Acupuncture at “Baihui” and “Xuanli” attenuates intracerebral hemorrhage-induced brain injury by modulating autophagy and the PI3K/AKT signaling pathway in rats - PMC Skip to main content An official website of the United States government Here's how you know Here's how you know Official websites use .gov A .gov website belongs to an official government organization in the United States. Secure .gov websites use HTTPS A lock ( Lock Locked padlock icon ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites. Search Log in Dashboard Publications Account settings Log out Search… Search NCBI Primary site navigation Search Logged in as: Dashboard Publications Account settings Log in Search PMC Full-Text Archive Search in PMC Journal List User Guide PERMALINK Copy As a library, NLM provides access to scientific literature. Inclusion in an NLM database does not imply endorsement of, or agreement with, the contents by NLM or the National Institutes of Health. Learn more: PMC Disclaimer | PMC Copyright Notice Am J Transl Res . 2026 Mar 15;18(3):1945–1958. doi: 10.62347/UGGC9616 Search in PMC Search in PubMed View in NLM Catalog Add to search Acupuncture at “Baihui” and “Xuanli” attenuates intracerebral hemorrhage-induced brain injury by modulating autophagy and the PI3K/AKT signaling pathway in rats Dejiang Ji Dejiang Ji 1 Department of Acupuncture and Moxibustion, Ningxia Hui Autonomous Region Hospital of Traditional Chinese Medicine, Ningxia Hui Autonomous Region Academy of Traditional Chinese Medicine, Ningxia Medical University Affiliated Autonomous Region Hospital of Traditional Chinese Medicine, Yinchuan 750021, Ningxia Hui Autonomous Region, China Find articles by Dejiang Ji 1, * , Dan Yang Dan Yang 2 School of Pharmacy, Ningxia Medical University, Yinchuan 750004, Ningxia Hui Autonomous Region, China Find articles by Dan Yang 2, * , Yahong Feng Yahong Feng 3 Department of Gynecology, Ningxia Hui Autonomous Region Hospital of Traditional Chinese Medicine, Ningxia Hui Autonomous Region Academy of Traditional Chinese Medicine, Ningxia Medical University Affiliated Autonomous Region Hospital of Traditional Chinese Medicine, Yinchuan 750021, Ningxia Hui Autonomous Region, China Find articles by Yahong Feng 3 , Xiaojing Zhang Xiaojing Zhang 3 Department of Gynecology, Ningxia Hui Autonomous Region Hospital of Traditional Chinese Medicine, Ningxia Hui Autonomous Region Academy of Traditional Chinese Medicine, Ningxia Medical University Affiliated Autonomous Region Hospital of Traditional Chinese Medicine, Yinchuan 750021, Ningxia Hui Autonomous Region, China Find articles by Xiaojing Zhang 3 , Gaxi Ye Gaxi Ye 1 Department of Acupuncture and Moxibustion, Ningxia Hui Autonomous Region Hospital of Traditional Chinese Medicine, Ningxia Hui Autonomous Region Academy of Traditional Chinese Medicine, Ningxia Medical University Affiliated Autonomous Region Hospital of Traditional Chinese Medicine, Yinchuan 750021, Ningxia Hui Autonomous Region, China Find articles by Gaxi Ye 1 Author information Article notes Copyright and License information 1 Department of Acupuncture and Moxibustion, Ningxia Hui Autonomous Region Hospital of Traditional Chinese Medicine, Ningxia Hui Autonomous Region Academy of Traditional Chinese Medicine, Ningxia Medical University Affiliated Autonomous Region Hospital of Traditional Chinese Medicine, Yinchuan 750021, Ningxia Hui Autonomous Region, China 2 School of Pharmacy, Ningxia Medical University, Yinchuan 750004, Ningxia Hui Autonomous Region, China 3 Department of Gynecology, Ningxia Hui Autonomous Region Hospital of Traditional Chinese Medicine, Ningxia Hui Autonomous Region Academy of Traditional Chinese Medicine, Ningxia Medical University Affiliated Autonomous Region Hospital of Traditional Chinese Medicine, Yinchuan 750021, Ningxia Hui Autonomous Region, China ✉ Address correspondence to: Xiaojing Zhang, Department of Gynecology, Ningxia Hui Autonomous Region Hospital of Traditional Chinese Medicine, Ningxia Hui Autonomous Region Academy of Traditional Chinese Medicine, Ningxia Medical University Affiliated Autonomous Region Hospital of Traditional Chinese Medicine, 114 Beijing West Road, Xixia District, Yinchuan 750021, Ningxia Hui Autonomous Region, China. E-mail: [email protected] ; Gaxi Ye, Department of Acupuncture and Moxibustion, Ningxia Hui Autonomous Region Hospital of Traditional Chinese Medicine, Ningxia Hui Autonomous Region Academy of Traditional Chinese Medicine, Ningxia Medical University Affiliated Autonomous Region Hospital of Traditional Chinese Medicine, 114 Beijing West Road, Xixia District, Yinchuan 750021, Ningxia Hui Autonomous Region, China. E-mail: [email protected] * Equal contributors and co-first authors. Received 2025 Dec 10; Accepted 2026 Feb 5; Collection date 2026. AJTR Copyright © 2026 PMC Copyright notice PMCID: PMC13090930 PMID: 42007091 Abstract Objective: To investigate the neuroprotective effects of acupuncture at the “Baihui” and “Xuanli” acupoints on rats with intracerebral hemorrhage (ICH). Methods: An ICH rat model was established. For the 3-MA group, the autophagy inhibitor 3-MA (400 nM) was injected into the lateral ventricle 15 min before ICH induction. Histopathologic changes were observed, and expressions of autophagy-related proteins and inflammatory cytokines in hippocampal tissues were measured. Additionally, neuronal apoptosis, oxidative stress markers, and PI3K/AKT pathway-related protein expression were assessed. Results: Compared to the sham group, the model group exhibited increased levels of Beclin-1, ATG5, and pro-inflammatory cytokines in the hippocampus, along with enhanced neuronal apoptosis and oxidative stress, as well as downregulated phosphorylation of PI3K and AKT. Compared to the model group, the acupuncture group showed further upregulation of Beclin-1 and ATG5, reduced levels of pro-inflammatory cytokines, alleviated neuronal apoptosis and oxidative stress, and increased phosphorylation of PI3K and AKT. Compared to the acupuncture group, the 3-MA group displayed loss of hippocampal structural integrity, decreased expression of Beclin-1 and ATG5, elevated pro-inflammatory cytokine levels, exacerbated apoptosis and oxidative stress, and suppressed PI3K signaling activity. In contrast to the 3-MA group, the 3-MA + acupuncture group, the rapamycin group, and the rapamycin + acupuncture group all demonstrated protective effects, including attenuated neuronal injury. Conclusion: Acupuncture at the “Baihui” and “Xuanli” acupoints significantly alleviated inflammation, apoptosis, and oxidative stress in the hippocampal tissue of ICH rats. This effect was associated with concurrent upregulation of autophagy markers (Beclin-1, ATG5) and activation of the PI3K/AKT signaling pathway. However, given the pleiotropic actions of the pharmacological agents used, the precise mechanistic relationship between PI3K/AKT signaling and autophagy remains correlative. Our findings suggest that functional autophagy is essential for acupuncture’s neuroprotective effects, and that its therapeutic benefit may arise from coordinated modulation of the PI3K/AKT/mTOR/autophagy network rather than a simple linear cascade. Keywords: Intracerebral hemorrhage, acupuncture, the PI3K/AKT pathway, autophagy Introduction Intracerebral hemorrhage (ICH) is a severe acute non-traumatic bleeding within the brain. The prevalence of ICH has increased in recent years, accounting for 18.8%-47.6% of all strokes, and is associated with high disability and mortality rates [ 1 , 2 ]. Neuronal injury after ICH is primarily caused by hematoma occupation and secondary ischemia. Although surgical hematoma evacuation is the preferred method to achieve hemostasis and relieve intracranial pressure, early surgical hematoma evacuation does not consistently improve clinical outcomes. Therefore, elucidating the internal pathogenesis of ICH and identifying effective therapeutic strategies are essential for reducing its morbidity and mortality. Traditional Chinese medicine (TCM) believes that ICH belongs to the category of “stroke” based on its etiology, pathogenesis, and clinical manifestations. It is manifested mainly as sudden loss of consciousness, facial deviation, tongue rigidity, and hemiplegia or partial paralysis. Acupuncture is one of the main therapies for treating stroke in TCM. Baihui (DU20), located at the vertex of the head, is the meeting point of all yang meridians and a principal acupoint of apoplexy, with effects of uplifting yang and restoring consciousness. Xuanli (GB6), located at the intersection of the anterior oblique line of parietal and temporal, is commonly used to improve facial motor dysfunction, motor aphasia, and peripheral facial paralysis [ 3 ]. Studies have shown that a series of cellular biological processes such as immune inflammation, apoptosis activation, and oxidative stress in surrounding tissues are critical contributors to secondary brain injury after ICH [ 4 , 5 ]. Autophagy has been shown to be activated in perihematoma tissue as early as 6 h after ICH, peaking at 24-72 h, declining after day 3, and exhibiting marked aggregation of autophagic vesicles in neurons by day 7 [ 6 ]. The activation of autophagy is considered a self-protective mechanism of cells to eliminate damaged organelles and harmful cytoplasmic components [ 7 ]. The PI3K/AKT signaling pathway can regulate various biological processes, including macrophage autophagy and inflammatory suppression, and plays a key regulatory role in autophagy [ 8 , 9 ]. Mammalian Beclin-1 interacts with PI3K/AKT to promote PI3K synthesis, thereby promoting lipid membrane extension, cargo recruitment, and autophagosome maturation [ 10 , 11 ]. In addition, inflammation represents a fundamental response of brain tissue to stimulation. Following ICH, multiple stimuli activate inflammatory cells, promoting their release of inflammatory mediators, among which TNF-α can induce brain edema and participate in ICH progression [ 12 ]. Although acupuncture at Baihui or Baihui-penetrating-Qubin has been reported to alleviate brain injury after ICH through anti-inflammatory and anti-apoptotic mechanisms, the optimal acupoint combination for regulating the PI3K/AKT/autophagy axis remains unclear. Xuanli, located along the Gallbladder Meridian and adjacent to Baihui, is a key acupoint for treating post-stroke motor dysfunction, facial paralysis, and cognitive impairment-symptoms commonly observed in ICH patients. The penetrating needling technique from Baihui to Xuanli simultaneously stimulates the Governor Vessel (Du Mai) and Gallbladder Meridian, which is clinically preferred for severe stroke syndromes. However, its effects have rarely been investigated in preclinical ICH models. Moreover, whether this acupuncture paradigm exerts specific regulatory effects on the PI3K/AKT/autophagy signaling cascade, and whether its neuroprotective efficacy depends on functional autophagy, have not been systematically addressed. Therefore, this study specifically aims to: (1) determine whether Baihui-penetrating-Xuanli acupuncture improves neurological outcomes in rat model of ICH; (2) investigate its effects on inflammation, apoptosis, oxidative stress, and the PI3K/AKT/autophagy pathway; and (3) evaluate whether its therapeutic effects are dependent on autophagy using pharmacologic modulators (3-MA and rapamycin). Our findings may provide support for this clinically relevant acupuncture protocol and clarify the role of autophagy in its neuroprotective effects. Materials and methods Reagents The Beclin-1 antibody (rabbit monoclonal, Cat. No. 00080987, 1:1500), ATG5 antibody (rabbit polyclonal, Cat. No. 10008350, 1:1000), AKT antibody (serine/threonine kinase, rabbit monoclonal, Cat. No. 34d5362/4, 1:1000), p-AKT antibody (Cat. No. 3600001545, 1:800), PI3K antibody (Cat. No. M14JL5P, 1:1000), p-PI3K antibody (Cat. No. 3K58815, 1:500), IL-1β antibody (Cat. No. 66009-1-Ig, Chengdu Zhengneng Biotechnology Co., LTD., 1:2000) and β-actin (Wuhan Sanying Biotechnology Co., LTD., Cat. No. 10029187, 1:3000) were utilized in this study. Additionally, Horseradish peroxidase (HRP)-conjugated secondary antibody (goat anti-rabbit IgG; Wuhan Sanying Biotechnology Co., LTD., Cat. No. 20001286/20001272, 1:3000) was employed. The autophagy agonist rapamycin (Cat. No. HY-10219) was purchased from MedChemExpress (MCE) Reagent Company. Main instruments The main instruments used in this study included a three-dimensional brain injection instrument (Rivold, H1829401-002), an ultrapure water machine (Sichuan Youpu, UPT-1-10T), a tissue embedding system (Wuhan Junjie, JB-P5), a tissue microtome (Leica, Germany, LEICARM22445), a slide scanning instrument (AperiodLV1, Leica, Germany), an ultramicro spectrophotometer (Beijing Kaiao Technology Development Co., Ltd., K5800), a vertical electrophoresis instrument (Wicks Technology (Beijing) Co., Ltd., WIX-EP300), a protein transfer membrane system (Beijing Wicks, WIX-EP300), a chemiluminescent detector (Azure, C300, USA), a horizontal decolorizing shaker (Qilimbel instrument in Haimen City), and an adjustable mixing instrument (Dalong Xingchuang Laboratory Instruments (Beijing) Co., Ltd., D1008). Disposable acupuncture needles (Huatuo brand, model: 0.25 mm × 40 mm) were used for acupuncture treatment. Animals Twenty-three SPF-grade healthy male Sprague-Dawley (SD) rats, aged 8-12weeks, weighing 300-310 g, were purchased from Beijing Huafukang Biotechnology Co., Ltd. (Certificate No.: SCXK[Bing]2019-0008). All rats were raised in an SPF environment with a temperature of 20-26°C and a humidity of 40%-70%°C, under a standard light-dark cycle, with free access to food and water. To minimize animal suffering during and after surgery, perioperative analgesia was administered by subcutaneous injection of buprenorphine (0.05 mg/kg) immediately after ICH induction and every 12 h for the first 24 h if needed. Rats were kept on a warming pad until fully recovered from anesthesia, provided with soft food and easy access to water, and monitored twice daily for signs of distress (e.g., lethargy, inability to reach food/water, > 20% body weight loss). Rats showing severe neurological deficits or moribund status were humanely euthanized according to predefined humane endpoints approved by the ethics committee. At the end of the experiment, rats were euthanized by intraperitoneal injection of an overdose of sodium pentobarbital (150 mg/kg). Death was confirmed by the absence of spontaneous breathing for more than 1 minute, loss of a corneal reflex, and cessation of heartbeat as assessed by palpation. All experimental procedures were approved by the Scientific Research Ethics Committee of Ningxia Hui Autonomous Region Hospital of Traditional Chinese Medicine (approval number: 2022-69). Experimental design A total of 23 rats were used in this study, with 3 randomly assigned to the sham group and the remaining 20 subjected to ICH modeling. Of these, 18 rats (90.0%) met the inclusion criteria for successful model establishment (defined as presence of hematoma in the caudate nucleus confirmed by gross inspection or histology, and baseline neurological deficit score ≥ 2 at 24 h post-surgery). The overall mortality rate was 10.0% (2/20), with one death each in the model group and the 3-MA group. The 18 successfully modeled rats were randomly divided into six groups: model group, acupuncture group, 3-MA group, 3-MA + acupuncture group, rapamycin group, and rapamycin + acupuncture group. Sham operation group: Only surgical procedures were performed without other intervention. Model group: The ICH model was established according to the rat stereotaxic atlas [ 13 ] and the modified autologous blood injection method [ 14 ]. The rats were anesthetized and fixed on a stereotaxic instrument using ear rods, with the skull adjusted to the horizontal level. A longitudinal incision of about 2 cm was made along the midline of the rat head, the periosteum was removed using 3% hydrogen peroxide solution, and the bregma and lambda were fully exposed. Subsequently, ICH was induced by injecting arterial blood into the caudate nucleus. After injection, the needle was retained in place for 10 minutes followed by layered wound closure. Model + acupuncture group: On the basis of ICH modeling, acupuncture intervention (Baihui and Xuanli on the affected side, penetration depth: 1.5 cm) was initiated on the second day after operation. Baihui and Xuanli points on the affected side were selected according to the Atlas of Acupoints of Experimental Animals [ 15 ]. The depth of the needle insertion was 0.8 inches. The needle was manually twisted for 5 min and retained for 30 min. 3-MA group: The autophagy inhibitor 3-MA (400 nM) was injected into the lateral ventricle 15 min before ICH induction. 3-MA + acupuncture group: In addition to 3-MA treatment, rats received the same acupuncture intervention as that of the acupuncture group. Rapamycin group: Rapamycin (0.8 ng) was injected into lateral ventricle 15 min before ICH induction. Rapamycin + acupuncture group: Acupuncture intervention consistent with the acupuncture group was applied on the basis of rapamycin pretreatment. Pathologic histology staining H&E staining: After brain tissue collection, samples were immediately fixed in 4% paraformaldehyde for 24 h, followed by dehydration, paraffin embedding, and sectioning in sequence. Sections were stained with hematoxylin solution for 10 min, then rinsed under running water for 3 min. Differentiation was performed using 1% hydrochloric acid-ethanol for 30 s, followed by rinsing with running water for 1 minute. Sections were then counterstained with eosin solution for 1 min, rinsed with running water for 1 minute, and then rinsed twice with 95% ethanol (3 s each), dehydrated with 100% ethanol three times (2 min each), and cleared sequentially in xylene I for 10 min and xylene II for 5 min. After natural drying, the slices were sealed with neutral gum and images were collected. Nissl staining: After deparaffinization, the sections were rinsed with distilled water and then incubated with Nissl staining solution at 50-60°C for 20-40 min, followed by gentle rinsing with distilled water. Then, 95% ethanol was used for rapid differentiation, followed by dehydration with absolute ethanol and clearing with xylene. Finally, sections were mounted with neutral gum for microscopic observation. Immunohistochemical staining: Paraffin sections were dewaxed and rehydrated, then subjected to antigen retrieval in 0.1 mol/L citric acid solution. After antigen retrieval, sections were washed with PBS three times to remove endogenous enzyme. Sections were blocked with blocking solution for 1 h, followed by incubation with antibodies against Beclin-1, ATG5, IL-1β, and TNF-α overnight at 4°C. After washing with PBS, sections were incubated with secondary antibodies at room temperature. Immunoreactivity was visualized using a DAB chromogenic solution. Sections were then dehydrated through gradient ethanol, cleared with xylene, mounted with neutral gum, and examined under a light microscope. RT-qPCR Total RNA was extracted from brain tissues using TRIzol regent, and RNA concentration and purity were assessed spectrophotometrically. Reverse transcription was performed using a cDNA kit (Cat. No. RR037A, Takara Bio, Japan) with total RNA (1 μg) under the following conditions: 42°C for 60 min and 70°C for 5 min. The synthesized cDNA was stored at 4°C until further use. All experiments were repeated 3 times, with β-actin as internal reference, and the relative fold change of mRNA expression was calculated using 2 -ΔΔCt method. Genes and primers were synthesized by Shaanxi Qingke Biotechnology Co., Ltd., and primer sequences are shown in Table 1 . Table 1. Sequences of primers for RT-qPCR Gene Upstream primer (5’-3’) Downstream primer (5’-3’) Beclin-1 ATGAGGGCGACAGTGAACAG CTGGATCAGCCTCTCCTCCT ATG5 CACCCCTGAAATGGCATTATCC TGGACAGTGTAGAAGGTCCTTT TNF-α GTGATCGGTCCCAACAAGGA CTTGGTGGTTTGCTACGACG IL-1β ACAGAACATAAGCCAACAAG ACACAGGACAGGTATAGATTC β-actin CCAATTGAACACGGCATTG ACGCAGCTCATTGTAGAA Open in a new tab ELISA IL-1β and TNF-α levels were quantified using commercial ELISA kits (MultiSciences Biotech Co., Ltd., China). All procedures were performed strictly according to the instructions of the reagent kit. Absorbance was measured at 450 nm using a microplate reader, and cytokine concentrations were calculated based on the corresponding standard curves. Western blotting Brain tissues were lysed under the protection of liquid nitrogen and centrifuged at 12,000 r/min for 15 min at 4°C. The supernatants were collected, and protein concentrations were determined using the BCA method. Equal amounts of protein were separated by 10% SDS-PAGE and transferred onto polyvinylidene difluoride (PVDF) membranes. After blocking, membranes were incubated with primary antibodies overnight at 4°C, followed by incubation with corresponding secondary antibodies at room temperature. Protein bands were visualized using an enhanced chemiluminescence (ECL) detection kit and imaged with a chemiluminescent detector (Azure C300, USA). Band intensities were quantified using ImageJ software (NIH, USA). For each target protein, the optical density of the band was normalized to that of β-actin in the same sample to correct for loading variations. The relative expression level was expressed as the ratio of target protein/β-actin. Statistical analysis All statistical analyses were reviewed and verified by a biostatistician. Data from at least three independent experiments were presented as mean ± SD. Normality and homogeneity of variances were confirmed prior to parametric testing. Comparisons between the two groups were analyzed using the t-test. For the comparison of multiple groups, one-way ANOVA followed by Tukey’s post hoc test was applied. A p value of < 0.05 indicated statistical significance. Results Acupuncture treatment alleviated inflammatory injury in hippocampal neurons of rats As shown in Figure 1 , hippocampal neurons in the sham group exhibited normal morphology, showing round or oval with regular arrangement. No inflammatory cell infiltration or microglial accumulation was observed in the hippocampus. However, the model groups demonstrated marked inflammatory cell infiltration and evident neuronal swelling, accompanied by disordered cellular arrangement. Figure 1. Open in a new tab H&E staining of hippocampal neurons in rats. (a) sham group (b) model group (c) acupuncture group (d) 3-MA group (e) 3-MA + acupuncture group (f) rapamycin group (g) rapamycin + acupuncture group. Scale bars: 100 μm (low magnification) and 20 μm (high magnification). 1) P < 0.05, compared to the sham group; 2) P < 0.05, compared to the model group; 3) P < 0.05, compared to the acupuncture group; 4) P < 0.05, compared to the 3-MA group. Compared to the model group, the acupuncture group showed alleviated inflammatory cell infiltration and neuronal swelling. Neuronal morphology was relatively preserved. In contrast, the 3-MA group exhibited increased microglial cell accumulation, severe cellular disorganization, and prominent nuclear membrane damage when compared to the acupuncture group. Compared to the 3-MA group, the 3-MA + acupuncture group, rapamycin group and rapamycin + acupuncture group demonstrated varying degrees of attenuation of inflammatory cell infiltration and alleviation of neuronal injury, along with regular cell arrangement. Acupuncture treatment enhanced hippocampal neuronal integrity in rats As shown in Figure 2 , Nissl bodies in the brain tissues of rats in the sham group were clearly visible without significant reduction or disappearance. However, in the model group, the number of Nissl bodies significantly decreased, accompanied by neuronal shrinkage, nuclear condensation, and deeply stained cytoplasm. Figure 2. Open in a new tab Nissl staining of hippocampal neurons in rats. Representative images and quantification of surviving neurons (cells/mm2). (a) sham group (b) model group (c) acupuncture group (d) 3-MA group (e) 3-MA + acupuncture group (f) rapamycin group (g) rapamycin + acupuncture group. Scale bars: 100 μm (low magnification) and 20 μm (high magnification). 1) P < 0.05, compared tothe sham group; 2) P < 0.05, compared to the model group; 3) P < 0.05, compared to the acupuncture group; 4) P < 0.05, compared to the 3-MA group. Compared to the model group, Nissl bodies were notably preserved, appearing dense and with regularly arranged morphology in the acupuncture group. In contrast, Nissl bodies in the hippocampus of rats in the 3-MA group were markedly reduced or absent. Compared to the 3-MA group, the 3-MA + acupuncture group showed partial restoration of Nissl bodies. In the rapamycin group and rapamycin + acupuncture group, Nissl bodies were clearly visible and increased in number. Acupuncture treatment enhanced autophagy and attenuated the inflammatory response in hippocampal neurons of rats As shown in Figure 3A , strong positive expression of ATG5, Beclin-1, IL-1β, and TNF-α was observed in the hippocampus of rats in model group. Compared to the model group, the positive expression of ATG5 and Beclin-1 was further enhanced in the acupuncture group, while the positive signals of IL-1β and TNF-α were weakened. In the 3-MA group, hippocampal tissue structure was severely disrupted, and immunoreactive signals were markedly reduced. Compared to the model group, 3-MA treatment significantly reduced the expression levels of Beclin-1 and ATG5, indicating effective suppression of autophagy. In contrast, the 3-MA + acupuncture group, rapamycin group, and rapamycin + acupuncture group showed partial restoration or enhancement of ATG5 and Beclin-1 expression, together with attenuation of IL-1β and TNF-α immunoreactivity. Figure 3. Open in a new tab The levels of Beclin-1, ATG5, IL-1β and TNF-α in rat hippocampus and serum. A. Immunohistochemical staining images of autophagy related molecules in hippocampus. Scale bars = 100 μm. B-E. The mRNA expression of Beclin, ATG5, IL-1β and TNF-α in rat hippocampus. F-I. Secretion levels of Beclin, ATG5, IL-1β and TNF-α in rat serum. J-M. Protein expression of Beclin-1, ATG5, and IL-1β in the hippocampus. (a) sham group (b) model group (c) acupuncture group (d) 3-MA group (e) 3-MA + acupuncture group (f) rapamycin group (g) rapamycin + acupuncture group. 1) P < 0.05, compared to the sham group; 2) P < 0.05, compared to the model group; 3) P < 0.05, compared to the acupuncture group; 4) P < 0.05, compared to the 3-MA group. Consistent with the immunohistochemical findings, the mRNA expression ( Figure 3B-E ) and secretion levels ( Figure 3F-I ) of Beclin-1, ATG5, IL-1β, and TNF-α were significantly increased in the model group. Compared to the model group, acupuncture further increased the levels of Beclin-1 and ATG5 expression, while reducing IL-1β and TNF-α levels. In contrast, compared to the model group, the 3-MA group demonstrated decreased Beclin-1 and ATG5 levels, along with elevated IL-1β and TNF-α. Furthermore, compared to the 3-MA group, the 3-MA + acupuncture group, the rapamycin group, and the rapamycin + acupuncture group all exhibited increased Beclin-1 and ATG5 levels, accompanied by reduced IL-1β and TNF-α. These results were further supported by western blot analysis ( Figure 3J-M ). Acupuncture treatment attenuated apoptosis in the hippocampus of rats To evaluate hippocampal apoptosis, TUNEL staining was performed. The results revealed that the model group exhibited a higher number of TUNEL-positive cells ( Figure 4A ), elevated expression of cleaved caspase-3 ( Figure 4B ), upregulated pro-apoptotic factor Bax ( Figure 4C ), and downregulated anti-apoptotic factor Bcl-2 ( Figure 4D ). Compared to the the model group, the acupuncture group showed a marked reduction in apoptotic activity. Conversely, the 3-MA group displayed an increase in both apoptotic cell counts and pro-apoptotic protein expression compared to the acupuncture group. However, when compared to the 3-MA group, the 3-MA + acupuncture, rapamycin, and rapamycin + acupuncture groups all demonstrated attenuated apoptosis. Figure 4. Open in a new tab Apoptosis levels in rat hippocampus. A. TUNEL apoptosis staining. B. The protein expression of cleaved caspase-3. C, D. mRNA expression of Bax and Bcl-2. E. The ratio of Bcl-2/Bax: (a) sham group (b) model group (c) acupuncture group (d) 3-MA group (e) 3-MA + acupuncture group (f) rapamycin group (g) rapamycin + acupuncture group. 1) P < 0.05, compared to the sham group; 2) P < 0.05, compared to the model group; 3) P < 0.05, compared to the acupuncture group; 4) P < 0.05, compared to the 3-MA group. Our analysis showed that the Bcl-2/Bax ratio was significantly reduced in the model group, consistent with enhanced apoptotic signaling. In the acupuncture group, the Bcl-2/Bax ratio was markedly increased, reflecting suppressed apoptosis. Conversely, the 3-MA group exhibited a further decline in the Bcl-2/Bax ratio relative to the acupuncture group, whereas the 3-MA + acupuncture, rapamycin, and rapamycin + acupuncture groups all showed an elevated Bcl-2/Bax ratio ( Figure 4E ). Acupuncture treatment alleviated oxidative stress in the hippocampus of rats During the course of ICH, the accumulation of blood-derived components within the brain parenchyma triggers a cascade of oxidative stress-related reactions. In the model group, the enzymatic activities of superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GSH-PX) were markedly reduced, accompanied by elevated levels of hydrogen peroxide (H 2 O 2 ) and malondialdehyde (MDA), indicating pronounced oxidative stress in the hippocampus. Compared to the model group, the acupuncture group showed enhanced antioxidant activity, evidenced by enhanced SOD, CAT, and GSH-PX activities, along with reduced concentrations of H 2 O 2 and MDA. In contrast, the 3-MA group displayed further decreases in SOD, CAT, and GSH-PX activities and elevated H 2 O 2 ( Figure 5A-D ) and MDA levels ( Figure 5E ). Furthermore, compared to the 3-MA group, the 3-MA + acupuncture group, rapamycin group, and rapamycin + acupuncture groups all demonstrated improved antioxidant capacity and reduced oxidative stress. Figure 5. Open in a new tab Oxidative stress levels in rat hippocampus. A. Superoxide dismutase (SOD) activity. B. Catalase (CAT) activity. C. Glutathione peroxidase (GSH-PX) activity. D. Hydrogen peroxide (H 2 O 2 ) levels. E. Malondialdehyde (MDA) content. (a) sham group (b) model group (c) acupuncture group (d) 3-MA group (e) 3-MA + acupuncture group (f) rapamycin group (g) rapamycin + acupuncture group. 1) P < 0.05, compared to the sham group; 2) P < 0.05, compared to the model group; 3) P < 0.05, compared to the acupuncture group; 4) P < 0.05, compared to the3-MA group. Acupuncture treatment activated the PI3K-AKT pathway in the hippocampus of rats As shown in Figure 6A-E , phosphorylation levels of PI3K and AKT proteins were significantly reduced in the hippocampus of rats in the model group. Compared to the model group, acupuncture significantly increased the expression of p-AKT and p-PI3K proteins. These changes occurred in parallel with upregulation of autophagy markers. Figure 6. Open in a new tab Expression levels of autophagy and PI3K pathway proteins in rat hippocampus. A-E. Phosphorylation levels of PI3K and AKT. (a) sham group (b) model group (c) acupuncture group (d) 3-MA group (e) 3-MA + acupuncture group (f) rapamycin group (g) rapamycin + acupuncture group. 1) P < 0.05, compared to the sham group; 2) P < 0.05, compared to the model group; 3) P < 0.05, compared to the acupuncture group; 4) P < 0.05, compared to the 3-MA group. Compared to the acupuncture group, the phosphorylation levels of AKT and PI3K proteins were reduced in the 3-MA group; In addition, compared to the 3-MA group, the 3-MA + acupuncture group, rapamycin group, and rapamycin + acupuncture group all showed notable increases in p-AKT and p-PI3K levels ( Figure 6A-E ). Discussion It has reported that acupuncture and moxibustion can attenuate neuronal necrosis and delay neuronal damage in experimental models [ 16 ]. Acupuncture therapy, as an important therapeutic modality of TCM, has been widely used in clinical treatment of various post-ICH sequelae, and its efficacy has been widely recognized [ 17 ]. From the perspective of TCM theory, ICH is categorized as “stroke” with core pathogenesis characterized by disruption of qi and blood flow, obstruction of cerebral vessels, or extravasation of blood beyond the vessels. The “Baihui” acupoint is regarded as the “meeting point of all yang meridians” capable of lifting yang qi, restoring consciousness, and opening the orifices. The “Xuanli” acupoint is located in the temporal region, and is thought to regulate qi along the Shaoyang meridian and harmonize qi and blood. Stimulation of these two acupoints is traditionally considered to promote “unblocking of brain meridians, restoration of consciousness, and regulation of qi and blood”. From a modern medicine perspective, these acupoints are located in regions corresponding to cerebral areas supplied by major intracranial arteries. Acupuncture stimulation may improve local cerebral blood flow and regulate cerebrovascular tone and vasodilation functions, providing a favorable microenvironment for PI3K/AKT pathway activation and autophagy regulation [ 18 , 19 ]. This “meridian-anatomical-molecular” multi-level interaction highlights the unique value of exploring acupuncture mechanisms guided by TCM theory. However, the effectiveness and mechanism of acupuncture in treating ICH remain to be further elucidated. Previous studies had reported that acupuncture at the “Baihui” and “Qubin” can effectively inhibit M1 polarization of microglia, which is beneficial for alleviating ICH-induced brain tissue injury [ 20 , 21 ]. Liu Hao et al. showed that acupuncture intervention significantly downregulated IL-1β expression in brain tissue of ICH rats, which was associated with improved neurological deficit scores and enhanced neurological recovery [ 22 ]. In addition to its anti-inflammatory effects, evidence suggests that modulation of autophagy-related protein expression may also contribute to neuroprotection after ICH. Autophagy is a self-degradation process to maintain cellular homeostasis. Following ICH, autophagy is initiated and participates in endogenous neuroprotective responses by eliminating damaged organelles [ 23 ]. Consistent with this notion, previous studies had shown that acupuncture can upregulate Beclin-1 expression in the brain tissue of ICH rats [ 24 ]. While autophagy is generally considered neuroprotective in the early phase after ICH, its role is highly context-dependent. Excessive or dysregulated autophagy may contribute to autophagic cell death under severe stress. In the present study, all assessments were performed at 72 h post-ICH, a time window widely reported as the peak of adaptive autophagy. The observation that 3-MA (which reduced Beclin-1 and ATG5) exacerbated brain injury and inflammation, whereas rapamycin (an autophagy inducer) mimicked acupuncture’s benefits, supports the notion that moderate upregulation of autophagy at this stage is protective. However, the net impact of autophagy depends on its intensity, duration, and cellular context-factors that warrant further investigation. We evaluated the effects of acupuncture on multiple pathologic processes following ICH by measuring inflammatory cytokines, autophagy-related proteins, neuronal apoptosis, and oxidative stress. Compared to the model group, rats receiving acupuncture at “Baihui” penetrating toward “Xuanli” exhibited reduced levels of IL-1β and TNF-α, decreased neuronal apoptosis, and attenuated oxidative stress. Concurrently, the expression of Beclin-1 and ATG5 was upregulated in the acupuncture group. Pharmacological modulation further revealed that 3-MA not only suppressed Beclin-1 and ATG5 expression but also exacerbated inflammation, apoptosis, and oxidative damage, whereas rapamycin produced effects similar to those of acupuncture. These findings suggest a close association between enhanced autophagic activity and the mitigation of neuroinflammation, apoptosis, and oxidative stress following ICH. While a direct causal relationship cannot be established due to the pleiotropic actions of the pharmacologic agents used, the data collectively indicate that functional autophagy - marked by elevated Beclin-1 and ATG5 - coincides with broad neuroprotective effects, including downregulation of IL-1β and TNF-α, suppression of apoptotic pathways, and restoration of redox balance. Thus, acupuncture at “Baihui”-“Xuanli” appears to confer protection against ICH-induced secondary brain injury through a multifaceted modulation of these interconnected pathologic processes. Recent studies have reported that acupuncture may exert neuroprotective effects by modulating the PI3K/AKT signaling pathway [ 25 , 26 ]. Studies have shown that acupuncture can modulate this pathway through two mechanisms. First, acupoint specificity: the “Baihui” acupoint is a key acupoint on the Governor Vessel, which is closely connected with brain function, whereas “Xuanli” acupoint belongs to the Gallbladder Meridian of the Foot-Shaoyang, participating in the circulation of Shaoyang meridian qi circulation. Given the anatomic and meridian connections between the Governor Vessel and Gallbladder Meridian in the head region, penetrating acupuncture between Baihui and Xuanli may enhance central regulatory effects through synergistic effects [ 27 ]. Second, neuro-humoral regulation: acupuncture may stimulate peripheral nerves in the scalp, transmit signals through the spinal cord to the central nervous system, activate endogenous neuroprotective mechanisms such as the release of brain-derived neurotrophic factor, thereby activating the PI3K/AKT pathway [ 28 ]. In this study, acupuncture at Baihui-penetrating-Xuanli was associated with concurrent upregulation of phosphorylated PI3K/AKT and autophagy-related markers (Beclin-1, ATG5), alongside reduced inflammation and improved histologic outcomes. However, it is important to acknowledge that the relationship between PI3K/AKT activation and autophagy induction in this context remains correlative rather than causally established. Notably, the pharmacologic agents (3-MA and rapamycin) used are not selective modulators of autophagy. 3-MA inhibits both Class I and Class III PI3K, thereby potentially suppressing AKT phosphorylation, while rapamycin acts primarily on mTOR, which may trigger feedback activation of upstream kinases, including AKT. Therefore, the observed effects of these agents cannot be interpreted as selective validation of a linear ‘PI3K/AKT → autophagy’ cascade. Instead, our data suggest that the therapeutic efficacy of acupuncture may depend on a coordinated modulation of the broader PI3K/AKT/mTOR/autophagy network, where multiple nodes are simultaneously influenced. The observation that 3-MA attenuated both the neuroprotective effects and the molecular signatures of acupuncture, whereas rapamycin mimicked them, supports the notion that functional autophagic activity is required for the full therapeutic benefit of acupuncture, even though the precise upstream regulators remain incompletely defined. Future studies employing genetic models (e.g., ATG5 knockout) or more specific pathway inhibitors would help dissect the individual contributions of each pathway component. Conclusion Acupuncture at Baihui-penetrating-Xuanli exerts significant neuroprotective effects in a rat model of ICH, as evidenced by improved neurological function, reduced neuroinflammation (decreased IL-1β and TNF-α levels), and enhanced expression of autophagy-related proteins Beclin-1 and ATG5. These protective effects are accompanied by activation of the PI3K/AKT signaling pathway, although the precise mechanistic interplay among these components remains correlative rather than causally defined. Critically, the attenuation of acupuncture-induced effects by autophagy inhibitor 3-MA and their replication by autophagy activator rapamycin underscore the functional importance of intact autophagic activity in mediating its therapeutic outcomes. Despite limitations related to pharmacologic specificity and the absence of direct assessment of mTOR/p-mTOR data preclude definitive pathway mapping, our findings provide compelling evidence that Baihui-penetrating-Xuanli acupuncture may protect against ICH-induced brain injury through coordinated modulation of inflammation and autophagy within a broader PI3K/AKT/mTOR signaling context. This work not only supports the clinical application of this specific acupuncture protocol but also lays a foundation for future studies employing more precise molecular tools to dissect the complex pathways underlying acupuncture’s neuroprotective actions. Acknowledgements This study was supported by the Natural Science Foundation of Ningxia (No. 2023AAC03693), the Key R&D Program of Ningxia (No. 2022BEG02036), the Young Talent Support Program of Ningxia Hui Autonomous Region (No. NXAST[2024]No.6), and the Ningxia Clinical Research Center for Acupuncture and Moxibustion (No. 2018DPG05013). Disclosure of conflict of interest None. References 1. Gao Y, Liu K, Fang S. Trend analysis of stroke subtypes mortality attributable to high body-mass index in China from 1990 to 2019. BMC Public Health. 2024;24:2155. doi: 10.1186/s12889-024-19615-2. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 2. Wang S, Zou XL, Wu LX, Zhou HF, Xiao L, Yao T, Zhang Y, Ma J, Zeng Y, Zhang L. Epidemiology of intracerebral hemorrhage: a systematic review and meta-analysis. Front Neurol. 2022;13:915813. doi: 10.3389/fneur.2022.915813. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 3. Flamand-Roze C, Cauquil-Michon C, Roze E, Souillard-Scemama R, Maintigneux L, Ducreux D, Adams D, Denier C. Aphasia in border-zone infarcts has a specific initial pattern and good long-term prognosis. Eur J Neurol. 2011;18:1397–1401. doi: 10.1111/j.1468-1331.2011.03422.x. [ DOI ] [ PubMed ] [ Google Scholar ] 4. Li Y, Shen G, Du J, Dai W, Su Z. Neuroprotective potential of ethoxzolamide targeting oxidative stress and inflammation in experimental models of intracerebral hemorrhage. Front Biosci (Landmark Ed) 2024;29:356. doi: 10.31083/j.fbl2910356. [ DOI ] [ PubMed ] [ Google Scholar ] 5. Hao L, Zhang A, Lv D, Cong L, Sun Z, Liu L. EGCG activates Keap1/P62/Nrf2 pathway, inhibits iron deposition and apoptosis in rats with cerebral hemorrhage. Sci Rep. 2024;14:31474. doi: 10.1038/s41598-024-82938-y. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 6. Zheng J, Zou W, Yu X. Autophagy in intracerebral hemorrhage: from mechanism to regulation. J Integr Neurosci. 2023;22:134. doi: 10.31083/j.jin2205134. [ DOI ] [ PubMed ] [ Google Scholar ] 7. Zhang G, Lu J, Zheng J, Mei S, Li H, Zhang X, Ping A, Gao S, Fang Y, Yu J. Spi1 regulates the microglial/macrophage inflammatory response via the PI3K/AKT/mTOR signaling pathway after intracerebral hemorrhage. Neural Regen Res. 2024;19:161–170. doi: 10.4103/1673-5374.375343. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 8. You Z, Yang Z, Cao S, Deng S, Chen Y. The novel KLF4/BIG1 regulates LPS-mediated neuro-inflammation and migration in BV2 cells via PI3K/Akt/NF-kB signaling pathway. Neuroscience. 2022;488:102–111. doi: 10.1016/j.neuroscience.2022.01.014. [ DOI ] [ PubMed ] [ Google Scholar ] 9. Zhang D, Cui Y, Zhao M, Zheng X, Li C, Wei J, Wang K, Cui J. Orexin-A exerts neuroprotective effect in experimental intracerebral hemorrhage by suppressing autophagy via OXR1-mediated ERK/mTOR signaling pathway. Front Cell Neurosci. 2022;16:1045034. doi: 10.3389/fncel.2022.1045034. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 10. Fontana F, Giannitti G, Marchesi S, Limonta P. The PI3K/Akt pathway and glucose metabolism: a dangerous liaison in cancer. Int J Biol Sci. 2024;20:3113–3125. doi: 10.7150/ijbs.89942. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 11. Deng RM, Zhou J. The role of PI3K/AKT signaling pathway in myocardial ischemia-reperfusion injury. Int Immunopharmacol. 2023;123:110714. doi: 10.1016/j.intimp.2023.110714. [ DOI ] [ PubMed ] [ Google Scholar ] 12. Wang Y, Tian M, Tan J, Pei X, Lu C, Xin Y, Deng S, Zhao F, Gao Y, Gong Y. Irisin ameliorates neuroinflammation and neuronal apoptosis through integrin αVβ5/AMPK signaling pathway after intracerebral hemorrhage in mice. J Neuroinflammation. 2022;19:82. doi: 10.1186/s12974-022-02438-6. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 13. Kaleem S, Lutz MW, Hernandez CE, Kang JH, James ML, Dombrowski KE, Swisher CB, VanDerWerf JD. A triage model for interhospital transfers of low risk intracerebral hemorrhage patients. J Stroke Cerebrovasc Dis. 2021;30:105616. doi: 10.1016/j.jstrokecerebrovasdis.2021.105616. [ DOI ] [ PubMed ] [ Google Scholar ] 14. Dong SS, Li MY, Yu XP, Kan YN, Dai XH, Zheng L, Cao HT, Duan WH, Luo EL, Zou W. Baihui-penetrating-qubin acupuncture attenuates neurological deficits through SIRT1/FOXO1 reducing oxidative stress and neuronal apoptosis in intracerebral hemorrhage rats. Brain Behav. 2024;14:e70095. doi: 10.1002/brb3.70095. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 15. Dai QV, Li X, Wang JQ, Guo Y, Zhou J, Gao FF, Lu SS, Huang J, Zhao MD, Xu ZF. Construction of acupoint atlas for experimental rats. Zhen Ci Yan Jiu. 2025;50:1339–1351. doi: 10.13702/j.1000-0607.20240873. [ DOI ] [ PubMed ] [ Google Scholar ] 16. Li XF, Ma XH, Zhou R, Liu C, Liu SQ. Effect of acupuncture on arthritic pathological injury in rats with type II collagen-induced rheumatoid arthritis. Zhen Ci Yan Jiu. 2023;48:1103–1110. doi: 10.13702/j.1000-0607.20221180. [ DOI ] [ PubMed ] [ Google Scholar ] 17. Qin X, Sun K, Xu W, Gao J, Jiang H, Chen W, Zhang L, Li Z, Li W, Yuan P, Yang K, Tong P, Zhong Y, Zhu X, Wan X, He C, Wang Y, Xu X, Huang Y, Zhang Z, Huang Y, Guo W, Cao J, Feng T, Wang X, Yin Y, Wang H, Sun C, Xiao X, Wei X, Zhu L. An evidence-based guideline on treating lumbar disc herniation with traditional Chinese medicine. J Evid Based Med. 2024;17:187–206. doi: 10.1111/jebm.12598. [ DOI ] [ PubMed ] [ Google Scholar ] 18. Dong SS, Li MY, Yu XP, Kan YN, Dai XH, Zheng L, Cao HT, Duan WH, Luo EL, Zou W. Baihui-penetrating-qubin acupuncture attenuates neurological deficits through SIRT1/FOXO1 reducing oxidative stress and neuronal apoptosis in intracerebral hemorrhage rats. Brain Behav. 2024;14:e70095. doi: 10.1002/brb3.70095. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 19. Liu H, DU J, Ruan C, Feng PP, Guo ZW, Lou KL, Yu XQ, Li XW. Mechanisms of acupuncture in inhibition of ferroptosis in intracerebral hemorrhage mice based on RNA m6A methylation sequencing. Zhen Ci Yan Jiu. 2025;50:366–374. doi: 10.13702/j.1000-0607.20240002. [ DOI ] [ PubMed ] [ Google Scholar ] 20. Lemaire I, Ouellet S. Distinctive profile of alveolar macrophage-derived cytokine release induced by fibrogenic and nonfibrogenic mineral dusts. J Toxicol Environ Health. 1996;47:465–478. doi: 10.1080/009841096161618. [ DOI ] [ PubMed ] [ Google Scholar ] 21. Cao F, Xu Y, Zhang M, Li X, Chen Y, Zhi M, Li Y. Baihui (DU20), Shenmen (HT7) and Sanyinjiao (SP6) target the cAMP/CREB/BDNF and PI3K/Akt pathways to reduce central nervous system apoptosis in rats with insomnia. Heliyon. 2022;8:e12574. doi: 10.1016/j.heliyon.2022.e12574. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 22. Liu H, Zhang B, Li XW, Du J, Feng PP, Cheng C, Zhu ZH, Lou KL, Ruan C, Zhou C, Sun XW. Acupuncture inhibits mammalian target of rapamycin, promotes autophagy and attenuates neurological deficits in a rat model of hemorrhagic stroke. Acupunct Med. 2022;40:59–67. doi: 10.1177/09645284211028873. [ DOI ] [ PubMed ] [ Google Scholar ] 23. Ahluwalia M, Kumar M, Ahluwalia P, Rahimi S, Vender JR, Raju RP, Hess DC, Baban B, Vale FL, Dhandapani KM, Vaibhav K. Rescuing mitochondria in traumatic brain injury and intracerebral hemorrhages - a potential therapeutic approach. Neurochem Int. 2021;150:105192. doi: 10.1016/j.neuint.2021.105192. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 24. Zhu Z, Yang XF, Yu HM, Chen PB, Jin LM, Li Y, Han D, Shang XM. Effect of acupuncture on the expression of neuropeptides and related inflammatory factors in rats with diarrhea-predominant irritable bowel syndrome. Zhen Ci Yan Jiu. 2023;48:1142–1150. doi: 10.13702/j.1000-0607.20221401. [ DOI ] [ PubMed ] [ Google Scholar ] 25. Rao R, Gan L, Zhao R, Han Y. Electroacupuncture alleviates cerebral ischemia injury by regulating PI3K/AKT/NF-κB signaling in microglia of ischemic stroke rats. Neuroreport. 2025;36:22–30. doi: 10.1097/WNR.0000000000002115. [ DOI ] [ PubMed ] [ Google Scholar ] 26. Qiu Z, Ma J, Zhang X, Jiao M, Zhi L. Electroacupuncture combined with trigonelline inhibits pyroptosis in cerebral ischemia-reperfusion by suppressing autophagy via the PI3K/AKT/mTOR signaling pathway. Brain Res Bull. 2025;221:111200. doi: 10.1016/j.brainresbull.2025.111200. [ DOI ] [ PubMed ] [ Google Scholar ] 27. Zhu ZL, Shen TY, Li XX, Mao JF, Xie T, Zhang JB. Progress of researches on involvement of corticospinal tract in the effect of acupuncture on improvement of post-stroke motor dysfunction. Zhen Ci Yan Jiu. 2022;47:843–6. doi: 10.13702/j.1000-0607.20210670. [ DOI ] [ PubMed ] [ Google Scholar ] 28. Li M, Wang X, Yang L, Jiang Y, Xie Y, Li K. Acupuncture improves learning and memory ability of posttraumatic stress disorder model rats through epigenetic regulation of microglial phosphatidylinositol 3-kinase pathway. Technol Health Care. 2023;31:409–421. doi: 10.3233/THC-236035. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Articles from American Journal of Translational Research are provided here courtesy of e-Century Publishing Corporation ACTIONS View on publisher site PDF (3.5 MB) Cite Collections Permalink PERMALINK Copy RESOURCES Similar articles Cited by other articles Links to NCBI Databases Cite Copy Download .nbib .nbib Format: AMA APA MLA NLM Add to Collections Create a new collection Add to an existing collection Name your collection * Choose a collection Unable to load your collection due to an error Please try again Add Cancel Follow NCBI NCBI on X (formerly known as Twitter) NCBI on Facebook NCBI on LinkedIn NCBI on GitHub NCBI RSS feed Connect with NLM NLM on X (formerly known as Twitter) NLM on Facebook NLM on YouTube National Library of Medicine 8600 Rockville Pike Bethesda, MD 20894 Web Policies FOIA HHS Vulnerability Disclosure Help Accessibility Careers NLM NIH HHS USA.gov Back to Top