T11 vertebrae, and a laminectomy was performed at the T10 vertebrae without damaging the spinal cord. The dorsal part of the T10 spinal cord segment was compressed using specialized forceps for 15 s. Postsurgery, the incision was sutured, and the mice were kept warm until they regained consciousness. They were then individually housed with thick bedding to minimize infection risk, and their cages were regularly cleaned. Following SCI induction, the mice lost their voiding reflex and required manual bladder emptying twice daily until reflex restoration. Treatments were administered via tail vein injection as follows: The Exo group received exosomes (0.4 mg/kg) in PBS (10 µg of exosomes in 100 µl of PBS) every three days for 28 days postinjury ( 5 ). The CBL group received Cerebrolysin (2.5 ml/kg) ( 27 ), and the CLE group received a combination of exosomes and CBL at three-day intervals. Additionally, all mice received daily IP injections of normal saline (100 ml/kg/day) for hydration and ceftriaxone (100 mg/kg/day) for infection prevention for seven days. Analgesia was provided with subcutaneous ketoprofen (0.5 mg/kg/day) for three days ( 5 ). BBB locomotor test Hind limb motor function recovery in BALB/c mice was assessed using the Basso, Beattie, and Bresnahan (BBB) Locomotor Rating Scale, which was originally developed by Basso and colleagues ( 28 ). This scale utilizes a 21-point rating system to assess the locomotor abilities of the lower limbs, ranging from complete paralysis (score of 0) to normal function (score of 21). Three hours postsurgery, once the mice regained consciousness, they were individually placed in an open field environment and allowed to move freely for five minutes. Two independent observers who were blinded to the treatment groups evaluated hind limb motor skill recovery using the BBB scale four weeks after surgery. Visualization and homing analysis of DiI-labeled exosomes To visualize the exosomes, a red fluorescent lipid stain, 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindocarbocyanine perchlorate (DiI), was used. Exosomes were incubated with DiI at a volume ratio of 400:1, maintaining an exosome concentration of 1 μg/μL, for 30 minutes at 37°C. After staining, ultracentrifugation was employed to purify the exosomes by removing any unbound dye. To investigate the homing capabilities of the labeled exosomes, DiI-stained PRP-exosomes were administered intravenously into the tail veins of three BALB/c mice. The exosomes were diluted in 100 μL of sterile phosphate-buffered saline (PBS). After 24 hours, the mice were euthanized, and their spinal cords were harvested. The injured spinal cord tissues, both longitudinal and transverse, were cryosectioned and analyzed through fluorescence microscopy. This analysis aimed to quantify the fluorescence intensity and, consequently, the distribution of the exosomes within the damaged spinal cord areas. Histological assessment and analysis of spinal cord tissue postinjury Hematoxylin–eosin (H&E) staining was used for spinal cord tissue samples obtained from the T8–T12 area 28 days after injury in each of the experimental groups. The mice were thoroughly sedated and then intracardially perfused with freshly made 10% formaldehyde to end their lives. A sequence of procedures, including washing, dehydration, clearing, paraffinization, and embedding in paraffin, were used to prepare the fixed tissue samples. Using a microtome, longitudinal slices with thicknesses of 5 µm and 10 slice intervals were created, and then they were placed onto glass slides. These slices were stained with H&E, and Kview (version: 3.7) software was used to examine the generated images. Serum collection and cytokine quantification Upon collection, a cardiac blood sample underwent immediate centrifugation at 2500×g for 10 minutes. The resulting serum samples were then carefully preserved at −70°C until the quantification of cytokines. Specifically, the concentrations of two cytokines, TNF-α and IL-10, were assessed in the serum samples utilizing enzyme-linked immunosorbent assay (ELISA) kits procured from R&D Systems (Minneapolis, USA). Gene expression analysis via real-time PCR Spinal cord RNA was isolated utilizing TRIzol reagent (Gibco, USA), and subsequent cDNA synthesis was conducted following the manufacturer’s protocols using a cDNA synthesis kit (Pars Tous, Iran). The synthesized cDNA from the extracted RNA served as the template for assessing the expression of the Bax and Bcl2 genes by employing the specific oligonucleotide primers detailed in Table 1 . The reaction mixture, comprising 10 μl, included 5 μl of prime Q-Master Mix with SYBR Green I (Pars Tous, Iran), 1.1 μl of cDNA, 1 μl of both forward and reverse primers, and 2.9 μl of sterile deionized water, as per the manufacturer’s guidelines. Real-time PCR was performed using the LightCycler-FastStart DNA Master SYBR Green system (Roche Molecular Biochemicals, Mannheim, Germany), initiating with a 15-minute preincubation at 95 °C, followed by 55 cycles of 60 seconds at 58 °C (denaturation) and 10 seconds at 95 °C (annealing). To prevent nonspecific product amplification, a melting curve analysis was performed utilizing a light cycler system. The β-actin gene, which has the same annealing temperature, was used as an internal control for housekeeping gene expression. All reactions were conducted in duplicate to ensure accuracy. Table 1. List of primer sets. Gene Primer sequence a Bax F: AGGGTTTCATCCAGGATCGAG R: TCCACGTCAGCAATCATCCTC Bcl2 F: GCCTCTTCACCTTTCAGCATTG R: TTCCCCGTTGGCATGAGATG β-actin F: TACAGCTTCACCACCACAGC R: ATGCCACAGGATTCCATACC Open in a new tab a Sequences were derived from NCBI ( www.ncbi.nlm.nih.gov ). Statistical analysis Statistical analyses were conducted using GraphPad Prism software (version 9.3.1, USA) to evaluate the data and generate graphical representations. For BBB locomotor test results, repeated measures ANOVA was used to assess the effects of treatment type (Exo, CBL, CLE) and time point (across the four weeks) on motor function recovery. Tukey’s post hoc test was applied to identify significant differences between groups at each time point. For other results, such as spinal cord tissue modifications, cytokine quantification, and gene expression analysis, one-way ANOVA was used to compare the data across the distinct treatment groups at the 28-day time point. Tukey’s post hoc test was applied for multiple comparisons between groups. Semiquantitative histological data, expressed as the median with the range from minimum to maximum, were analyzed using the Kruskal–Wallis test. Post hoc analysis employing the Mann–Whitney test was conducted where significant effects were observed. A P value less than 0.05 indicated statistical significance. Results Exosome characterization Exosomes were isolated from PRP obtained from healthy human donors. Characterization of their size distribution and zeta potential was performed using DLS, which revealed a consistent size distribution with an average diameter of 57.03 nm ( Figure 1 (a)) and a zeta potential of approximately −6.79 mV ( Figure 1 (b)). SEM was employed to further investigate the morphology of the exosomes, confirming the size uniformity observed in DLS measurements ( Figure 1 (c)). The protein content of the exosomes was quantified using a spectrophotometric Bradford assay, with results indicating 2.5 μg of protein per microliter of exosome solution. The exosomes were subsequently stored at −80 °C for future use. Figure 1. Open in a new tab Exosome characterization. (a) Size distribution of the exosomes; (b) zeta potential of the exosomes; (c) SEM image showing the exosome morphology. CBL loading and release rates The encapsulation of CBL in exosomes via sonication was quantified using spectrophotometry at the designated λmax, revealing an incorporation rate of approximately 30.95% ( Figure 2 (a)). Previous studies have indicated that the surface proteins of exosomes remain unchanged after sonication-mediated loading ( 29 ). The release of CBL from the exosomes, as evaluated spectrophotometrically over 72 hours, showed that approximately 35.17% of the incorporated drug was released during this time ( Figure 2 (b)). The percentages of released CBL at various incubation intervals (1, 6, 12, 24, 36, 48, and 72 hours) in PBS are detailed in Table 2 . Figure 2. Open in a new tab Encapsulation and Release of CBL in Exosomes. (a) CBL encapsulation efficiency in exosomes via sonication; (b) profile of CBL release from exosomes over 72 hours. Table 2. Release percentages of CBL at various incubation intervals in PBS. Time (hour) 1 6 12 24 36 48 72 CBL release (%) 6.90 ± 0.85, n = 3 10.93 ± 0.82, n = 3 14.97 ± 0.74, n = 3 17.58 ± 0.31, n = 3 23.64 ± 0.74, n = 3 27.09 ± 0.66, n = 3 35.17 ± 0.41, n = 3 Open in a new tab Comparative motor function recovery using BBB scores The BBB test was administered four hours post-surgery and subsequently weekly, with the average scores presented in Table 3 . The trend of motor function improvement over four weeks is illustrated in Figure 3 (a). This linear diagram shows that the main treatment group, CLE, exhibited a more rapid and intense improvement in motor symptoms than did the Exo, CBL, and SCI groups. Comparisons were made between the scores of the different experimental groups ( Figure 3 (b)). In the first week, there was no significant difference between the SCI and Exo groups in terms of average BBB scores. However, significant differences were observed between the CLE group and the CBL group compared to the SCI group ( P < 0.001), between the Exo group and the CBL group ( P < 0.05), and between the Exo group and the CLE group ( P < 0.01), while no significant difference existed between the CBL group and the CLE group. In the second week, significant differences were detected between the CBL and CLE groups compared with the SCI group ( P < 0.001), between the CLE and Exo groups ( P < 0.01), and between the Exo and the SCI groups ( P < 0.05). However, there were no significant differences between the Exo and CBL groups or between the CBL and CLE groups. In the third week, significant differences were noted between all three treatments and the SCI group ( P < 0.001) and between the Exo and CLE groups ( P < 0.05), with no significant differences between the Exo and CBL groups or between the CBL and CLE groups. In the fourth week, all three treatments significantly differed from those in the SCI group ( P < 0.001). Additionally, significant differences were found between the CLE and CBL groups ( P < 0.01) and between the CLE and Exo groups ( P < 0.01), with no significant difference between the CBL and Exo groups. The locomotor function of the mice in the laminectomy group reached normal in the third week. Table 3. Average BBB scores following weekly assessments. Week Groups 1 2 3 4 Control 21 21 21 21 Laminectomy 18 . 66 20 21 21 SCI 3 . 33 4.66 5.66 5.66 Exo 5 7 9.66 11 CBL 7 . 33 8.66 10.33 11.33 CLE 8 . 33 10.33 12 14.33 Open in a new tab Figure 3. Open in a new tab (a) Weekly BBB scores illustrating motor function improvement over four weeks; (b) Comparative BBB scores among groups, with significance indicated by star symbols: * P < 0.05, ** P < 0.01, and *** P < 0.001. DiI-labeled exosome localization in injured spinal cord To explore whether exosomes derived from PRP can penetrate the spinal cord following injury, the exosomes were labeled with the red fluorescent dye DiI. Twenty-four hours after the IV injection of DiI-labeled exosomes, their localization was examined under a fluorescence microscope. The results revealed the gradual spread of exosomes from the injection site to various regions of the spinal cord, as depicted in Figure 4 , through cross-sectional tissue analysis. Figure 4. Open in a new tab Distribution of DiI-labeled exosomes in cross-sections of spinal cord tissue 24 hours postinjection. Qualitative comparison of spinal tissue among the experimental groups H&E-stained spinal tissues from all the experimental groups were subjected to histological examination. Representative images are shown in Figure 5 for each group in the following order: (a) Control; (b) Laminectomy; (c) SCI; (d) Exo; (e) CBL; and (f) CLE. Qualitatively, the SCI group exhibited pronounced tissue disorganization and a larger lesion size than the other groups. In contrast, the treatment groups showed reduced tissue disruption and smaller lesion sizes, with the CLE group demonstrating the least disturbance and lesion size among the treatment groups. Figure 5. Open in a new tab H&E-stained histological images of spinal tissues from the (a) control, (b) laminectomy, (c) SCI, (d) Exo, (e) CBL, and (f) CLE groups. Serum levels of TNF-α and IL-10 The serum levels of TNF-α and IL-10 were assessed using ELISA. The findings revealed significantly lower TNF-α levels in the Exo ( P < 0.001), CBL, and CLE groups ( P < 0.001) than in the SCI group, as shown in Figure 6 (a). Additionally, significant differences were observed between the Exo and CBL groups ( P < 0.01), the Exo and CLE groups ( P < 0.001), and the CLE and CBL groups ( P < 0.01). Conversely, IL-10 levels increased following the administration of Exo, CBL, or CLE. Significant differences were observed between the Exo ( P < 0.01), CBL, and CLE groups ( P < 0.001) and the SCI group, as illustrated in Figure 6 (b). Moreover, significant differences were noted between the Exo and CBL ( P < 0.05), Exo and CLE ( P < 0.001), and CBL and CLE groups ( P < 0.01). Figure 6. Open in a new tab Comparison of the serum levels of TNF-α and IL-10 among the experimental groups, with statistical significance indicated by star symbols: * P < 0.05, ** P < 0.01, and *** P < 0.001. (a) TNF-α levels were significantly lower in the Exo, CBL, and CLE groups than in the SCI group; (b) IL-10 levels increased significantly with Exo, CBL, and CLE treatments compared to those in the SCI group, with differences observed among treatment groups. Expression of Bax/Bcl2 at spinal cord lesion site SCI induced increased expression of the apoptotic Bax gene compared to that in the control and laminectomy groups; however, this expression was significantly reduced in the Exo, CBL, and CLE treatment groups compared to that in the SCI group ( P < 0.001), with significant differences observed between Exo and CLE ( P < 0.001) and between CBL and CLE ( P < 0.05) but not between Exo and CBL ( Figure 7 (a)). Post-injury, the expression of the anti-apoptotic Bcl2 gene decreased, while Exo, CBL, and CLE treatments increased its expression. Significant differences were found between SCI and CBL ( P < 0.01), between SCI and CLE ( P < 0.001), and between Exo and CLE ( P < 0.001), but not between SCI and Exo, between Exo and CBL, or between CBL and CLE ( Figure 7 (b)). Comparison of the apoptotic-to-anti-apoptotic gene expression ratios revealed significant decreases in all treatment groups compared to those in the SCI group, as well as between the Exo and CBL groups, between the Exo and CLE groups, and between the CBL and CLE groups ( P < 0.001) ( Figure 7 (c)). Figure 7. Open in a new tab Real-time PCR analysis results, with statistical significance indicated by star symbols: * P < 0.05, ** P < 0.01, and *** P < 0.001. (a) Bax expression increased after SCI and was reduced by Exo, CBL, and CLE treatments. (b) Bcl2 expression decreased after SCI but was upregulated following treatment. (c) The Bax/Bcl2 ratio significantly decreased in all treatment groups compared to the SCI group. Discussion SCI results in a progressive decline in motor, sensory, and autonomic functions, leading to trauma that can partially or completely damage the spinal cord. This condition has significant physical, psychosocial, and vocational impacts on both patients and their caregivers. SCI involves both primary and secondary damage. The initial injury causes acute bleeding and ischemia, leading to further damage. Secondary mechanisms begin within minutes and can last for weeks or months, expanding the trauma area. This phase includes acute events such as electrolyte shifts, edema, and necrotic cell death and introduces new events such as free radical formation, delayed calcium influx, immune response, inflammation, and apoptotic cell death. Proinflammatory cytokines, mainly TNF-α, cause oxidative stress, inflammation, and apoptosis, which contribute significantly to SCI. Exacerbating the inflammatory response, TNF-α activates nuclear factor-kappa B, a transcription factor that controls genes involved in inflammation and the immunological response, increasing proinflammatory cytokines and chemokines ( 30 ). TNF-α also affects the pathways leading to oxidative stress, which produces reactive oxygen species, kills cells, and reduces the action of antioxidant enzymes. It also alters apoptosis signaling pathways by inducing proapoptotic genes and caspase-mediated cell death. Conversely, in SCI, anti-inflammatory cytokines such as IL-10 influence the immune system and encourage tissue regeneration. In addition to stimulating the production of anti-inflammatory cytokines such as IL-4 and IL-13 and suppressing proinflammatory cytokines such as TNF-α and IL-1β, IL-10 stimulates the JAK/STAT pathway, which results in the activation of anti-inflammatory genes and regulates the activity of immune cells. Moreover, IL-10 influences the apoptotic signaling pathway by upregulating antiapoptotic genes such as Bcl2 and downregulating proapoptotic genes such as Bax ( 9 , 31 ). This interaction highlights the complex balance between pro- and anti-inflammatory signals in the pathophysiology of SCI, with the reparative and protective effects of IL-10 counterbalancing the damage induced by TNF-α. By facilitating the release of cytochrome c from mitochondria, Bax promotes apoptosis, whereas Bcl2 inhibits this process and enhances cell survival. Increased neuronal apoptosis following SCI is associated with a decrease in Bcl2 expression and an increase in Bax expression. Previous studies have demonstrated that exosomes may efficiently transfer functional cargo from a variety of sources using CP05, making them interesting drug delivery vehicles ( 32 , 33 ). As an exosomal capture peptide, CP05 is able to recognize and bind to the exosomal marker CD63 with specificity. It is utilized in the creation of fusion peptides that are intended to transport cargo into exosomes. PRP-derived exosomes are particularly advantageous since they include several membrane proteins, such as CD63, and do not promote cancer ( 34 ). PRP-derived exosomes are generated in greater quantities with advantageous size features compared to those from cell lines, allowing for intracellular delivery. They are also easily accessible, decreasing immune responses associated with foreign exosomes. In the present study, we employed PRP-derived exosomes, a blend of peptides from pig brains that were subjected to enzymatic treatment, as a delivery system for CBL. These peptides include NGF, glial cell line-derived neurotrophic factor (GDNF), BDNF, and ciliary neurotrophic factor (CNTF). The results of this study showed that PRP exosomes might be a useful therapeutic strategy for treating SCI. PRP offers a convenient supply of exosomes that can be used to deliver drugs for SCI treatment. Exosomes generated from platelets are widely available and may be extracted using minimally invasive techniques. They present an appealing alternative for delivering therapeutic drugs such as CBL directly to SCI sites due to their exceptional capacity to cross biological barriers, target injured tissues, and alter immune responses. By lowering dose requirements and eliminating adverse effects, the incorporation of CBL into exosomes can improve therapeutic effectiveness. Moreover, exosomes themselves have natural healing qualities that work in concert with CBL administration, such as immunomodulatory and anti-inflammatory effects as well as stimulation of tissue regeneration and repair. Their ability to proceed with preclinical studies is supported by their proven safety profile. Furthermore, because exosomes are highly customizable, targeted treatment can be achieved by altering their payload with functional molecules such as miRNAs. CBL, a neuropeptide-based drug, has demonstrated neuroprotective effects with a favorable safety profile and minimal risk of immune activation. Unlike recombinant proteins, its low-molecular-weight peptides are rapidly metabolized, reducing immunogenicity. A placebo-controlled trial confirmed that CBL does not increase immune-related adverse events ( 35 ), making it a strong candidate for exosome-mediated therapeutic delivery. Exosomes, as non-immunogenic and biocompatible carriers ( 36 ), enhance CBL’s stability, targeted delivery, and neurorepair while minimizing immune responses. The CLE approach, leverages their synergistic effects to provide a safer and more effective strategy for neurological treatment. The present study demonstrated that Exo and CBL led to a reduction in TNF-α levels and an increase in IL-10 levels, with these effects being most pronounced in the CLE group ( Figure 6 ). Additionally, compared with the SCI group, the CLE group exhibited a significant reduction in Bax gene expression and an increase in Bcl2 gene expression ( Figure 7 ). These findings suggest that the combination of Exo and CBL effectively suppresses apoptosis and inflammation. Furthermore, histological analysis of stained spinal cord tissues from the lesion site revealed less tissue disorganization in the treatment groups than in the SCI group, with the CLE group showing the smallest injury site and the least tissue disorganization among all treatment groups ( Figure 5 ). The histological findings are consistent with the molecular data, particularly in terms of Bax/Bcl2 expression, providing a cohesive narrative of the therapeutic efficacy of CLE. The CLE group demonstrated a significant reduction in Bax gene expression and an increase in Bcl2 expression, which are indicators of reduced apoptosis and enhanced cell survival. These molecular changes were mirrored in the histological analysis, where the CLE-treated group exhibited less tissue disorganization, a smaller injury site, and improved spinal cord morphology compared to the SCI group ( Figure 5 ). This alignment between molecular and histological data reinforces the notion that CLE’s effectiveness in promoting recovery after SCI is driven by its ability to modulate apoptotic pathways, thus preventing neuronal death and supporting tissue regeneration. This indicates a positive impact of the treatment on nerve regeneration. Moreover, the BBB locomotor test indicated greater recovery in the treatment groups than in the SCI group, with the CLE group exhibiting the most significant improvement in motor performance. As illustrated in Figure 3 (a), both the Exo and CBL groups showed relative improvement by the fourth week, whereas the CLE group demonstrated more substantial improvement. Statistical analysis of the motor test results further confirmed that by the fourth week, the CLE group had achieved greater recovery of motor function than the other treatment groups and the SCI group ( Figure 3 (b)). In summary, the results of this study reveal for the first time that the enrichment of exosomes with CBL improves motor performance in a mouse SCI mouse model by reducing apoptosis, inflammation, lesion site size, and tissue disorganization. Figure 8 shows the critical signaling pathways involved in apoptosis and inflammation in SCI, highlighting the effects of exosome and CBL treatments. Figure 8. Open in a new tab Key Signaling Pathways in SCI. This illustration highlights the pivotal roles of Bax, Bcl2, TNF-α, and IL-10 in regulating apoptosis and inflammation. The findings also show the impact of exosome and CBL treatments in mitigating these processes, underscoring their relevance in this study. Despite its promising findings, this study has some limitations that must be considered when translating results from animal models to clinical applications. The small sample size may impact generalizability, necessitating larger studies for validation. While the effects of CLE on apoptosis and inflammation were demonstrated, the precise molecular mechanisms remain unclear and require further investigation. Additionally, the study did not assess the long-term effects on functional recovery, emphasizing the need for extended follow-up studies. Lastly, differences between rodent and human spinal cord physiology must be taken into account, highlighting the importance of studies using larger animal models or human-derived cells to better understand the potential for clinical translation of CLE. Conclusion In conclusion, this study demonstrated that exosomes loaded with CBL play a significant role in decreasing inflammation and apoptosis and reducing tissue disorganization in a mouse model of SCI. These effects collectively contribute to enhancing motor function recovery. The findings highlight the therapeutic potential of exosome-based delivery of CBL, which shows promise in mitigating the detrimental effects of SCI by addressing key pathological processes such as inflammatory responses and cell death pathways. This approach has implications for advancing treatment strategies aimed at promoting neuroprotection and functional recovery in SCI patients. Acknowledgements The authors of this work would like to thank all the colleagues. Notably, this study received funding from the Stem Cell Research Center, Tabriz University of Medical Sciences, Tabriz, Iran. Funding Statement This research was supported by a grant from Tabriz University of Medical Sciences [grant number 67070]. List of abbreviations Bax Bcl-2-Associated X Protein BDNF Brain-Derived Neurotrophic Factor Bcl2 B-cell Lymphoma 2 BBB Basso-Beattie-Bresnahan (Locomotor Scale) BSCB Blood-Spinal Cord Barrier CBL Cerebrolysin CLE Cerebrolysin-Loaded Exosomes CNTF Ciliary Neurotrophic Factor CNS Central Nervous System DiI 1,1′-Dioctadecyl-3,3,3′,3′-Tetramethylindocarbocyanine Perchlorate DLS Dynamic Light Scattering ELISA Enzyme-Linked Immunosorbent Assay Exo Exosome GDNF Glial Cell Line-Derived Neurotrophic Factor H&E Hematoxylin & Eosin IL-10 Interleukin-10 IP Intraperitoneal IV Intravenous JAK/STAT Janus Kinase / Signal Transducer and Activator of Transcription Pathway NGF Nerve Growth Factor NT-3 Neurotrophin-3 PBS Phosphate-Buffered Saline PCR Polymerase Chain Reaction PRP Platelet-Rich Plasma SCI Spinal Cord Injury SEM Scanning Electron Microscopy TNF-α Tumor Necrosis Factor Alpha Disclaimer statements Contributors Abbas Ebrahimi-Kalan and Zeinab Aliyari-Serej designed the original study. Naeimeh Akbari-Gharalari conducted the data analyses reported in this manuscript. Maryam Ghahremani-Nasab contributed to the histological assessment, Hamid Soltani Zangbar participated in animal modeling, Yahya Yahyavi handled the drug preparation, and Farshad Nezhadshahmohammad created the illustrations using Corel software. All authors have approved the final manuscript. Data availability The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request. Ethics approval This study was conducted in accordance with the principles of the Declaration of Helsinki and was approved by the Ethics Committee of Tabriz University of Medical Sciences, Tabriz, Iran (Ethics Registration No. IR.TBZMED.VCR.REC.1399.471). Conflicts of interest No potential conflict of interest was reported by the author(s). References 1. Khorasanizadeh M, Yousefifard M, Eskian M, et al. Neurological recovery following traumatic spinal cord injury: a systematic review and meta-analysis. J Neurosurg Spine. 2019;30(5):683–699. [ DOI ] [ PubMed ] [ Google Scholar ] 2. Htwe O, Hussain RI, Naicker AS.. Challenges in managing severe lower limb spasticity associated with bilateral hip joints subluxation. Eur J Gen Med. 2016;13(2):165–167. [ Google Scholar ] 3. O’Shea TM, Burda JE, Sofroniew MV.. Cell biology of spinal cord injury and repair. J Clin Investig. 2017;127(9):3259–3270. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 4. Katoh H, Yokota K, Fehlings MG.. Regeneration of spinal cord connectivity through stem cell transplantation and biomaterial scaffolds. Front Cell Neurosci. 2019;13:248. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 5. Akbari-Gharalari N, Ghahremani-Nasab M, Naderi R, et al. Improvement of spinal cord injury symptoms by targeting the Bax/Bcl2 pathway and modulating TNF-α/IL-10 using Platelet-Rich Plasma exosomes loaded with dexamethasone. AIMS Neurosci. 2023;10(4):332–353. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 6. Dimitrijevic MR, Danner SM, Mayr W.. Neurocontrol of movement in humans with spinal cord injury. Artif Org. 2015;39(10):823–833. [ DOI ] [ PubMed ] [ Google Scholar ] 7. Turtle JD, Henwood MK, Strain MM, et al. Engaging pain fibers after a spinal cord injury fosters hemorrhage and expands the area of secondary injury. Exp Neurol. 2019;311:115–124. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 8. Omrani M, Beyrampour-Basmenj H, Jahanban-Esfahlan R, et al. Global trend in exosome isolation and application: an update concept in management of diseases. Mol Cell Biochem. 2024;479:679–691. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 9. Zhang X, Jiang W, Lu Y, et al. Exosomes combined with biomaterials in the treatment of spinal cord injury. Front Bioeng Biotechnol. 2023;11:1077825. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 10. Akbari-Gharalari N, Ghahremani-Nasab M, Naderi R, et al. The potential of exosomal biomarkers: Revolutionizing Parkinson’s disease: how do they influence pathogenesis, diagnosis, and therapeutic strategies? AIMS Neurosci. 2024;11(3):374–397. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 11. Akbari-Gharalari N, Khodakarimi S, Nezhadshahmohammad F, et al. Exosomes in neuron-glia communication: A review on neurodegeneration. Bioimpacts. 2024;14(5):30153–30153. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 12. Hellenbrand DJ, Reichl KA, Travis BJ, et al. Sustained interleukin-10 delivery reduces inflammation and improves motor function after spinal cord injury. J Neuroinflamm. 2019;16(1):1–19. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 13. Huang J-H, Yin X-M, Xu Y, et al. Systemic administration of exosomes released from mesenchymal stromal cells attenuates apoptosis, inflammation, and promotes angiogenesis after spinal cord injury in rats. J Neurotrauma. 2017;34(24):3388–3396. [ DOI ] [ PubMed ] [ Google Scholar ] 14. Ren Z, Qi Y, Sun S, et al. Mesenchymal stem cell-derived exosomes: Hope for spinal cord injury repair. Stem Cells Develop. 2020;29(23):1467–1478. [ DOI ] [ PubMed ] [ Google Scholar ] 15. Irmak G, Demirtaş TT, Gümüşderelioğlu M.. Sustained release of growth factors from photoactivated platelet rich plasma (PRP). Eur J Pharm Biopharmaceut. 2020;148:67–76. [ DOI ] [ PubMed ] [ Google Scholar ] 16. Muheremu A, Shu L, Liang J, et al. Sustained delivery of neurotrophic factors to treat spinal cord injury. Transl Neurosci. 2021;12(1):494–511. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 17. Han Q, Xu X-M.. Neurotrophin-3-mediated locomotor recovery: A novel therapeutic strategy targeting lumbar neural circuitry after spinal cord injury. Neural Regener Res. 2020;15(12):2241–2242. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 18. Harvey AR, Lovett SJ, Majda BT, et al. Neurotrophic factors for spinal cord repair: Which, where, how and when to apply, and for what period of time? Brain Res. 2015;1619:36–71. [ DOI ] [ PubMed ] [ Google Scholar ] 19. Sahib S, Sharma A, Menon PK, et al. Cerebrolysin enhances spinal cord conduction and reduces blood-spinal cord barrier breakdown, edema formation, immediate early gene expression and cord pathology after injury. Progr Brain Res. 2020;258:397–438. [ DOI ] [ PubMed ] [ Google Scholar ] 20. Martínez-Torres NI, Cárdenas-Bedoya J, Torres-Mendoza BM.. Cerebrolysin induces motor recovery along with plastic changes in motoneurons and an increase in GAP43 protein in the ventral spinal cord following a kainic acid excitotoxic lesion in the rat motor cortex. Neurochem Res. 2025;50(1):31. [ DOI ] [ PubMed ] [ Google Scholar ] 21. Martínez-Torres NI, Cárdenas-Bedoya J, Torres Mendoza BM. The neurotrophic effect of cerebrolysin promotes plastic changes in spinal cord motoneurons after motor cortex lesion. Available at SSRN 4601662. 22. Fouad S, Elfarrash S, Rizk A, et al. Cerebrolysin recovers diaphragmatic function and reduces injury-associated astrogliosis following a cervical spinal cord hemi-section injury in rats. Egypt J Neurol Psychiatry Neurosurg. 2023;59(1):116. [ Google Scholar ] 23. Sharma S, Ali S, Patnaik R, et al. Cerebrolysin attenuates heat shock protein (HSP 72 KD) expression in the rat spinal cord following morphine dependence and withdrawal: possible new therapy for pain management. Curr Neuropharmacol. 2011;9(1):223–235. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 24. Zhang Y, Bi J, Huang J, et al. Exosome: A review of its classification, isolation techniques, storage, diagnostic and targeted therapy applications. Int J Nanomed. 2020;15:6917–6934. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 25. Wan Y, Wang L, Zhu C, et al. Aptamer-conjugated extracellular nanovesicles for targeted drug delivery. Cancer Res. 2018 Feb 1;78(3):798–808. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 26. Salmanipour S, Rezaie A, Alipour N, et al. Development of polyphosphate/nanokaolin-modified alginate sponge by gas-foaming and plasma glow discharge methods for ultrarapid hemostasis in noncompressible bleeding. ACS Appl Mater Interfaces. 2024;16(27):34684–34704. [ DOI ] [ PubMed ] [ Google Scholar ] 27. Abolhasanpour N, Eidi A, Hajebrahimi S, et al. Effect of cerebrolysin on bladder function after spinal cord injury in female Wistar rats. Int J Urol. 2019;26(9):917–923. [ DOI ] [ PubMed ] [ Google Scholar ] 28. Basso DM, Beattie MS, Bresnahan JC.. A sensitive and reliable locomotor rating scale for open field testing in rats. J Neurotrauma. 1995;12(1):1–21. [ DOI ] [ PubMed ] [ Google Scholar ] 29. Zhao J, Li Y, Jia R, et al. Mesenchymal stem cells-derived exosomes as dexamethasone delivery vehicles for autoimmune hepatitis therapy. Front Bioeng Biotechnol. 2021;9:650376. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 30. Pang Q-M, Qian N-N, Zou W-H, et al. PBMSCs transplantation facilitates functional recovery after spinal cord injury by regulating microglia/macrophages plasticity. Transpl Immunol. 2022;72:101592. [ DOI ] [ PubMed ] [ Google Scholar ] 31. He X, Li Y, Deng B, et al. The PI3K/AKT signalling pathway in inflammation, cell death and glial scar formation after traumatic spinal cord injury: Mechanisms and therapeutic opportunities. Cell Prolifer. 2022;55(9):e13275. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 32. Xu K, Feng H, Zhao R, et al. Targeting tetraspanins at cell interfaces: functional modulation and exosome-based drug delivery for precise disease treatment. ChemMedChem. 2025;20(2):e202400664. [ DOI ] [ PubMed ] [ Google Scholar ] 33. Li X, Liu Z, Xu S, et al. A drug delivery system constructed by a fusion peptide capturing exosomes targets to titanium implants accurately resulting the enhancement of osseointegration peri-implant. Biomater Res. 2022;26(1):89. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 34. Xiao G, Xu Z, Luo F.. Combinational antitumor strategies of exosomes as drug carriers: Mini review. Front Pharmacol. 2023;13:1107329. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 35. Poon W, Matula C, Vos PE, et al. Safety and efficacy of Cerebrolysin in acute brain injury and neurorecovery: CAPTAIN I – a randomized, placebo-controlled, double-blind, Asian-Pacific trial. Neurol Sci. 2020;41(2):281–293. [ DOI ] [ PubMed ] [ Google Scholar ] 36. Wang J, Zheng Y, Zhao M.. Exosome-based cancer therapy: Implication for targeting cancer stem cells. Front Pharmacol. 2017;7:533. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Articles from The Journal of Spinal Cord Medicine are provided here courtesy of Taylor & Francis ACTIONS View on publisher site PDF (1.6 MB) Cite Collections Permalink RESOURCES Similar articles Cited by other articles Links to NCBI Databases Follow NCBI NCBI on X (formerly known as Twitter) NCBI on Facebook NCBI on LinkedIn NCBI on GitHub NCBI RSS feed Connect with NLM NLM on X (formerly known as Twitter) NLM on Facebook NLM on YouTube National Library of Medicine 8600 Rockville Pike Bethesda, MD 20894 Web Policies FOIA HHS Vulnerability Disclosure Help Accessibility Careers NLM NIH HHS USA.gov Back to Top

Related documents

• Emerging strategies for spinal cord injury repair: stem cells, extracellular vesicles, biomaterials, and neuromodulation.#415530
• First-in-Human Clinical Trial of STUP-001, an In Vivo Direct Cell Conversion Gene Therapy for AIS-A/B Chronic Spinal Cord Injury#881474
• A Phase 2, Single Arm Multicenter, Study Testing Mezigdomide, Carfilzomib, and Dexamethasone (480Kd) in Participants With Relapsed or Refractory Multiple Myeloma (RRMM)#1127315
• Identification and Experimental Validation of Biomarkers Associated with PI3K/AKT Signaling Pathway in Spinal Cord Injury.#122786
• The Effect of Diet on Chronic Inflammation and Related Disorders Following Spinal Cord Injury#1161483