Conceptio › Archive › NCBI PubMed Central
NCBI PubMed Centralopen access

Downregulation of miRNAs Accompanies Increased HERV-K (HML-2) Expression in Amyotrophic Lateral Sclerosis.

Simula ER et al. · ncbi_pmc
NCBI PubMed Central · Papers · License: Open Access
Open Source ↗Direct PDF ↓
distributed systems architecture

Downregulation of miRNAs Accompanies Increased HERV-K (HML-2) Expression in Amyotrophic Lateral Sclerosis - PMC Skip to main content An official website of the United States government Here's how you know Here's how you know Official websites use .gov A .gov website belongs to an official government organization in the United States. Secure .gov websites use HTTPS A lock ( Lock Locked padlock icon ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites. Search Log in Dashboard Publications Account settings Log out Search… Search NCBI Primary site navigation Search Logged in as: Dashboard Publications Account settings Log in Search PMC Full-Text Archive Search in PMC Journal List User Guide PERMALINK Copy As a library, NLM provides access to scientific literature. Inclusion in an NLM database does not imply endorsement of, or agreement with, the contents by NLM or the National Institutes of Health. Learn more: PMC Disclaimer | PMC Copyright Notice Mol Neurobiol . 2026 Apr 17;63(1):570. doi: 10.1007/s12035-026-05861-5 Search in PMC Search in PubMed View in NLM Catalog Add to search Downregulation of miRNAs Accompanies Increased HERV-K (HML-2) Expression in Amyotrophic Lateral Sclerosis Elena Rita Simula Elena Rita Simula 1 Department of Biomedical Sciences, Division of Microbiology and Virology, University of Sassari, Sassari, Italy Find articles by Elena Rita Simula 1, # , Marta Garcia-Montojo Marta Garcia-Montojo 2 National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, MD USA 3 Twilight Bioscience, Inc. 100 Cummings Center. Suite 207-209, Beverly, MA USA Find articles by Marta Garcia-Montojo 2, 3, # , Mattia Canu Mattia Canu 4 ASL Sassari, SC Anestesia Territoriale Cure Palliatiave, 07100 Sassari, Italy Find articles by Mattia Canu 4 , Vanna Chessa Vanna Chessa 4 ASL Sassari, SC Anestesia Territoriale Cure Palliatiave, 07100 Sassari, Italy Find articles by Vanna Chessa 4 , Tommaso Ercoli Tommaso Ercoli 5 Neurological Unit, AOU Sassari, University of Sassari, Viale S. Pietro 10, 07100 Sassari, Italy Find articles by Tommaso Ercoli 5 , Elisa Ruiu Elisa Ruiu 5 Neurological Unit, AOU Sassari, University of Sassari, Viale S. Pietro 10, 07100 Sassari, Italy Find articles by Elisa Ruiu 5 , Paolo Solla Paolo Solla 5 Neurological Unit, AOU Sassari, University of Sassari, Viale S. Pietro 10, 07100 Sassari, Italy Find articles by Paolo Solla 5 , Avindra Nath Avindra Nath 2 National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, MD USA Find articles by Avindra Nath 2, ✉ , Leonardo Antonio Sechi Leonardo Antonio Sechi 1 Department of Biomedical Sciences, Division of Microbiology and Virology, University of Sassari, Sassari, Italy 6 Complex Structure of Microbiology and Virology, University Hospital of Sassari, Sassari, Italy Find articles by Leonardo Antonio Sechi 1, 6, ✉ Author information Article notes Copyright and License information 1 Department of Biomedical Sciences, Division of Microbiology and Virology, University of Sassari, Sassari, Italy 2 National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, MD USA 3 Twilight Bioscience, Inc. 100 Cummings Center. Suite 207-209, Beverly, MA USA 4 ASL Sassari, SC Anestesia Territoriale Cure Palliatiave, 07100 Sassari, Italy 5 Neurological Unit, AOU Sassari, University of Sassari, Viale S. Pietro 10, 07100 Sassari, Italy 6 Complex Structure of Microbiology and Virology, University Hospital of Sassari, Sassari, Italy ✉ Corresponding author. # Contributed equally. Received 2026 Jan 20; Accepted 2026 Apr 11; Issue date 2026. © The Author(s) 2026 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/ . PMC Copyright notice PMCID: PMC13090184  PMID: 41995990 Abstract Amyotrophic lateral sclerosis (ALS) is a rapidly progressing neurodegenerative disease with limited treatments. Evidence suggests that reactivation of the HERV-K (HML-2) subgroup contributes to its pathogenesis. This study explores the role of microRNAs (miRNAs) in regulating HML-2 expression. We identified dysregulated miRNAs in ALS and, among them, those predicted to target the HML-2 transcript. The expression levels of selected miRNAs were validated in peripheral blood leukocytes of ALS individuals and healthy controls. Co-transfection experiments were then performed to determine the regulatory potential of these miRNAs on HML-2 expression. We found that the HML-2 envelope gene expression levels were elevated in peripheral blood mononuclear cells of ALS individuals compared to controls ( p = 0.02), and they negatively correlated with the levels of previously identified miRNAs, which were downregulated in patients compared to healthy controls (miR-15a-3p, p = 0.04; miR-15a-5p, p = 0.01; miR-150-5p, p = 0.001; miR-182-5p, p = 0.012; miR-192-3p, p = 0.034; miR-221-3p, p = 0.011), except miR-181a-2-3p that was upregulated in ALS compared to controls ( p = 0.006). Among these miRNAs, we found, by co-transfection, that miR-182-5p and miR-221-3p were capable of binding the HML-2 transcript. This interaction resulted in a significant downregulation of the expression of its genes, with a pronounced effect observed on the envelope gene. Our findings suggest a link between miRNAs and HML-2 expression. In particular, the observed increase in HML-2 levels in ALS may result from the downregulation of key miRNAs, such as miR-221, that normally help restrain HML-2 expression under physiological conditions. Supplementary Information The online version contains supplementary material available at 10.1007/s12035-026-05861-5. Keywords: ALS, MiRNAs, HERV-K, HML-2, Neurodegeneration, Gene regulation Background Amyotrophic Lateral Sclerosis (ALS) is a neurodegenerative disorder characterized by the progressive death of motor neurons. The principal clinical manifestations of ALS include paralysis of voluntary muscles, atrophy, and fasciculations. Typically, the disorder results in a life expectancy of three to five years after onset, and respiratory failure is the most common cause of fatality [ 1 ]. ALS is commonly classified according to the initial site of motor neuron involvement. Limb-onset ALS is characterized by early weakness in the arms or legs, whereas bulbar-onset ALS typically presents with speech or swallowing difficulties [ 2 ]. Each subtype has unique clinical features and disease progression, suggesting that different underlying mechanisms may contribute to the development and progression of the pathology [ 3 ]. TDP-43 proteinopathy in the brain is the hallmark of ALS, being present in approximately 97% of patients, but the molecular mechanisms of ALS pathogenesis are not yet fully understood. Pathogenic alterations are believed to involve interference with protein expression and degradation and defects in RNA processing [ 4 ]. These abnormalities result in progressive cell breakdown, disruption of axonal architecture and function, axonal retraction, and ultimately denervation of muscles [ 5 ]. Also, the etiology of ALS remains largely elusive, ranking the disorder within the spectrum of multifactorial diseases involving the interplay of multiple genetic, and environmental, factors [ 6 ]. Genetic predispositions in familial cases account for approximately 5–10% of incidence. On the other hand, sporadic ALS, which constitutes the majority of cases, hints at potential environmental triggers that could influence disease onset and progression [ 7 ]. Recent studies have provided evidence supporting that the reactivation of a specific protein encoded by Human Endogenous Retrovirus ( HERV ), namely envelope (HML-2 env), may play a role in the development of ALS [ 8 – 10 ]. HERVs are sequences of retroviral origin that compose approximately 8% of the human genome and exhibit high levels of expression in stem cells, predominantly silenced following cell differentiation [ 11 ]. Although they generally remain dormant, the reactivation of HERVs has been implicated in various neurodegenerative diseases, including ALS [ 12 , 13 ]. HERV-K, and particularly the HML-2 subgroup, has nearly a hundred copies within the human genome and is the most recently acquired and transcriptionally active. It is involved in various pathological contexts, including neurodegeneration, cancer, and autoimmune diseases [ 14 – 18 ]. Notably, specific loci of HML-2 that encode for the envelope protein are expressed in the central nervous system of a subset of ALS individuals but not in unaffected controls [ 8 ]. Cellular and in vivo models of ALS show that overexpression of the envelope protein of HML-2 leads to neuronal death, particularly motor neurons, causing an ALS-like syndrome in transgenic mice. HML-2 env transgenic mice display progressive motor impairment and a shortened life-span [ 8 ]. Moreover, a relationship between HML-2 and TDP-43 proteinopathy has been demonstrated, pointing out mechanistic pathways for the neurotoxic effects of HML-2. HML-2 expression is positively correlated with mislocalized TDP-43 protein levels within the cortical brain tissue and human neuronal cells from iPSCs [ 19 ] and it is sufficient to induce cytoplasmic aggregation and phosphorylation of TDP-43 [ 20 ]. The potential role of HML-2 reactivation in the pathogenesis of ALS has prompted investigations into the mechanisms behind this reactivation but the exact processes involved remain elusive. One possible mechanism, that we investigate in this study, is related to microRNAs (miRNAs). The Human Genome Project disclosed that within the three billion base pairs of the human genome, merely about 2% are involved in protein-coding. This suggests that a substantial portion of the genome is involved in generating a diverse range of non-coding RNAs (ncRNAs), which are increasingly recognized for their regulatory roles not only in normal cellular processes but also in pathological conditions, including neurodegenerative diseases, cancers, and autoimmune disorders [ 21 – 24 ]. MiRNAs are evolutionarily conserved, tissue-specific small ncRNAs, typically ranging from 18 to 25 nucleotides in length. They are crucial post-transcriptional regulators of gene expression. They operate by binding to complementary sequences of target messenger RNAs, leading, most often, to suppression of protein synthesis. This suppression occurs through mechanisms such as mRNA destabilization or inhibition of mRNA translation, effectively downregulating gene expression [ 25 ]. Notably, a single miRNA can regulate multiple genes, while the expression of a particular gene can be controlled by a complex network of interacting miRNAs [ 26 ]. Numerous studies have demonstrated that the biogenetic pathways of miRNAs are disrupted in ALS. Notably, Campos-Melo et al. [ 27 ]. and Figueroa-Romero et al. [ 28 ]. have reported alterations in miRNA profiles. Both familial ALS (fALS) and sporadic ALS (sALS) individuals exhibit decreased levels of specific miRNA subsets when compared to healthy controls (HCs) and individuals with other neurodegenerative disorders. Among the various miRNAs potentially involved, most of them showed comparable expression levels between ALS individuals and HCs, while others were found to be differentially expressed. Specifically, miR-15a-3p, miR-15a-5p, miR-150-5p, miR-182-5p, miR-192-3p, miR-221-3p, and miR-181a-2-3p were identified as dysregulated and have been previously implicated in neurodegenerative pathways [ 29 – 33 ]. In the present study we investigated the potential binding of those miRNAs to the HML-2 transcript, their expression in ALS individuals and controls and their modulatory effect on HML-2 expression. Methods Study Design Combined case–control and in vitro study with retrospective data collection. Samples The study was conducted in accordance with the principles outlined in the Declaration of Helsinki. All participants provided written informed consent prior to inclusion in the study. The study protocol was reviewed and approved by the local Ethics Committee at Sassari University Hospital (Azienda Ospedaliero-Universitaria, Sassari, Italy; IRB number 2395/2016), and all procedures involving human samples were performed in compliance with relevant institutional and regulatory guidelines. Whole blood samples were collected from patients diagnosed with ALS and from healthy blood donors. A total of 13 ALS patients were recruited between March and October 2021 (5 females and 8 males; median age = 62 years) from ATSSardegna, UOS Malati ventilati e cure palliative ACA (Table 1 ). Samples from a group of 14 HCs were collected throughout 2021 at the Blood Transfusion Centre of Sassari (7 females and 7 males; median age = 61.5 years). Table 1. Clinical characteristics of ALS patients Samples ALS 1 ALS 2 ALS 3 ALS 4 ALS 5 ALS 6 ALS 7 ALS 8 ALS 9 ALS 10 ALS 11 ALS 12 ALS 13 Sex F F M M M M M F F M M F M Age (y/o) 66 58 79 72 63 63 62 86 55 62 46 62 62 fALS/sALS NR s NR NR s s NR s s s NR NR NR Spinal/Bulbar B S NR NR NR NR NR B NR S NR NR NR Disease duration (mo) 24 108 96 72 12 24 36 120 60 192 NR NR NR ALS-FRS NR < 20 < 20 < 20 NR NR NR < 20 NR < 20 NR NR NR PEG/NIV PEG PEG/NIV PEG PEG PEG PEG PEG PEG PEG PEG PEG NR NR Tracheostomy YES YES YES YES YES YES YES YES YES YES YES NO NR Comorbidity NR NO NO NO NO Diabetes NO NO Discoid Lupus Erythematosus Diabetes NO NR NR Open in a new tab fALS = familial amyotrophic lateral sclerosis; sALS = sporadic amyotrophic lateral sclerosis F = female; M = male; NR = not reported; ALS-FRS = functional rating scale; PEG = percutaneous endoscopic gastrostomy; NIV = non-invasive ventilation; B = bulbar onset; L = limb, S = spinal onset Blood Samples Collection Peripheral venous blood samples were obtained from the participants using K2-EDTA tubes. The collected whole blood was gently layered over an equal volume of Ficoll (Sigma-Aldrich, St. Louis, MO, USA) in a 15 mL tube and centrifuged for 20 min at 1800 revolutions per minute (rpm) without brake. The peripheral blood mononuclear cells (PBMCs) were collected and stored at −80 °C in fetal bovine serum with 10% dimethyl sulfoxide for total RNA, including small RNAs, extraction. Identification of miRNAs able to Bind HERV-K Consensus Sequence To identify miRNAs with predicted binding affinity for the HML-2 transcript, a HML-2 consensus sequence [ 34 ] was submitted to the miRDB target prediction platform ( https://mirdb.org ). The resulting list was then filtered to only those miRNAs previously associated with neurodegenerative disorders, with particular focus on those implicated in ALS, based on literature. This filtering step yielded a panel of 16 candidate miRNAs. Expression profiles of these candidates were subsequently analyzed in total RNA extracted from PBMCs of ALS individuals and HCs, and seven of them showed differential expression between the two groups. (Fig. 1 ). Two miRNAs, selected from the subset of downregulated candidates, were subjected to functional validation through co-transfection assays with a plasmid encoding the HML-2 consensus sequence, to evaluate their capacity to mediate post-transcriptional regulation. Fig. 1. Open in a new tab Representation of predicted miRNA binding sites on HML-2 and expression levels in ALS and HCs. Schematic representation of the predicted binding sites between miRNAs and the HML-2 transcript ( A ) HERV-K-env gene expression levels are upregulated in ALS individuals compared to controls ( B ). miR-15a-3p, miR-15a-5p, miR-150-5p, miR-182-5p, miR-192-3p, and miR-221-3p are downregulated in ALS patients ( C , D , E , J , K , and L ) and negatively correlated with the HERV-K envelope gene expression levels ( F , G , H , N , O and P ). miR-181a-2-3p was found to be upregulated in ALS patients ( I ) and positively correlated with HERV-K-env gene expression ( M ). Group comparisons were performed using the non-parametric Mann–Whitney U test. The ALS patient group comprised 13 individuals and the healthy control group 14 individuals ( n = 13 ALS vs. n = 14 HC). No correction for multiple comparisons was applied, consistent with the targeted candidate-miRNA approach adopted in this study. Effect sizes are reported as Cohen's d with 95% confidence intervals (95% CI). Statistical significance was set at p < 0.05 (*) RNA Isolation, RT-PCR, and qPCR Analysis Total RNA, including small RNAs, from PBMCs was purified using the miRNeasy Mini Kit (QIAGEN, Hilden, Germany) and treated with DNase to remove DNA contamination with the Turbo DNA-free kit (Thermo Fisher Scientific, Waltham, MA, USA), following manufacturer’s instructions. Then, RNA concentration was measured with a Nanodrop (Thermo Fisher Scientific, Waltham, MA, USA) and all the samples were adjusted to the same concentration. First-strand cDNA synthesis was performed using QuantiTect Reverse Transcription Kit (QIAGEN, Hilden, Germany). MiRNAs were reverse transcribed using miRCURY LNA RT Kit (QIAGEN, Hilden, Germany). No-RT (no Reverse Transcriptase) for each sample and no-TC (no Template Control) controls were made to check for DNA and reagent contamination, respectively. Subsequently, samples were analyzed in technical triplicates by real-time PCR using the QuantiNova SYBR Green PCR Kit (QIAGEN, Hilden, Germany) for mRNA quantification, and the miRCURY LNA SYBR Green PCR Kit (QIAGEN, Hilden, Germany) for miRNA analysis, according to manufacturer's instructions. The relative miRNA and mRNA expression levels were calculated by the 2 −∆∆Ct method. Normalization of mRNA expression levels was performed using HPRT1 as the reference gene. miRNA expression levels were normalized using the average of two reference small RNAs, snRNA-U6 and miR-103a-3p. Gene-specific primer pairs are listed in Table 2 . Table 2. Selected miRNAs capable of binding to HML-2 mRNA Target Genes Accession Number Name Target References Binding site on HML-2 sequence (nt) MIMAT0004488 hsa-miR-15a-3p CAGGCCAUAUUGUGCUGCCUCA [ 35 – 37 ] 369 (LTR), 3574 (PRO), 8306 (ENV), 8873 (LTR) MIMAT0000068 hsa-miR-15a-5p UAGCAGCACAUAAUGGUUUGUG [ 36 , 38 – 40 ] 369 (LTR), 3574 (PRO), 8306 (ENV), 8873 (LTR) MIMAT0000451 hsa-miR-150-5p UCUCCCAACCCUUGUACCAGUG [ 41 , 42 ] 1948 (GAG), 5824 (POL) MIMAT0004558 has-miR-181a-2-3p ACCACUGACCGUUGACUGUACC [ 43 , 44 ] 3558 (PRO), 3989 (POL), 4346 (POL), 6053 (POL) MIMAT0000259 hsa-miR-182-5p UUUGGCAAUGGUAGAACUCACACU [ 45 , 46 ] 4537 (POL), 5918 (POL), 6876 (ENV) MIMAT0004543 hsa-miR-192-3p CUGCCAAUUCCAUAGGUCACAG [ 47 ] 7706 (ENV), 7958 (ENV), 8013 (ENV) MIMAT0000278 hsa-miR-221-3p AGCUACAUUGUCUGCUGGGUUUC [ 48 ] 1512 (GAG), 7905 (ENV) MIMAT0004489 hsa-miR-16–1-3p CCAGUAUUAACUGUGCUGCUGA [ 36 , 49 ] 610 (LTR), 1743 (GAG), 1938 (GAG), 4941 (POL), 9114 (LTR) MIMAT0000077 hsa-miR-22-3p AAGCUGCCAGUUGAAGAACUGU [ 50 ] 2235 (GAG), 6288 (ENV), 6550 (ENV), 8231 (LTR) MIMAT0004495 hsa-miR-22-5p AGUUCUUCAGUGGCAAGCUUUA [ 50 ] 2235 (GAG), 6288 (ENV), 6550 (ENV), 8231 (LTR) MIMAT0004613 hsa-miR-188-3p CUCCCACAUGCAGGGUUUGCA [ 37 ] 377 (LTR), 5159 (POL), 8881 (LTR) MIMAT0000457 hsa-miR-188-5p CAUCCCUUGCAUGGUGGAGGG [ 37 ] 377 (LTR), 5159 (POL), 8881 (LTR) MIMAT0004683 hsa-miR-362-3p AACACACCUAUUCAAGGAUUCA [ 37 ] 942 (LTR), 3478 (PRO), 9446 (LTR) MIMAT0002873 hsa-miR-502-5p AUCCUUGCUAUCUGGGUGCUA [ 37 , 51 ] 1265 (GAG), 1467(GAG), 3496 (PRO), 5096 (POL), 7134 (ENV) MIMAT0004797 hsa-miR-582-3p UAACUGGUUGAACAACUGAACC [ 27 , 37 ] 2270 (GAG), 3058 (GAG), 4421 (POL), 8091 (ENV) MIMAT0003247 hsa-miR-582-5p UUACAGUUGUUCAACCAGUUACU [ 27 , 37 ] 2270 (GAG), 3058 (GAG), 4421 (POL), 8091 (ENV) XM_047445854 HML-2-env-FW HML-2-env-RV CTGAGGCAATTGCAGGAGTT GCTGTCTCTTCGGAGCTGTT Reference Genes Accession Number Name Target X59362 U6 N/A – QIAGEN YP02119464 MIMAT0000101 has-miR-103a-3p AGCAGCAUUGUACAGGGCUAUGA NM_000194 HPRT1-FW HPRT1-RV GCTATAAATTCTTTGCTGACCTGCTG AATTACTTTTATGTCCCCTGTTGACTGG Open in a new tab The table reports the sequences of the selected miRNAs analyzed in this study, along with the primer sequences used for HML-2 detection and the nucleotide position at which each miRNA is predicted to bind the HML-2 consensus sequence. Reference genes employed for the normalization of miRNA and HML-2 transcript quantification are listed in the lower section Cell Culture HEK293 cells were grown in Dulbecco’s Modified Eagle’s medium (DMEM) + GlutaMAX. [+] 4.5 g/L D-Glucose. [+] 110 mg/L Sodyum Pyruvate supplemented with 10% fetal bovine serum with 5% antibiotics and maintained in a tissue culture incubator at 37 °C with 5% CO 2 . Transient Co-Transfection of HEK-293 HEK-293 cells were grown in DMEM and maintained in a tissue culture incubator at 37 °C with 5% CO 2 . After 24 h of passaging and achieving approximately 80% confluence, HEK-293 cells were co-transfected with a HML-2 plasmid that has consensus sequence of the virus [ 8 ] and microRNAs (Thermo Fisher Scientific, Waltham, MA, USA) using the Lipofectamine 3000 kit (Thermo Fisher Scientific, Waltham, MA, USA). Briefly, 1.5 µg of HML-2 plasmid or 1.5 µg of pcDNA (negative control), and 15 nM of miRNAs were mixed with Lipofectamine 3000, P3000, and Opti MEM reduced serum medium following manufacturer’s instructions (Thermo Fisher Scientific, Waltham, MA, USA). After 15 min of incubation at room temperature, the respective mixture was added to the cells. After 48 h of incubation, the cells were lysed, and the proteins and RNA were extracted. Protein Purification and Quantification For protein extraction cells were lysed in NeuN buffer (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with a protease inhibitor cocktail (MilliporeSigma, Burlington, MA, USA) and incubated for 10 min on ice. Subsequently, lysates were centrifuged at 10,000 g for 10 min at 4 °C. The supernatant, containing proteins, was transferred to new tubes and proteins were quantified using Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, Waltham, MA, USA) according to manufacturer’s instructions. Western Blot Analysis Protein concentration in the lysates was measured with the Pierce BCA protein assay kit and all samples to be compared were adjusted to the same concentration. 20 µg of protein per sample was mixed with lithium dodecyl sulfate buffer with 10% β-mercaptoethanol. Samples were denatured at 95 °C for 5 min at 900 rpm in a thermo shaker. They were then resolved in a 4–12% bis–tris gel (Invitrogen, Carlsbad, CA, USA) at 180 V for 45 min and transferred to a Polyvinylidene Difluoride (PDVF) membrane (iBlot PDVF stack; Thermo Fisher Scientific, Waltham, MA, USA) using an iBlot blotting system (Thermo Fisher Scientific, Waltham, MA, USA) for 7 min. Then, membranes were blocked with phosphate buffered saline (PBS) with 5% skimmed milk for 1 h and incubated at 4 °C with anti-HML-2 env primary antibodies (Austral Biologicals, San Ramon, CA, USA) (1:1000 in tris buffered saline (TBS) with 5% albumin and 0.02% sodium azide) overnight. The next day blots were washed 3 times in PBS-0.05% Tween-20 for 5 min and incubated with secondary anti-mouse IgG HPR-conjugated antibody (Cell Signaling Technology, Danvers, MA, USA) for 1 h (1:2500 in PBS-0.05% Tween-1% skimmed milk) in PBS. Blots were washed again 3 times and chemiluminescence was developed with Supersignal West Femto signal kit (Thermo Fisher Scientific, Waltham, MA, USA). Images were processed for quantification of chemiluminescence with Image J software. Statistical Analysis Data was analyzed using GraphPad Prism version 8 (GraphPad Software, San Diego, CA, USA). The Kolmogorov–Smirnov test was applied to all data sets to assess normality. For normally distributed data, differences between groups were evaluated by one-way ANOVA followed by Dunnett’s post hoc test. For non-normally distributed data, comparisons were performed using the non-parametric Mann–Whitney U test, with Bonferroni correction for multiple comparisons. Each miRNA was analyzed as an individual, biologically selected candidate compared between patients and controls using the Mann–Whitney U test; given the targeted candidate-miRNA approach, rather than a large-scale exploratory screening, a global multiple-testing correction was not applied. Values in graphs are presented as mean ± standard error of the mean (SEM) for normally distributed data, and as median with interquartile range (IQR) for non-parametric data. Correlations between two variables were assessed using Spearman's rank correlation coefficient. Statistical significance was defined as p < 0.05. Results The consensus sequence of HML-2 was analyzed using miRDB, yielding 288 microRNAs predicted to interact with the transcript. From this list, 16 candidates were selected based on previously reported associations with ALS or other neurodegenerative disorders (Table 2 ). We then quantitatively evaluated the expression of these 16 miRNAs in RNA samples extracted from peripheral blood mononuclear cells of ALS individuals and HCs. Expression profiling, performed via qPCR, revealed a subset of miRNAs that were consistently downregulated in comparison with HC samples. Two miRNAs, selected among the most significantly downregulated, were chosen for functional validation. Each of the two candidate miRNAs was co‑transfected into HEK‑293 cells alongside a construct containing the HML‑2 consensus sequence. We investigated the expression levels of HML-2- env and miRNAs in PBMC of ALS patients and HCs by qPCR. The binding sites on the HML-2 sequence of the miRNAs that showed a differential expression in ALS patients compared to controls are depicted in Fig. 1 A. There was upregulation of HML-2- env transcript in patients compared to controls ( p = 0.02) (Fig. 1 B). While levels of most miRNAs were found to be similarly expressed in ALS patients and HCs (supplementary materials, Figure S1 ) a subset showed significant downregulation in ALS, including miR-15a-3p ( p = 0.04; Fig. 1 C), miR-15a-5p ( p = 0.01; Fig. 1 D), miR-150-5p ( p = 0.001; Fig. 1 E), miR-182-5p ( p = 0.012; Fig. 1 J), miR-192-3p ( p = 0.034; Fig. 1 K), and miR-221-3p ( p = 0.011; Fig. 1 L). In contrast, miR-181a-2-3p was significantly upregulated in ALS compared to controls ( p = 0.006; Fig. 1 I). To assess whether the observed miRNA alterations reflect a coordinated dysregulation pattern, a composite miRNA score was calculated for each subject as the mean expression of the downregulated candidate miRNAs (miR-15a-3p, miR-15a-5p, miR-150-5p, miR-192-3p, and miR-221-3p). Comparison between ALS patients and HCs using the Mann–Whitney test revealed a significant difference ( p = 0.019), supporting the presence of a coordinated dysregulation of these miRNAs in ALS (supplementary materials, figure S2 ). Moreover, the expression levels of some of these miRNAs showed negative correlations with HML-2- env , suggesting a potential inverse relationship between reduced miRNA levels and increased HML-2 expression. Specifically, among the analyzed miRNAs, HML-2- env expression levels showed a statistically significant negative correlation exclusively with miR-15a-5p ( r = −0.48, p = 0.04; Fig. 1 G). Although not statistically significant, we found trends toward negative correlation with miR-15a-3p ( r = −0.43, p = 0.06; Fig. 1 F), miR-150-5p ( r = −0.43, p = 0.06; Fig. 1 H), miR-182-5p ( r = −0.39, p = 0.09; Fig. 1 N), miR-192-3p ( r = −0.28, p = 0.17; Fig. 1 O), and miR-221-3p ( r = −0.39, p = 0.08; Fig. 1 P). In contrast, a tendency toward a positive correlation was observed only between miR-181a-2-3p and HML-2- env ( r = 0.28, p = 0.17; Fig. 1 M). To investigate the potential role of miRNAs in regulating HML-2 expression we co-transfected cells with an HML-2 plasmid and miR-182-5p and miR-221-3p and measured HML-2 transcripts two days after transfection (Fig. 2 ). These two miRNAs are dysregulated in various neurological diseases, including ALS [ 29 , 30 , 45 , 52 – 55 ], and have been implicated in the regulation of multiple cellular processes such as apoptosis, cell proliferation, and differentiation [ 56 , 57 ]. The levels of HML-2 RNA were lower in the cells co-transfected with miR-221-3p and with the combination of both miRNAs but not with miR-182-5p alone (Fig. 2 A). The same effect was observed on HML-2 -gag and -pol transcripts (Fig. 2 B and C), suggesting that the miRNA may regulates HML-2 at the pre-mRNA stage. Given the documented neurotoxic role of the envelope protein in ALS, associated with neuroinflammatory responses and motor neuron damage HEK293 cells were selected due to their high transfection efficiency and well-characterized molecular background, which allows controlled assessment of exogenous miRNA-target interactions with reduced experimental variability, we performed env-protein-level validation. Co-transfection with the individual miR-221-3p decreased the level of HML-2 env protein and when the miRNAs were used in combination, we found a synergistic effect (Fig. 3 ). No significant effect on the protein was found for miR-182-5p alone. The concordance between the RNA and the protein results indicate that miR-221-3p downregulates the target gene, most likely by inhibiting its translation or reducing its stability. (Fig. 3 ) (supplementary materials, figure S3 for the uncropped membrane images). One possibility to explain the synergistic effect is that miR-182-5p binding might cause a change on the secondary structure of the HERV-K mRNA making it more accessible to miR-221-3p binding and enhancing its ability to suppress translation or reduce mRNA stability (Fig. 3 A and B). However, this remains an open question and requires experimental validation. These results suggest that the use of specific miRNAs or their combination could represent a potential therapeutic strategy for the regulation of HML-2 expression. Fig. 2. Open in a new tab miR-182-5p and miR-221-3p synergistically modulate env gene expression in HEK-293 cells following transfection. HEK-293 cells were transfected with pcDNA, HML-2 alone or co-transfected with HML-2 + miR-182-5p, miR-221-3p or with both miRNAs. Total RNA was extracted post-transfection and analyzed by qPCR to assess the HML-2- env ( A ), pol ( B ) and gag ( C ) gene expression. Statistical significance was set at p < 0.05 (*) Fig. 3. Open in a new tab miR-182-5p and miR-221-3p synergistically modulate HML-2 envelope protein expression in HEK-293 after transfection. Proteins purified from HEK-293 cell line transfected with pcDNA, HML-2 alone or co-transfected with HML-2 + miR-182-5p, miR-221-3p or with both miRNAs were analyzed by western blot. Protein expression levels were assessed by western blot analysis and protein signals were quantified using ImageJ and plotted ( B ). ( A ) Representative image of a blot. ( B ) Comparison of HERV-K-env protein levels among the different treatments. Data are derived from three independent biological replicates. Statistical significance was set at p < 0.05 (*) Discussion HML-2 reactivation has been observed in several pathological conditions, but the molecular factors responsible for this process are still not fully understood. In this study, we explored whether specific miRNAs are involved in modulating HML-2 expression. MiRNAs play essential roles across various biological contexts, far beyond the classical model of post-transcriptional gene silencing through binding to the 3′ untranslated region (3′ UTR) of target mRNAs, resulting in gene silencing [ 58 , 59 ]. Binding sites of miRNAs have also been identified in other regions of mRNA, including the 5′ UTR and coding sequences, resulting in gene silencing [ 60 ], and binding to the promoter regions, resulting in transcription induction [ 61 , 62 ]. In addition to regulating host gene expression, miRNAs play a significant role in modulating genes of infecting viruses or bacteria. Notably, they have been implicated in the control of HIV-1 latency and reactivation, either contributing to the maintenance of transcriptional silencing of the integrated provirus or promoting its reactivation, depending on the cellular context and the specific miRNA expression profile [ 63 – 65 ]. In light of the multiple roles attributed to microRNAs, we propose that miRNA-mediated regulation could represent a potential mechanism contributing to HML-2 reactivation. In fact, they can be involved in neuronal development, synaptic plasticity, and neural circuit maintenance [ 66 ]. Several miRNAs are enriched in the central and peripheral nervous systems, where they modulate the expression of genes involved in neurogenesis, axonal growth, and neuromuscular signaling [ 67 – 69 ]. Notably, specific miRNAs have been associated with motor neuron integrity and have emerged as potential contributors to the pathophysiology of neurodegenerative disorders such as ALS [ 70 , 71 ]. Members of the miR-15/16 cluster, located within the intronic region of the DLEU2 gene, have shown variable expression profiles in ALS, with both up- and downregulation described in blood, muscle, and neuron-derived extracellular vesicles [ 36 , 72 , 73 ]. These miRNAs target Bcl-2, an anti-apoptotic protein involved in neuronal survival, suggesting a mechanistic link to ALS-related neurodegeneration [ 74 – 76 ]. MiR-150-5p has been found significantly downregulated in plasma from sporadic ALS patients [ 41 ], and miR-181 has been proposed as a prognostic biomarker, with higher plasma levels predicting reduced survival, in combination with neurofilament light chain [ 43 ]. In contrast, although no specific molecular mechanisms have been proposed so far for miR-182 and miR-192 in the context of ALS, both miRNAs have been found to be deregulated in the disease [ 37 ], as confirmed by our findings. MiR-182, part of the neuron-enriched miR-183/96/182 cluster, has been shown to regulate axonal growth and dendritic maturation via the AKT/PTEN pathway, and to interact with TDP-43 and FUS in other neurodegenerative contexts [ 45 , 46 ]. MiR-192-5p has been investigated in models of cerebral ischemia, where it shows neuroprotective and anti-inflammatory effects by downregulating Dyrk1a expression [ 77 ]. Given the shared features of neuroinflammation and neuronal loss, similar mechanisms may also be relevant to the pathophysiology of ALS. To further support the robustness of our findings, we interrogated an independent publicly available dataset (GEO: GSE148097 ). Most investigated miRNAs showed a consistent directional trend with our cohort, with the exception of hsa-miR-181a-2-3p, whose upregulation in our data is consistent with its reported role as a prognostic biomarker in ALS [ 43 ]. These observations support the biological relevance of the identified miRNA signature, although larger cohorts and standardized pipelines will be required to fully validate its diagnostic and prognostic value in ALS. Beyond their known functions, it is particularly noteworthy that our findings revealed the ability of these miRNAs to bind the HML-2 transcript, suggesting a potential regulatory interaction that may contribute to the control of HERV-K expression. Growing evidence points to the HML-2 potential contribution to disease pathogenesis. High expression levels of HML-2-env have been identified in brain samples obtained post-mortem from subsets of patients [ 8 , 78 ]. The envelope protein has been identified within extracellular vesicles derived from the plasma of ALS patients, with increased levels observed in the advanced stages of the disease [ 79 ]. Recently, it was demonstrated that individuals with ALS exhibit higher levels of HML-2-env protein in cerebrospinal fluid [ 9 ] and corresponding antibodies in plasma than control subjects. Intriguingly, a diminished humoral response against HML-2 was observed in patients at later stages of the disease. This decrease in antibody levels was also correlated with reduced predicted survival rates suggesting that the reactivation of HML-2 may play a role in the pathogenesis of ALS and that a humoral response against it could be protective for patients, whereas a loss of this response might be associated with a poorer prognosis [ 80 ]. Furthermore, antibody levels against HML-2-env appear to correlate with those detected against TDP-43 [ 81 ], whose aberrant protein aggregation and localization play a critical role in ALS [ 82 ]. Notably, we documented that HML-2 possesses the capacity to modulate the immune system, primarily by inducing mediators involved in the pro-inflammatory response [ 83 ]. The mechanisms underlying the regulation of HML-2 expression remain largely unknown. However, given its consistent upregulation in various pathological contexts one potential approach to understanding its role is to investigate how its expression is controlled. Since miRNAs predominantly regulate the expression of target genes negatively, we hypothesize that miRNAs’ dysregulation may lead to a failure in the silencing of HML-2 and its consequent overexpression. In our analysis, we identified a consistent downregulation of miR-15a-3p, miR-15a-5p, miR-150-5p, miR-182-5p, miR-192-3p, and miR-221-3p in ALS patients relative to healthy controls, alongside a significant upregulation of miR-181a-2-3p. These findings suggest that specific miRNA dysregulation may actively contribute to disease pathogenesis by modulating key cellular processes, including apoptosis, neuroinflammation, and neuronal homeostasis [ 29 , 43 , 84 – 86 ]. Notably, while each of these miRNAs has been individually linked to distinct molecular pathways, their coordinated deregulation in ALS implies a broader disruption of post-transcriptional gene regulation rather than isolated molecular events. Among the downregulated miRNAs, miR-182-5p has been implicated in neuronal structural integrity and axonal growth [ 29 ], while miR-221-3p has been described as neuroprotective under cellular stress conditions, with evidence supporting its role in suppressing neuronal apoptosis and attenuating pro-inflammatory signaling [ 87 ]. Although the function of miR-192-3p remains incompletely characterized, emerging data suggest its involvement in the modulation of pro-inflammatory cytokine signaling [ 86 ], warranting further investigation of its potential role in the neuroinflammatory setting of ALS. Conversely, the upregulation of miR-181a-2-3p observed in our cohort is consistent with previous reports of elevated circulating miR-181 levels in ALS, where higher expression has been associated with accelerated disease progression and shorter survival [ 85 ]. Whether this upregulation represents a primary pathological event or a secondary compensatory response remains to be determined. Although weak, probably due to the limited number of samples, we found a negative correlation between the expression levels of miRNAs and those of HML-2- env , which is upregulated in patients compared to controls. In the correlation analysis, we observed that, unlike the others, miR-181a-2-3p shows a trend towards a positive correlation with HML-2 gene expression levels. The weak positive correlation suggests that this miRNA, although capable of binding the HML-2 transcript in silico, is unlikely to participate in the downregulation of HML-2, as both its expression and HML-2 env levels are increased in ALS patients. Nevertheless, the possibility that it may contribute to retroviral reactivation, rather than silencing, cannot be excluded. In addition, we documented that miR-221-3p can reduce HML-2 expression possibly by inhibiting translation or decreasing mRNA stability, as evidenced by the reduced levels HML-2 transcripts, especially the envelope gene, and the envelope protein. Conversely, reduced levels of miR-221-3p may result in augmentation of expression of HERV-K by relieving this post-transcriptional regulation. All the investigated miRNAs are involved in neurodegenerative processes, but for the first time, we suggest a potential role in the regulation of HML-2. It remains unclear why miRNAs are downregulated in ALS. One plausible mechanism involves the loss of TDP‑43 function, a key regulator of miRNA biogenesis. Under physiological conditions, TDP‑43 interacts with the Drosha and Dicer complexes to facilitate miRNA processing [ 88 , 89 ] both at the nuclear and cytoplasmic levels. However, in ALS, TDP‑43 frequently accumulates in the cytoplasm and forms aggregates, preventing it from carrying out its normal nuclear functions and thereby interfering with the miRNA biogenesis machinery. In parallel, increased HML‑2 expression has been shown to repress ASRGL1 [ 90 ], a gene involved in proteostasis maintenance. ASRGL1 downregulation leads to the accumulation of aberrantly modified proteins, including TDP‑43, further promoting its pathological aggregation. This creates a potential self-reinforcing loop in which miRNA downregulation permits HML-2 activation, which in turn suppresses ASRGL1 , leading to increased TDP-43 pathology and further impairment of miRNA biogenesis. Such a feedback mechanism may contribute to the selective downregulation of specific miRNAs observed in ALS and could underlie the dysregulated retroelement expression seen in this disease. However, this proposed cascade remains hypothetical and requires experimental validation. Conclusions These findings raise several hypotheses that require further validation. Confirming the existence of a feedback loop involving TDP-43 dysfunction, altered miRNA processing, and HML-2 activation will be important to better understand its relevance in ALS pathology. Despite the relevance of these findings, several limitations should be acknowledged in the interpretation of the present study. Importantly, our findings from PBMCs should be interpreted as peripheral correlates of disease-associated molecular alterations, rather than direct evidence of CNS mechanisms. The exact mechanisms through which these miRNAs might inhibit the HML-2 expression are not yet defined. The correlation observed between HML-2 env expression and miRNAs suggests a possible link, but this needs to be confirmed through further experiments. Additionally, we do not know which miRNA has the greatest influence on HML-2 expression. The selected miRNAs might act individually or, more likely, have a synergistic effect on the regulation of HML-2. However, fully understanding HML-2 regulation strategies could pave the way for new therapeutic strategies to improve patients' conditions. Supplementary Information Below is the link to the electronic supplementary material. ESM 1 (586.9KB, docx) (DOCX 586 KB) Acknowledgements This research was supported in part by the Intramural Research Program (ZIA 003130) of the National Institutes of Health (NIH), National Institute of Neurological Disorders and Stroke (NINDS). The contributions of the NIH author(s) were made as part of their official duties as NIH federal employees, are in compliance with agency policy requirements, and are considered Works of the United States Government. However, the findings and conclusions presented in this paper are those of the author(s) and do not necessarily reflect the views of the NIH or the U.S. Department of Health and Human Services. Special thanks to all the patients who made this study possible, and to Dr. Yao Lin for contributing to the creation of the figures included in this paper. Abbreviations ALS Amyotrophic lateral sclerosis HERV Human Endogenous Retrovirus Env Envelope miRNAs MicroRNAs ncRNAs Non-coding RNAs fALS Familial ALS sALS Sporadic ALS HCs Healthy controls ALS-FRS Functional rating scale PEG Percutaneous endoscopic gastrostomy NIV Non-invasive ventilation PBMCs Peripheral blood mononuclear cells No-RT No Reverse Transcriptase No-TC No Template Control DMEM Dulbecco’s Modified Eagle’s medium PDVF Polyvinylidene Difluoride PBS Phosphate buffered saline TBS Tris buffered saline SEM Standard error of the mean IQR Interquartile range 3′ UTR 3′ Untranslated region 5′ UTR 5′ Untranslated region Author Contribution Conception and design of the study: E.R.S, M.G.M, L.A.S., A.N.. Acquisition and analysis of data: E.R.S, M.G.M., L.A.S., A.N.. Drafting a significant portion of the manuscript or figures: E.R.S, M.G.M, L.A.S., A.N.. Samples and clinical data collection: E.R.S, L.S., M.C., V.C., T.E., E.R., P.S.. Funding Open access funding provided by Università degli Studi di Sassari within the CRUI-CARE Agreement. This study was funded by the European Union-E. Ins Ecosystem of Innovation For Next Generation Sardinia to LAS; Regione Autonoma Sardegna Grant: legge regionale 12 22 December 2022 n. 22 to LAS; PRIN 2022 n: 2022BP837R to LAS. Ministero Della Salute. PNRR-MCNT1-2023–12376993 to LAS. All authors have read and agreed to the published version of the manuscript. Data Availability Data sharing is not applicable to this article as no datasets were generated or analysed during the current study. Declarations Ethics Approval and Consent to Participate The study protocol received approval from the institutional review board at Sassari University Hospital (Azienda Ospedaliero-Universitaria, Sassari, Italy; IRB number 2395/2016). Written informed consent was obtained from all participants. Competing interest The authors declare no competing interests. Footnotes Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Elena Rita Simula and Marta Garcia-Montojo are contributed equally to this work. Contributor Information Avindra Nath, Email: [email protected]. Leonardo Antonio Sechi, Email: [email protected]. References 1. Wijesekera LC, Leigh NP (2009) Amyotrophic lateral sclerosis. Orphanet J Rare Dis 4:3. 10.1186/1750-1172-4-3 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 2. Jankovska N, Matej R (2021) Molecular pathology of ALS: what we currently know and what important information is still missing. Diagnostics (Basel, Switzerland) 11. 10.3390/diagnostics11081365 [ DOI ] [ PMC free article ] [ PubMed ] 3. Hu Y, Chen W, Wei C et al (2024) Pathological mechanisms of amyotrophic lateral Sclerosis. Neural Regen Res 19:1036–1044. 10.4103/1673-5374.382985 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 4. Butti Z, Patten SA (2018) RNA Dysregulation in amyotrophic lateral sclerosis. Front Genet 9:712. 10.3389/fgene.2018.00712 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 5. Berth SH, Lloyd TE (2023) Disruption of axonal transport in neurodegeneration. J Clin Invest 133. 10.1172/JCI168554 [ DOI ] [ PMC free article ] [ PubMed ] 6. Ungaro C, Sprovieri T, Morello G et al (2021) Genetic investigation of amyotrophic lateral sclerosis patients in south Italy: a two-decade analysis. Neurobiol Aging 99:99.e7-99.e14. 10.1016/j.neurobiolaging.2020.08.017 [ DOI ] [ PubMed ] [ Google Scholar ] 7. Bagyinszky E, Hulme J, Ssa An (2023) Studies of genetic and proteomic risk factors of amyotrophic lateral sclerosis inspire biomarker development and gene therapy. Cells. 10.3390/cells12151948 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 8. Li W, Lee MH, Henderson L et al (2015) Human endogenous retrovirus-K contributes to motor neuron disease. Sci Transl Med 7. 10.1126/scitranslmed.aac8201 [ DOI ] [ PMC free article ] [ PubMed ] 9. Steiner JP, Bachani M, Malik N et al (2022) Human endogenous retrovirus k envelope in spinal fluid of amyotrophic lateral sclerosis is toxic. Ann Neurol 92:545–561. 10.1002/ana.26452 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 10. Wood H (2015) Human endogenous retrovirus-K activation is implicated in amyotrophic lateral sclerosis. Nat Rev Neurol 11:666. 10.1038/nrneurol.2015.206 [ DOI ] [ PubMed ] [ Google Scholar ] 11. Wang T, Medynets M, Johnson KR et al (2020) Regulation of stem cell function and neuronal differentiation by HERV-K via mTOR pathway. Proc Natl Acad Sci U S A 117:17842–17853. 10.1073/pnas.2002427117 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 12. Mayer J, Harz C, Sanchez L et al (2018) Transcriptional profiling of HERV-K(HML-2) in amyotrophic lateral sclerosis and potential implications for expression of HML-2 proteins. Mol Neurodegener 13:39. 10.1186/s13024-018-0275-3 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 13. Dembny P, Newman AG, Singh M et al (2020) Human endogenous retrovirus HERV-K(HML-2) RNA causes neurodegeneration through Toll-like receptors. JCI insight 5. 10.1172/jci.insight.131093 [ DOI ] [ PMC free article ] [ PubMed ] 14. Garcia-Montojo M, Doucet-O’Hare T, Henderson L, Nath A (2018) Human endogenous retrovirus-K (HML-2): a comprehensive review. Crit Rev Microbiol 44:715–738. 10.1080/1040841X.2018.1501345 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 15. Medstrand P, Mager DL (1998) Human-specific integrations of the HERV-K endogenous retrovirus family. J Virol 72:9782–9787. 10.1128/JVI.72.12.9782-9787.1998 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 16. Noli M, Meloni G, Ruberto S et al (2022) HERV-K Envelope protein induces long-lasting production of autoantibodies in T1DM patients at onset in comparison to ZNT8 autoantibodies. Pathog (Basel, Switzerland). 10.3390/pathogens11101188 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 17. Carta A, Manca MA, Scoppola C et al (2022) Antihuman endogenous retrovirus immune response and adaptive dysfunction in autism. Biomedicines. 10.3390/biomedicines10061365 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 18. Manca MA, Simula ER, Cossu D et al (2023) Association of HLA-A*11:01, -A*24:02, and -B*18:01 with prostate cancer risk: a case-control study. Int J Mol Sci. 10.3390/ijms242015398 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 19. Phan K, He Y, Fu Y et al (2021) Pathological manifestation of human endogenous retrovirus K in frontotemporal dementia. Commun Med. 10.1038/s43856-021-00060-w [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 20. Chang Y-H, Dubnau J (2023) Endogenous retroviruses and TDP-43 proteinopathy form a sustaining feedback driving intercellular spread of Drosophila neurodegeneration. Nat Commun 14:966. 10.1038/s41467-023-36649-z [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 21. Fu X-D (2014) Non-coding RNA: a new frontier in regulatory biology. Natl Sci Rev 1:190–204. 10.1093/nsr/nwu008 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 22. Simula ER, Jasemi S, Paulus K, Sechi LA (2024) Upregulation of microRNAs correlates with downregulation of HERV-K expression in Parkinson’s disease. J Neurovirol 30:550–555. 10.1007/s13365-024-01234-7 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 23. Otmani K, Lewalle P (2021) Tumor suppressor miRNA in cancer cells and the tumor microenvironment: mechanism of deregulation and clinical implications. Front Oncol 11. 10.3389/fonc.2021.708765 [ DOI ] [ PMC free article ] [ PubMed ] 24. Han Q, Gao L, Chen L (2025) The role of deregulated microRNAs in immune cells of Sjögren’s disease. Int J Gen Med 18:847–855. 10.2147/IJGM.S504780 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 25. Dexheimer PJ, Cochella L (2020) MicroRNAs: from mechanism to organism. Front Cell Dev Biol 8. 10.3389/fcell.2020.00409 [ DOI ] [ PMC free article ] [ PubMed ] 26. Valinezhad Orang A, Safaralizadeh R, Kazemzadeh-Bavili M (2014) Mechanisms of miRNA-mediated gene regulation from common downregulation to mRNA-specific upregulation. Int J Genomics 2014:970607. 10.1155/2014/970607 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 27. Campos-Melo D, Droppelmann CA, He Z et al (2013) Altered microRNA expression profile in Amyotrophic Lateral Sclerosis: a role in the regulation of NFL mRNA levels. Mol Brain 6:26. 10.1186/1756-6606-6-26 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 28. Figueroa-Romero C, Hur J, Lunn JS et al (2016) Expression of microRNAs in human post-mortem amyotrophic lateral sclerosis spinal cords provides insight into disease mechanisms. Mol Cell Neurosci 71:34–45. 10.1016/j.mcn.2015.12.008 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 29. Soto A, Nieto-Díaz M, Reigada D et al (2022) miR-182-5p regulates Nogo-A expression and promotes neurite outgrowth of hippocampal neurons in vitro. Pharmaceuticals (Basel). 10.3390/ph15050529 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 30. Chen Q, Deng N, Lu K et al (2021) Elevated plasma miR-133b and miR-221-3p as biomarkers for early Parkinson’s disease. Sci Rep 11:15268. 10.1038/s41598-021-94734-z [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 31. Bekris LM, Lutz F, Montine TJ et al (2013) Microrna in Alzheimer’s disease: an exploratory study in brain, cerebrospinal fluid and plasma. Biomarkers 18:455–466. 10.3109/1354750X.2013.814073 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 32. Li H, Yu L, Li M et al (2020) Microrna-150 serves as a diagnostic biomarker and is involved in the inflammatory pathogenesis of Parkinson’s disease. Mol Genet Genomic Med 8:e1189. 10.1002/mgg3.1189 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 33. Braun CJ, Zhang X, Savelyeva I et al (2008) P53-responsive micrornas 192 and 215 are capable of inducing cell cycle arrest. Cancer Res 68:10094–10104. 10.1158/0008-5472.CAN-08-1569 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 34. Lee YN, Bieniasz PD (2007) Reconstitution of an infectious human endogenous retrovirus. PLoS Pathog 3:1–12. 10.1371/journal.ppat.0030010 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 35. Moncini S, Lunghi M, Valmadre A et al (2017) The miR-15/107 family of microRNA genes regulates CDK5R1/p35 with implications for Alzheimer’s disease pathogenesis. Mol Neurobiol 54:4329–4342. 10.1007/s12035-016-0002-4 [ DOI ] [ PubMed ] [ Google Scholar ] 36. Liguori M, Nuzziello N, Introna A et al (2018) Dysregulation of microRNAs and target genes networks in peripheral blood of patients with sporadic amyotrophic lateral sclerosis. Front Mol Neurosci 11:288. 10.3389/fnmol.2018.00288 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 37. Foggin S, Mesquita-Ribeiro R, Dajas-Bailador F, Layfield R (2019) Biological significance of microRNA biomarkers in ALS—innocent bystanders or disease culprits? Front Neurol 10. 10.3389/fneur.2019.00578 [ DOI ] [ PMC free article ] [ PubMed ] 38. Li N, Pan J, Liu W et al (2020) Microrna-15a-5p serves as a potential biomarker and regulates the viability and apoptosis of hippocampus neuron in children with temporal lobe epilepsy. Diagn Pathol 15:46. 10.1186/s13000-020-00944-w [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 39. Recabarren-Leiva D, Alarcón M (2018) New insights into the gene expression associated to amyotrophic lateral sclerosis. Life Sci 193:110–123. 10.1016/j.lfs.2017.12.016 [ DOI ] [ PubMed ] [ Google Scholar ] 40. Saucier D, Wajnberg G, Roy J et al (2019) Identification of a circulating miRNA signature in extracellular vesicles collected from amyotrophic lateral sclerosis patients. Brain Res 1708:100–108. 10.1016/j.brainres.2018.12.016 [ DOI ] [ PubMed ] [ Google Scholar ] 41. Waller R, Wyles M, Heath PR et al (2017) Small RNA sequencing of sporadic amyotrophic lateral sclerosis cerebrospinal fluid reveals differentially expressed miRNAs related to neural and glial activity. Front Neurosci 11:731. 10.3389/fnins.2017.00731 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 42. Hu Z, Cui Y, Qiao X et al (2018) Silencing miR-150 Ameliorates experimental autoimmune encephalomyelitis. Front Neurosci 12 10.3389/fnins.2018.00465 [ DOI ] [ PMC free article ] [ PubMed ] 43. Magen I, Yacovzada NS, Yanowski E et al (2021) Circulating miR-181 is a prognostic biomarker for amyotrophic lateral sclerosis. Nat Neurosci 24:1534–1541. 10.1038/s41593-021-00936-z [ DOI ] [ PubMed ] [ Google Scholar ] 44. Stein CS, McLendon JM, Witmer NH, Boudreau RL (2022) Modulation of miR-181 influences dopaminergic neuronal degeneration in a mouse model of Parkinson’s disease. Mol Ther Nucleic Acids 28:1–15. 10.1016/j.omtn.2022.02.007 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 45. Jawaid A, Woldemichael BT, Kremer EA et al (2019) Memory decline and its reversal in aging and neurodegeneration involve miR-183/96/182 biogenesis. Mol Neurobiol 56:3451–3462. 10.1007/s12035-018-1314-3 [ DOI ] [ PubMed ] [ Google Scholar ] 46. Wang WM, Lu G, Su XW et al (2017) MicroRNA-182 regulates neurite outgrowth involving the PTEN/AKT pathway. Front Cell Neurosci 11:96. 10.3389/fncel.2017.00096 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 47. Qin Z, Han X, Ran J et al (2021) Exercise-mediated alteration of miR-192-5p is associated with cognitive improvement in Alzheimer’s disease. NeuroImmunoModulation 29:36–43. 10.1159/000516928 [ DOI ] [ PubMed ] [ Google Scholar ] 48. Pegoraro V, Merico A, Angelini C (2017) Micro-RNAs in ALS muscle: differences in gender, age at onset and disease duration. J Neurol Sci 380:58–63. 10.1016/j.jns.2017.07.008 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 49. Joilin G, Gray E, Thompson AG et al (2020) Identification of a potential non-coding RNA biomarker signature for amyotrophic lateral sclerosis. Brain Commun 2:fcaa053. 10.1093/braincomms/fcaa053 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 50. Catanesi M, d’Angelo M, Tupone MG et al (2020) MicroRNAs dysregulation and mitochondrial dysfunction in neurodegenerative diseases. Int J Mol Sci. 10.3390/ijms21175986 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 51. Kovanda A, Leonardis L, Zidar J et al (2018) Differential expression of microRNAs and other small RNAs in muscle tissue of patients with ALS and healthy age-matched controls. Sci Rep 8:5609. 10.1038/s41598-018-23139-2 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 52. Roser A-E, Caldi Gomes L, Halder R et al (2018) miR-182-5p and miR-183-5p act as GDNF mimics in dopaminergic midbrain neurons. Mol Ther Nucleic Acids 11:9–22. 10.1016/j.omtn.2018.01.005 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 53. Paez-Colasante X, Figueroa-Romero C, Rumora AE et al (2020) Cytoplasmic TDP43 binds microRNAs: new disease targets in amyotrophic lateral sclerosis. Front Cell Neurosci 14:117. 10.3389/fncel.2020.00117 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 54. D’Erchia AM, Gallo A, Manzari C et al (2017) Massive transcriptome sequencing of human spinal cord tissues provides new insights into motor neuron degeneration in ALS. Sci Rep 7:10046. 10.1038/s41598-017-10488-7 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 55. Di Pietro L, Lattanzi W, Bernardini C (2018) Skeletal muscle microRNAs as key players in the pathogenesis of amyotrophic lateral sclerosis. Int J Mol Sci. 10.3390/ijms19051534 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 56. Li J, Li Q, Huang H et al (2017) Overexpression of miRNA-221 promotes cell proliferation by targeting the apoptotic protease activating factor-1 and indicates a poor prognosis in ovarian cancer. Int J Oncol 50:1087–1096. 10.3892/ijo.2017.3898 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 57. Liu S, Liu H, Deng M, Wang H (2020) MiR-182 promotes glioma progression by targeting FBXW7. J Neurol Sci 411:116689. 10.1016/j.jns.2020.116689 [ DOI ] [ PubMed ] [ Google Scholar ] 58. Huntzinger E, Izaurralde E (2011) Gene silencing by microRNAs: contributions of translational repression and mRNA decay. Nat Rev Genet 12:99–110. 10.1038/nrg2936 [ DOI ] [ PubMed ] [ Google Scholar ] 59. Ipsaro JJ, Joshua-Tor L (2015) From guide to target: molecular insights into eukaryotic RNA-interference machinery. Nat Struct Mol Biol 22:20–28. 10.1038/nsmb.2931 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 60. Zhang J, Zhou W, Liu Y et al (2018) Oncogenic role of microRNA-532-5p in human colorectal cancer via targeting of the 5’UTR of RUNX3. Oncol Lett 15:7215–7220. 10.3892/ol.2018.8217 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 61. Stroynowska-Czerwinska A, Fiszer A, Krzyzosiak WJ (2014) The panorama of miRNA-mediated mechanisms in mammalian cells. Cell Mol Life Sci 71:2253–2270. 10.1007/s00018-013-1551-6 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 62. Dharap A, Pokrzywa C, Murali S et al (2013) MicroRNA miR-324-3p induces promoter-mediated expression of RelA gene. PLoS ONE 8:e79467. 10.1371/journal.pone.0079467 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 63. Huang J, Wang F, Argyris E et al (2007) Cellular microRNAs contribute to HIV-1 latency in resting primary CD4+ T lymphocytes. Nat Med 13:1241–1247. 10.1038/nm1639 [ DOI ] [ PubMed ] [ Google Scholar ] 64. Sung T-L, Rice AP (2009) miR-198 inhibits HIV-1 gene expression and replication in monocytes and its mechanism of action appears to involve repression of cyclin T1. PLoS Pathog 5:e1000263. 10.1371/journal.ppat.1000263 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 65. Swaminathan G, Navas-Martín S, Martín-García J (2014) MicroRNAs and HIV-1 infection: antiviral activities and beyond. J Mol Biol 426:1178–1197. 10.1016/j.jmb.2013.12.017 [ DOI ] [ PubMed ] [ Google Scholar ] 66. Tang X, Sun C (2020) The roles of MicroRNAs in neural regenerative medicine. Exp Neurol 332:113394. 10.1016/j.expneurol.2020.113394 [ DOI ] [ PubMed ] [ Google Scholar ] 67. Smirnova L, Gräfe A, Seiler A et al (2005) Regulation of miRNA expression during neural cell specification. Eur J Neurosci 21:1469–1477. 10.1111/j.1460-9568.2005.03978.x [ DOI ] [ PubMed ] [ Google Scholar ] 68. Cho KHT, Xu B, Blenkiron C, Fraser M (2019) Emerging roles of miRNAs in brain development and perinatal brain injury. Front Physiol 10:227. 10.3389/fphys.2019.00227 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 69. Rashidi SK, Kalirad A, Rafie S et al (2023) The role of microRNAs in neurobiology and pathophysiology of the hippocampus. Front Mol Neurosci 16:1226413. 10.3389/fnmol.2023.1226413 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 70. Maity D, Kaundal RK (2025) Exploring dysregulated miRNAs in ALS: implications for disease pathogenesis and early diagnosis. Neurol Sci 46:1661–1686. 10.1007/s10072-024-07840-x [ DOI ] [ PubMed ] [ Google Scholar ] 71. Haramati S, Chapnik E, Sztainberg Y et al (2010) miRNA malfunction causes spinal motor neuron disease. Proc Natl Acad Sci U S A 107:13111–13116. 10.1073/pnas.1006151107 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 72. Si Y, Cui X, Crossman DK et al (2018) Muscle microrna signatures as biomarkers of disease progression in amyotrophic lateral sclerosis. Neurobiol Dis 114:85–94. 10.1016/j.nbd.2018.02.009 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 73. Katsu M, Hama Y, Utsumi J et al (2019) Microrna expression profiles of neuron-derived extracellular vesicles in plasma from patients with amyotrophic lateral sclerosis. Neurosci Lett 708:134176. 10.1016/j.neulet.2019.03.048 [ DOI ] [ PubMed ] [ Google Scholar ] 74. Aqeilan RI, Calin GA, Croce CM (2010) miR-15a and miR-16-1 in cancer: discovery, function and future perspectives. Cell Death Differ 17:215–220. 10.1038/cdd.2009.69 [ DOI ] [ PubMed ] [ Google Scholar ] 75. Pekarsky Y, Balatti V, Croce CM (2018) BCL2 and miR-15/16: from gene discovery to treatment. Cell Death Differ 25:21–26. 10.1038/cdd.2017.159 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 76. Vogler M, Braun Y, Smith VM et al (2025) The BCL2 family: from apoptosis mechanisms to new advances in targeted therapy. Signal Transduct Target Ther 10:91. 10.1038/s41392-025-02176-0 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 77. He W, Meng D-L, Yang D et al (2023) miRNA-192-5p targets Dyrk1a to attenuate cerebral injury in MCAO mice by suppressing neuronal apoptosis and neuroinflammation. Folia Histochem Cytobiol 61:217–230. 10.5603/fhc.96703 [ DOI ] [ PubMed ] [ Google Scholar ] 78. Douville R, Liu J, Rothstein J, Nath A (2011) Identification of active loci of a human endogenous retrovirus in neurons of patients with amyotrophic lateral sclerosis. Ann Neurol 69:141–151. 10.1002/ana.22149 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 79. Li Y, Chen Y, Zhang N, Fan D (2022) Human endogenous retrovirus K (HERV-K) env in neuronal extracellular vesicles: a new biomarker of motor neuron disease. Amyotroph Lateral Scler Frontotemporal Degener 23:100–107. 10.1080/21678421.2021.1936061 [ DOI ] [ PubMed ] [ Google Scholar ] 80. Garcia-Montojo M, Simula ER, Fathi S et al (2022) Antibody response to HML-2 may be protective in amyotrophic lateral sclerosis. Ann Neurol 92:782–792. 10.1002/ana.26466 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 81. Simula ER, Arru G, Zarbo IR et al (2021) Tdp‐43 and herv‐k envelope‐specific immunogenic epitopes are recognized in als patients. Viruses. 10.3390/v13112301 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 82. Wang X, Hu Y, Xu R (2024) The pathogenic mechanism of TAR DNA-binding protein 43 (TDP-43) in amyotrophic lateral sclerosis. Neural Regen Res 19:800–806. 10.4103/1673-5374.382233 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 83. Arru G, Galleri G, Deiana GA et al (2021) Herv-k modulates the immune response in als patients. Microorganisms. 10.3390/microorganisms9081784 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 84. Cimmino A, Calin GA, Fabbri M et al (2005) MiR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci U S A 102:13944–13949. 10.1073/pnas.0506654102 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 85. Wang Q, Tian X, Lu Q et al (2022) Study on the ameliorating effect of miR-221-3p on the nerve cells injury induced by sevoflurane. Int J Neurosci 132:181–191. 10.1080/00207454.2020.1806267 [ DOI ] [ PubMed ] [ Google Scholar ] 86. Wang Z, Miu K-K, Zhang X et al (2020) Hepatic miR-192-3p reactivation alleviates steatosis by targeting glucocorticoid receptor. JHEP Rep Innov Hepatol 2:100179. 10.1016/j.jhepr.2020.100179 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 87. Shan Y, Hu J, Lv H et al (2021) MiR-221 exerts neuroprotective effects in ischemic stroke by inhibiting the proinflammatory response. J Stroke Cerebrovasc Dis 30:105489. 10.1016/j.jstrokecerebrovasdis.2020.105489 [ DOI ] [ PubMed ] [ Google Scholar ] 88. Kawahara Y, Mieda-Sato A (2012) TDP-43 promotes microRNA biogenesis as a component of the Drosha and Dicer complexes. Proc Natl Acad Sci U S A 109:3347–3352. 10.1073/pnas.1112427109 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 89. Hawley ZCE, Campos-Melo D, Strong MJ (2020) Evidence of a negative feedback network between TDP-43 and miRNAs dependent on TDP-43 nuclear localization. J Mol Biol 432:166695. 10.1016/j.jmb.2020.10.029 [ DOI ] [ PubMed ] [ Google Scholar ] 90. Garcia-Montojo M, Fathi S, Rastegar C et al (2024) TDP-43 proteinopathy in ALS is triggered by loss of ASRGL1 and associated with HML-2 expression. Nat Commun 15:4163. 10.1038/s41467-024-48488-7 [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Associated Data This section collects any data citations, data availability statements, or supplementary materials included in this article. Supplementary Materials ESM 1 (586.9KB, docx) (DOCX 586 KB) Data Availability Statement Data sharing is not applicable to this article as no datasets were generated or analysed during the current study. Articles from Molecular Neurobiology are provided here courtesy of Springer ACTIONS View on publisher site PDF (1.9 MB) Cite Collections Permalink PERMALINK Copy RESOURCES Similar articles Cited by other articles Links to NCBI Databases Cite Copy Download .nbib .nbib Format: AMA APA MLA NLM Add to Collections Create a new collection Add to an existing collection Name your collection * Choose a collection Unable to load your collection due to an error Please try again Add Cancel Follow NCBI NCBI on X (formerly known as Twitter) NCBI on Facebook NCBI on LinkedIn NCBI on GitHub NCBI RSS feed Connect with NLM NLM on X (formerly known as Twitter) NLM on Facebook NLM on YouTube National Library of Medicine 8600 Rockville Pike Bethesda, MD 20894 Web Policies FOIA HHS Vulnerability Disclosure Help Accessibility Careers NLM NIH HHS USA.gov Back to Top

Record · ID 30637 · SHA-256 4ec5b767fc5497ec
Retrieved via Conceptio — every document is proof-bundled with source, license, and retrieval metadata.