Synaptojanin-2-binding protein ameliorates oxidative stress, neuroinflammation and depression-like behaviors via SYNJ2/PIP(2)/IP(3) signaling pathway.

Synaptojanin-2-binding protein ameliorates oxidative stress, neuroinflammation and depression-like behaviors via SYNJ2/PIP2/IP3 signaling pathway - PMC Skip to main content An official website of the United States government Here's how you know Here's how you know Official websites use .gov A .gov website belongs to an official government organization in the United States. Secure .gov websites use HTTPS A lock ( Lock Locked padlock icon ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites. Search Log in Dashboard Publications Account settings Log out Search… Search NCBI Primary site navigation Search Logged in as: Dashboard Publications Account settings Log in Search PMC Full-Text Archive Search in PMC Journal List User Guide PERMALINK Copy As a library, NLM provides access to scientific literature. Inclusion in an NLM database does not imply endorsement of, or agreement with, the contents by NLM or the National Institutes of Health. Learn more: PMC Disclaimer | PMC Copyright Notice Redox Biol . 2026 Apr 7;93:104154. doi: 10.1016/j.redox.2026.104154 Search in PMC Search in PubMed View in NLM Catalog Add to search Synaptojanin-2-binding protein ameliorates oxidative stress, neuroinflammation and depression-like behaviors via SYNJ2/PIP 2 /IP 3 signaling pathway Wenjing Wang Wenjing Wang a School of Basic Medical Sciences, Qilu Hospital (Qingdao), Cheeloo College of Medicine, Shandong University, 250012, China b Department of Physiology, School of Basic Medical Sciences, Cheeloo College of Medicine, Shandong University, Jinan, 250012, China c Department of Medical Psychology and Ethics, School of Basic Medical Sciences, Cheeloo College of Medicine, Shandong University, Jinan, 250012, China Find articles by Wenjing Wang a, b, c , Xiao Chen Xiao Chen a School of Basic Medical Sciences, Qilu Hospital (Qingdao), Cheeloo College of Medicine, Shandong University, 250012, China b Department of Physiology, School of Basic Medical Sciences, Cheeloo College of Medicine, Shandong University, Jinan, 250012, China c Department of Medical Psychology and Ethics, School of Basic Medical Sciences, Cheeloo College of Medicine, Shandong University, Jinan, 250012, China Find articles by Xiao Chen a, b, c , Ye Li Ye Li a School of Basic Medical Sciences, Qilu Hospital (Qingdao), Cheeloo College of Medicine, Shandong University, 250012, China b Department of Physiology, School of Basic Medical Sciences, Cheeloo College of Medicine, Shandong University, Jinan, 250012, China c Department of Medical Psychology and Ethics, School of Basic Medical Sciences, Cheeloo College of Medicine, Shandong University, Jinan, 250012, China Find articles by Ye Li a, b, c , Changmin Wang Changmin Wang a School of Basic Medical Sciences, Qilu Hospital (Qingdao), Cheeloo College of Medicine, Shandong University, 250012, China b Department of Physiology, School of Basic Medical Sciences, Cheeloo College of Medicine, Shandong University, Jinan, 250012, China c Department of Medical Psychology and Ethics, School of Basic Medical Sciences, Cheeloo College of Medicine, Shandong University, Jinan, 250012, China Find articles by Changmin Wang a, b, c , Mengni Chang Mengni Chang a School of Basic Medical Sciences, Qilu Hospital (Qingdao), Cheeloo College of Medicine, Shandong University, 250012, China b Department of Physiology, School of Basic Medical Sciences, Cheeloo College of Medicine, Shandong University, Jinan, 250012, China c Department of Medical Psychology and Ethics, School of Basic Medical Sciences, Cheeloo College of Medicine, Shandong University, Jinan, 250012, China Find articles by Mengni Chang a, b, c , Ruojing Guo Ruojing Guo a School of Basic Medical Sciences, Qilu Hospital (Qingdao), Cheeloo College of Medicine, Shandong University, 250012, China b Department of Physiology, School of Basic Medical Sciences, Cheeloo College of Medicine, Shandong University, Jinan, 250012, China c Department of Medical Psychology and Ethics, School of Basic Medical Sciences, Cheeloo College of Medicine, Shandong University, Jinan, 250012, China Find articles by Ruojing Guo a, b, c , Penghui Wei Penghui Wei d Department of Anesthesiology, Qilu Hospital (Qingdao), Cheeloo College of Medicine, Shandong University, Qingdao, 266035, China Find articles by Penghui Wei d, ⁎ , Zhipeng Xu Zhipeng Xu d Department of Anesthesiology, Qilu Hospital (Qingdao), Cheeloo College of Medicine, Shandong University, Qingdao, 266035, China Find articles by Zhipeng Xu d, ⁎⁎ , Shuyan Yu Shuyan Yu a School of Basic Medical Sciences, Qilu Hospital (Qingdao), Cheeloo College of Medicine, Shandong University, 250012, China c Department of Medical Psychology and Ethics, School of Basic Medical Sciences, Cheeloo College of Medicine, Shandong University, Jinan, 250012, China e Shandong Key Laboratory of Neurorehabilitation, University of Health and Rehabilitation Sciences, Qingdao, 266113, China Find articles by Shuyan Yu a, c, e, ⁎⁎⁎ Author information Article notes Copyright and License information a School of Basic Medical Sciences, Qilu Hospital (Qingdao), Cheeloo College of Medicine, Shandong University, 250012, China b Department of Physiology, School of Basic Medical Sciences, Cheeloo College of Medicine, Shandong University, Jinan, 250012, China c Department of Medical Psychology and Ethics, School of Basic Medical Sciences, Cheeloo College of Medicine, Shandong University, Jinan, 250012, China d Department of Anesthesiology, Qilu Hospital (Qingdao), Cheeloo College of Medicine, Shandong University, Qingdao, 266035, China e Shandong Key Laboratory of Neurorehabilitation, University of Health and Rehabilitation Sciences, Qingdao, 266113, China ⁎ Corresponding author. [email protected] ⁎⁎ Corresponding author. [email protected] ⁎⁎⁎ Corresponding author.School of Basic Medical sciences, Qilu Hospital (Qingdao), Cheeloo College of Medicine, Shandong University, 250012, China [email protected] Received 2026 Jan 29; Revised 2026 Mar 19; Accepted 2026 Apr 3; Collection date 2026 Jun. © 2026 The Authors This is an open access article under the CC BY-NC license (http://creativecommons.org/licenses/by-nc/4.0/). PMC Copyright notice PMCID: PMC13091457  PMID: 41955750 Abstract Depression is a neuro-psychiatric disorder that seriously impairs human physical and mental health. Its clinical treatment effect is not satisfactory and the pathogenesis is unclear. Therefore, it is urgent to clarify its pathological mechanism to provide a new direction for the treatment of depression. The “pathological triad”, comprising oxidative stress (an imbalance between reactive oxygen species and antioxidant defenses), neuroinflammation (inflammatory responses within the central nervous system), and apoptosis (programmed cell death), has emerged as a central mechanistic driver underlying the pathophysiology of depression. The present study found that chronic unpredictable mild stress (CUMS) drives a significant down-regulation of the synaptojanin-2-binding protein (SYNJ2BP) expression in hippocampal CA1 subregion. Overexpression of SYNJ2BP mitigates oxidative stress, neuroinflammation, neuronal apoptosis and synaptic structural impairment, while concurrently ameliorating depressive- and anxiety-like phenotypes by interacting with SYNJ2 to modulate phosphatidylinositol 4,5-bisphosphate (PIP 2 )/inositol 1,4,5-trisphosphate (IP 3 ) metabolism, and subsequently suppress downstream p38/JNK signaling cascades. Conversely, SYNJ2BP knockdown or exogenous PIP 2 administration abrogates these protective effects, whereas inhibition of IP 3 signaling recapitulates the beneficial outcomes of SYNJ2BP overexpression. Collectively, our findings reveal a new SYNJ2BP/SYNJ2/PIP 2 /IP 3 signaling axis in neurons of hippocampal CA1 subregion that critically mediates CUMS-induced neuronal damage and emotional behavioral deficits, thereby potentially providing therapeutic targets for depression treatment. Keywords: Depression, Oxidative stress, Neuroinflammation, Apoptosis, Synaptojanin-2-binding protein Graphical abstract Open in a new tab Highlights • Chronic stress down-regulated the synaptojanin-2-binding protein (SYNJ2BP) expression in hippocampal CA1 subregion. • SYNJ2BP improves depression-like behaviors via suppressing oxidative stress, neuroinflammation, and apoptosis. • SYNJ2BP exerts neuroprotection by inhibiting the PIP2-IP3-p38/JNK signaling pathway in the hippocampus. • Inhibition of IP3 signaling ameliorates neuronal damage and depressive-like behaviors in mice. 1. Introduction Depression is a prevalent neuropsychiatric disorder characterized by persistent depressive mood and impairments in daily functional performance, accompanied by high rates of disability, suicide, and recurrence, imposing a substantial global burden [ [1] , [2] , [3] ]. Given its complex pathogenesis and limited efficacy of current clinical interventions, further elucidation of its underlying mechanisms is urgently needed [ 4 , 5 ]. Accumulating evidence supports the notion that the “pathological triad”, including oxidative stress, neuroinflammation, and programmed cell apoptosis, acts as a central mechanistic driver in the pathophysiology of depression [ 6 , 7 ]. Clinical studies have demonstrated elevated oxidative damage biomarkers (e.g., malondialdehyde [MDA], 8-hydroxy-2′-deoxyguanosine [8-OHdG]) and reduced antioxidant defenses (e.g., superoxide dismutase [SOD], glutathione [GSH]) in both peripheral and central biofluids of patients with major depressive disorder (MDD) [ [8] , [9] , [10] , [11] ]. Notably, chronic stress exposure induces sustained overactivation of microglia, the resident immune cells of the CNS, which in turn triggers the release of pro-inflammatory cytokines (e.g., tumor necrosis factor-α [TNF-α], interleukin-1β [IL-1β]), a key event linking neuroinflammation to depressive-like phenotypes [ [12] , [13] , [14] ]. Concomitantly, mitochondrial dysfunction and impaired antioxidant defense capacity drive a surge in oxidative stress, culminating in the overproduction of reactive oxygen species (ROS) [ 15 , 16 ]. These two processes, oxidative stress and neuroinflammation, rapidly couple and mutually amplified. The inflammatory signaling exacerbates oxidative damage, while oxidative byproducts in turn potentiate pro-inflammatory responses, thereby forming a self-reinforcing toxic positive feedback loop. This feedforward cycle then triggers neuronal apoptosis in emotion- and cognition-related brain regions (e.g., hippocampus, prefrontal cortex), which sequentially induces synaptic loss, reduced neurogenesis, and ultimately neuronal death. Collectively, these pathological events may lead to irreversible structural impairment of neural circuits, a critical mechanism underlying the pathophysiology of depression [ [17] , [18] , [19] ]. In the present study, we investigated the molecular mechanisms underlying chronic unpredictable mild stress (CUMS)-induced depressive-like behaviors, focusing on the functional role of synaptojanin-2-binding protein (SYNJ2BP) in neurons of the hippocampal CA1 subregion. We found that CUMS exposure drives significant downregulation of SYNJ2BP expression in neurons of the hippocampal CA1, while overexpression of SYNJ2BP mitigates oxidative stress, neuroinflammation, neuronal apoptosis, synaptic structural impairment, and concurrently ameliorates depressive- and anxiety-like behaviors by interacting with SYNJ2 to modulate phosphatidylinositol 4,5-bisphosphate (PIP 2 )/inositol 1,4,5-trisphosphate (IP 3 ) metabolism, which then suppress downstream p38/JNK signaling cascades. In conclusion, these results put new insights into the mechanisms underlying the CUMS-induced neuronal damage and emotional behavioral deficits, and provide potentially therapeutic targets for depression. 2. Materials and methods 2.1. Animals All experiments were approved by the Shandong University Institutional Animal Care and Use Committee (ECSBMSSDU-2022-2-65). Unless otherwise stated, 6-8 weeks male C57BL/6 mice (purchased from Jinan Pengyue Laboratory Animal Breeding Co., Ltd.) were randomly assigned to the control group or experimental group. All mice were housed under standardized conditions, including a temperature of 22 °C, a 12-h light-dark cycle, and unrestricted access to food and water. 2.2. CUMS depression model As previously described [ 20 , 21 ], CUMS consisted of the following stressors: 24 h food deprivation, 30-s tail pinch, 24 h water deprivation, 24 h exposure to a pungent odor (camphor), 0.5-mA foot shock (0.5 s duration), 8-h cage tilt (45°), 24-h light-dark cycle reversal, 24-h wet bedding, and 2-4 h physical restraint. These stressors were randomly assigned to the CUMS group once daily for 6 consecutive weeks. Mice in the control group were housed under identical conditions but without exposure to any stressors. 2.3. Stereotaxic surgery and virus injection Stereotactic brain surgery was performed as previously described, with minor modifications [ 22 , 23 ]. Mice were anesthetized with sodium pentobarbital (40 mg/kg, i.p.) and secured in a stereotaxic frame (Stoelting, USA) for stereotactic viral delivery. Using the microsyringe (Hamilton, Fisher Labs), bilateral injections of pAAV-hSyn-Synj2bp-eGFP (AAV2/9, 4.65 x 10 12 vg/mL) and pAAV-hSyn-eGFP (AAV2/9, 1.28 x 10 12 vg/mL) were administered into the hippocampal CA1 region, the following coordinates relative to bregma: anteroposterior (AP), −2 mm; mediolateral (ML), ±1.5 mm; dorsoventral (DV), −1.5 mm. Viruses (1 μL per hemisphere, titer range: 1 x 10 12 -1 x 10 13 IU/mL) were infused slowly at a rate of 0.1 μL/min. Twenty-one days post-injection, viral transduction efficiency was assessed and injection sites were verified histologically; only data from animals with correctly targeted injections were included in subsequent analyses. Viruses were custom-produced by GeneChem (Shanghai, China). 2.4. Drug administration The same as mentioned above, with only minor modifications [ 24 , 25 ]. PtdIns-(4,5)-P2 (1,2-dihexanoyl) sodium salt (Catalog No.: HY-175067, MedChemExpress) is a synthetic analog of natural phosphatidylinositol. Either PIP2 (400 μM, dissolved in normal saline) or its vehicle (normal saline) was administered bilaterally into the dorsal CA1 region of the hippocampus at a volume of 0.5 μL per side. The treatment regimen consisted of one administration every 72 h for a total of three consecutive sessions. The same as mentioned above, with only minor modifications [ 26 ]0.2-Aminoethyldiphenylborinate (2-APB; Catalog No.: HY-W009724, MedChemExpress), an inositol 1,4,5-trisphosphate (IP 3 ) receptor antagonist at a concentration of 500 μM dissolved in 10% dimethyl sulfoxide (DMSO), or its vehicle control (10% DMSO alone), was bilaterally administered into the dorsal CA1 region of the hippocampus at a volume of 0.5 μL per side. The treatment regimen consisted of one administration every 72 h for a total of three consecutive sessions. 2.5. Behavioral assays Sucrose preference test (SPT): During the adaptation phase, singly housed mice were provided with two bottles of 1% sucrose solution for 24 h. Over the subsequent 24 h, one sucrose bottle was replaced with a plain water bottle; this was followed by a 12-h water deprivation period. In the test phase, mice were given ad libitum access to two distinct bottles containing plain water or 1% sucrose solution, respectively. The volume of each liquid consumed over 24 h was recorded. The sucrose preference index (SPI) was calculated as a percentage: (volume of 1% sucrose solution consumed/total volume of water + 1% sucrose solution consumed) × 100, and used to assess the anhedonic phenotype, a core symptom of depression, in mice [ 27 ]. Forced swim test (FST): Individual mice were placed in a transparent glass cylinder (height: 25 cm, diameter: 10 cm) filled with water (23-25 °C) at two-thirds of the cylinder height. All animals underwent a 6-min FST: the initial 2 min served as an acclimation period, and the duration of immobility was recorded during the subsequent 4 min. Immobility was defined as the state in which mice remained floating passively in the water with minimal movements (excluding those necessary to maintain buoyancy). Total immobility time was used to evaluate despair-like behavior, a core readout of depressive-like phenotypes in rodents [ 28 ]. Tail suspension test (TST): Individual mice were suspended 10 cm above the ground using adhesive tape applied 30 cm proximal to the tail tip. All animals underwent a 6-min TST: the initial 2 min served as an acclimation period, and the duration of immobility was recorded during the subsequent 4 min. Immobility was defined as the absence of active body movements (excluding passive swaying due to gravity). Total immobility time was used to evaluate despair-like behavior, a core behavioral endpoint for depressive-like phenotypes in rodents. Open field test (OFT): Mice were individually placed in the central zone of a standard open field apparatus (50 x 50 × 40 cm, open-top) and allowed 5 min of free exploration. Locomotor activity was recorded and analyzed using the TOP Scan behavioral analysis system (CleverSys Inc., Reston, VA, USA). The total distance traveled was quantified as a measure of general locomotor activity, while the duration spent in the central zone served as an index of anxiety-like behavior. Elevated-plus maze test (EPM): The apparatus was positioned approximately 50 cm above the ground, consisting of two open arms (6 × 30 cm), two closed arms (6 x 30 × 20 cm; enclosed by 20-cm-high walls), and a central hub (6 × 6 cm). Mice were individually placed on the central hub facing an open arm (standard starting orientation) and allowed 5 min of free exploration. Locomotor and arm exploration behaviors were recorded and analyzed using the TOP Scan behavioral analysis system (CleverSys Inc., Reston, VA, USA). The time spent in open arms and entries into open arms were quantified as core indices of anxiety-like behavior in rodents. 2.6. Oxidative stress measures Reactive oxygen species (ROS) detection: For quantification of ROS production in tissue samples, frozen sections were incubated with dihydroethidium (DHE) (a ROS-sensitive fluorescent probe) at room temperature for 30 min in the dark, followed by counterstaining with 4′,6-diamidino-2-phenylindole (DAPI; Beyotime Biotechnology, Shanghai, China) for 5 min. Fluorescent signals were visualized and analyzed using a laser scanning confocal microscope. Assessment of oxidative stress products: The level of malondialdehyde (MDA), a key biomarker of lipid peroxidation, was quantified in the hippocampal CA1 subregion using a commercial assay kit (Jiancheng Bioengineering Institute, Nanjing, China), following the manufacturer's instructions. Assessment of antioxidant enzyme activity: The activities of superoxide dismutase (SOD) and glutathione peroxidase (GPx) were quantified in the hippocampal CA1 subregion using commercial activity assay kits (Jiancheng Bioengineering Institute, Nanjing, China), following the manufacturer's protocols. 2.7. Western blotting The mice were sacrificed after behavioral tests, and the hippocampal tissues were quickly collected and homogenized in lysis buffer. Homogenates were centrifuged at 12,000 rpm at 4 °C for 20 min, and the resulting supernatants were collected. Protein concentrations were quantified using a BCA protein assay kit (Cat. No. P0009, Beyotime Biotechnology, Shanghai, China) according to the manufacturer's instructions. Equal amounts of protein (e.g., 30 μg per lane) were mixed with 2x sodium dodecyl sulfate (SDS) loading buffer, boiled at 100 °C for 10 min to denature proteins, and separated by 8-15% SDS-polyacrylamide gel electrophoresis (SDS-PAGE). Separated proteins were transferred to polyvinylidene difluoride (PVDF) membranes. Membranes were blocked with 5% non-fat dry milk at room temperature for 1 h to reduce non-specific binding. They were then incubated overnight at 4 °C with primary antibodies diluted in TBST containing 5% bovine serum albumin (BSA). The primary antibodies were as follows: anti-SYNJ2BP (1:1000; ab224217; Abcam), anti-SYNJ2BP (1:500; 15666-1-AP; Proteintech), anti-SYNJ2 (1:500; sc-390354; Santa Cruz), anti-SYNJ2 (1:1000; 13893-1-AP; Proteintech), anti-phospho- c -Jun (1:1000; BS43042; Bioworld), anti- c -Jun (1:1000; BS54511; Bioworld), anti-phospho-NFKB p65 (1:1000; BS66162; Bioworld), anti-NFKB p65 (1:1000; BS90940; Bioworld), anti-p38 (1:1000; 9212; Cell Signaling Technology), anti-phospho-p38 (1:1000; 4511; Cell Signaling Technology), anti-phospho-JNK (1:1000; 4288; Cell Signaling Technology), anti-JNK (1:1000; 9252; Cell Signaling Technology), anti-BAX (1:1000; 2772; Cell Signaling Technology), anti-BAK (1:1000; 12105; Cell Signaling Technology), anti-IL-1β (1:100; sc-12742; Santa Cruz). After three washes with TBST (10 min each), membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies at room temperature for 1 h: HRP-conjugated goat anti-mouse IgG (H + L) (1:2000; ZB-2305, Zhongshan Jinqiao Biotechnology), HRP-conjugated goat anti-rabbit IgG (H + L) (1:5000; ZB-2301, Zhongshan Jinqiao Biotechnology). Membranes were washed three times with TBST (10 min each) and visualized using an enhanced chemiluminescence (ECL) substrate. Protein band intensities were quantified using ImageJ software (Version 1.53t, National Institutes of Health, USA), with GAPDH (1:5000; 10494-1-AP; Proteintech) as the loading control to normalize protein expression levels. 2.8. Golgi staining Following completion of behavioral tests, mice were euthanized via cervical dislocation and brains were rapidly dissected on ice. Golgi staining was performed using the FD Rapid Golgi Staining Kit (Cat. No. PK401, FD NeuroTechnologies, Columbia, MD, USA) following the manufacturer's protocols with minor modifications [ 29 ]. Dissected brain tissues were immersed in a 1:1 mixture of Solution A and Solution B (kit components) at room temperature in the dark for 2 weeks, then transferred to Solution C and incubated at 4 °C for 7 days. Brain sections (150 μm thick) were cut using a vibratome (Leica VT1200S, Leica Biosystems, Wetzlar, Germany) and collected in Solution C. Sections were stained with Solution D for 24 h at room temperature, followed by three sequential washes with Solution E (10 min each). Post-staining, sections were dehydrated through a graded ethanol series (50%, 70%, 95%, 100%; 10 min per step), cleared in xylene (15 min), and mounted onto glass slide. Stained sections were imaged using a fluorescence microscope (SLIDEVIEW VS120, Olympus Corporation, Tokyo, Japan). Dendritic morphology analysis was performed using Fiji software (Version 1.53t, National Institutes of Health, USA): dendritic spine density was quantified as the number of spines per 100 μm of dendrite, and dendritic branching complexity was assessed via Sholl analysis (concentric circles spaced 20 μm apart from the soma, counting intersections per circle). 2.9. Transmission electron microscopy Following behavioral testing, mice were euthanized, and bilateral hippocampal tissues were rapidly dissected and trimmed into 1 mm 3 cubes (critical for uniform fixation). Tissues were fixed in 2.5% glutaraldehyde in 0.1 M phosphate buffer (PB, pH 7.4) for 4 h at 4 °C, followed by three 10-min rinses in 0.1 M PB. Post-fixation was performed with 1% osmium tetroxide in 0.1 M PB for 2 h at 4 °C. Tissues were rinsed three times (10 min each) in 0.1 M citrate buffer (pH 7.0) before dehydration. Tissues were infiltrated overnight at 37 °C in a 1:1 mixture of 100% acetone and epoxy resin. Polymerization was carried out at 60 °C for 48 h to ensure full curing. Ultrathin sections (70 nm thick) were cut using an ultramicrotome (Leica UC7, Leica Biosystems, Wetzlar, Germany) and collected on 200-mesh copper grids. Sections were stained with: 4% uranyl acetate (aqueous) for 20 min at room temperature; 0.5% lead citrate for 5 min at room temperature, with rinses in deionized water between steps. Sections were imaged using a transmission electron microscope (Philips Tecnai 20 U-TWIN, Eindhoven, Netherlands) operated at 120 kV. Synapses were identified by the presence of presynaptic vesicles, a presynaptic active zone, and a postsynaptic density (PSD). In the present study, the count of synaptic vesicles was obtained by tallying the number of synaptic vesicles docked in the active zone of the presynaptic membrane in each electron microscopy image [ 21 , 30 ]. All analyses were performed by a researcher blinded to experimental groups to eliminate observer bias. 2.10. Proteomics analysis Label-free quantitative (LFQ) proteomics was employed to profile protein expression differences in hippocampal tissues. Total protein was extracted from the CA1 region of the hippocampus, and after lysis and separation, the protein was quantified using the fluorescent peptide quantification method. Subsequently, 1 μg of protein sample was digested with trypsin, and the products were separated by capillary high-performance liquid chromatography (nano-LC) and analyzed by mass spectrometry using a Q Exactive HF-X mass spectrometer (Thermo Fisher Scientific). After strict screening of the mass spectrometry data, the proteins were identified by comparison with the UniProt database. Differential expression proteins were screened by analysis software, and GO functional annotation and KEGG pathway enrichment analysis were performed. Differentially expressed proteins were identified using a fold change threshold of >1.2 or <0.83 (i.e., a 1.2-fold change) and a P-value <0.05 (Student's t-test). 2.11. Protein-protein interaction (PPI) and molecular docking Protein-protein interaction (PPI) partners of SYNJ2B were predicted using the STRING database ( https://string-db.org/ ) [ 31 ]. The resulting PPI network was visualized and analyzed using Cytoscape software (v3.7.2). Node degree centrality—defined as the number of direct physical interactions (edges) connected to a target node—was calculated to quantify the “hub” property of each protein: proteins with higher degree centrality are considered key regulators in the network, as they mediate more interactions with other proteins [ 32 ]. The protein structures of SYNJ2BP and SYNJ2 are from the UniProt database ( https://www.uniprot.org/ ). This database provides sequence and functional information of proteins as described in the literature. The Haddock server ( https://rascar.science.uu.nl/haddock2.4/ ) was used to evaluate the flexible molecular docking between proteins, analyze different conformations of docking, binding activities under different conformations, and amino acid residues with interaction distances within 5IA. In the output models, the first obtained model was used as the final model, and then PyMOL was used to preprocess the three-dimensional structure of the protein and draw the amino acid residues interacting between the two proteins. 2.12. Primary neuron culture The same as mentioned above, with only minor modifications [ 21 , 33 , 34 ]. Primary neuronal cultures were established from the cerebral cortex and hippocampus of postnatal day 0 (P0) mice pups. Tissues were transferred into ice-cold DMEM-F12 medium supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 μg/mL streptomycin. Under a submicroscope, meninges and blood vessels were carefully removed to minimize glial contamination. Tissues were then incubated in 0.25% trypsin-EDTA at 37 °C for 10 min, followed by gentle mechanical dissociation using Pasteur pipettes to generate a single-cell suspension. The reaction was terminated by adding trypsin inhibitor, and cells were centrifuged at 1000× g for 5 min at 4 °C. The supernatant was aspirated, and the pellet was resuspended. Cell suspensions were filtered through a 70 μm cell strainer (Millipore, Billerica, MA) to remove aggregates and plated onto poly- l -lysine-coated (50 μg/mL) 6-well plates or culture dishes. After 4-8 h of initial adherence, the medium was replaced with fresh Neurobasal™-A complete medium (Cat. No. 10888022; Gibco) supplemented with 1 × B-27 (Cat. No. 12587010; Gibco), 0.5 mM l -glutamine (Cat. No. 35050061; Gibco), and 1% penicillin-streptomycin. At day in vitro 3 (DIV3), 5 μM cytosine β- d -arabinofuranoside (Ara-C; 147-94-4; Sigma-Aldrich) was added to suppress glial proliferation. Thereafter, half of the medium was replaced every 3-4 days with pre-warmed Neurobasal™-A complete medium. Neuronal purity was assessed at DIV7 by immunofluorescence staining for microtubule-associated protein 2 (Map2; 4542; Cell Signaling Technology), with typical yields exceeding 95% MAP2-positive neurons. 2.13. Lentivirus transfection Virus transfection was performed 7 days before in vitro culture (DIV 7). According to the manufacturer's instructions, lentivirus transfection was carried out using LV-SYNJ2BPshRNA (Gene Chem, Shanghai) to knock down SYNJ2BP. The sequence of SYJN2BPShRNA is “CATCTACGTCAGCCGTATCAA”, and the sequence of its blank vector is “TTCTCCGAACGTGTCACGT”. LV-hSyn-Sf-iGluSnFR.A184S-WPER was constructed by Hegen Bio-technology (Shanghai, China) for detecting neurotransmitter glutamate. Neurons were cultured for 14 days and then used for other experiments. 2.14. Immunofluorescence After anesthetizing the mice, the brain was removed after perfusion of the heart and then immersed in 4% PFC overnight. After graded dehydration, the brain was sectioned into continuous coronal slices (40 μm). The slices were incubated with primary antibodies for 12 h and then with fluorescently labeled secondary antibodies for 1 h. The primary antibodies included: anti-phospho- c -Jun (1:200; BS43042; Bioworld),anti- Iba1 + (1:200; 17198; Cell Signaling Technology), anti-Cleaved Caspase-3 (1:500; 9661; Cell Signaling Technology), anti- Map2(1:1000; 4542; Cell Signaling Technology), anti- PSD95(1:1000; 3450; Cell Signaling Technology), anti- VGLUT1(1:500; sc-377425; Santa Cruz). The secondary antibodies included: anti-rabbit or anti-mouse Alexa Fluor 405, 488, 568, 647 (1:1000, Thermo Fisher Scientific). Finally, the slices were counterstained with DAPI (1:1000; c1002; Beyotime) for 5 min. Images were captured using LSM980 (Carl Zeiss), Dragonfly 200 (Andor, UK). Image processing and analysis were performed using IMARIS 10.1 software and ImageJ software. 2.15. Three-dimensional reconstruction The same as mentioned above, with only minor modifications [ 12 ]. Three-dimensional (3D) surface rendering of microglia and neurons was performed using the “Surface” module in IMARIS 10.1 software (Bitplane AG, Zurich, Switzerland). To ensure accurate reconstruction of fine cellular processes (e.g., microglial ramifications and neuronal dendrites/axons), intensity thresholds were empirically optimized based on negative control samples (without primary antibody staining) to minimize background noise and avoid over-segmentation. For visualization of glutamate neurotransmitter signals (labeled by Sf-iGluSnFR.A184S), the “Spots” module in IMARIS was utilized. Spots were defined as punctate fluorescent signals with a diameter range of 0.5-2.0 μm (consistent with the size of presynaptic terminals) and intensity thresholds were adjusted to exclude non-specific fluorescence, ensuring only bona fide glutamate release events were reconstructed. 2.16. Co-immunoprecipitation Mice were euthanized immediately after completion of behavioral assays, and bilateral hippocampi were rapidly dissected on ice to minimize protein degradation. Tissues were homogenized in ice-cold IP lysis buffer (Cat. No. P0013; Beyotime Biotechnology) supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF, a serine protease inhibitor). Homogenates were centrifuged at 12,000× g for 15-20 min at 4 °C. The supernatant (total protein extract) was collected, and protein concentration was quantified using a BCA Protein Assay Kit according to the manufacturer's protocol. Input control: 50 μL of total protein extract was reserved and mixed with 5 x SDS loading buffer (1:4 dilution) for subsequent Western blot analysis. IP group: 3-4 mg of total protein was adjusted to a final volume of 500 μL with IP lysis buffer, then precleared with 50 μL of protein A/G agarose beads (Cat. No. 20421; Thermo Fisher Scientific) for 1 h at 4 °C with gentle rotation to remove non-specific binding proteins. Precleared lysates were incubated overnight (12-16 h) at 4 °C with 3-5 μg of primary antibodies: Anti-SYNJ2 and Anti-rabbit IgG. After primary antibody incubation, 50 μL of protein A/G agarose beads (pre-equilibrated in IP lysis buffer) was added to each sample, followed by incubation for 3-4 h at 4 °C with gentle rotation. Beads were pelleted by centrifugation at 500× g for 5 min at 4 °C, and were washed 5 x with 1 mL of ice-cold 1 × PBS (pH 7.4) to remove unbound proteins. The final supernatant was completely aspirated to avoid dilution of immunoprecipitated complexes. Immunoprecipitated proteins were eluted by adding 50 μL of 2 x SDS-PAGE loading buffer to the beads, followed by boiling at 100 °C for 8 min to denature proteins and dissociate them from the beads. Samples were immediately placed on ice and stored at −80 °C until Western blot analysis. 2.17. Real-time quantitative PCR RNA was extracted from the hippocampus using the RNA Rapid Extraction Kit (Aidlab) according to the manufacturers’ instructions, with RNA concentrations determined using an ultra-micro nucleic acid analyzer. With use of a reverse transcription kit (Vazyme, NJ), RNA was reverse transcribed into cDNA. Quantitative fluorescent PCR was performed using the Bio-Rad IQ5 Real-Time Fluorescent Quantitative PCR System. GAPDH served as a control in each group and results were statistically analyzed using the ΔΔCT method [ 35 ]. 2.18. Statistical analysis All behavioral testing and statistical analyses were conducted under blinded conditions. Data are expressed as mean ± SEM unless otherwise specified. Normality tests were performed to evaluate the distribution of the data. For comparisons between two groups with normally distributed variables, an unpaired Student's t-test was utilized. For multiple-group comparisons, one- or two-way ANOVA followed by Tukey's post-hoc test. All statistical analyses were performed using GraphPad Prism 8 and Origin 2021 software. A P-value <0.05 was considered statistically significant for all analyses. 3. Results 3.1. CUMS-induced depression- and anxiety-like behaviors accompanied by oxidative stress, neuroinflammation, apoptosis and neuronal structural damage within the hippocampal CA1 region After 6 weeks of CUMS stimulation, mice showed “anhedonia” and “behavioral despair” ( Fig. 1 A–D), indicating that CUMS can induce typical depression-like behaviors in mice. CUMS-exposed mice displayed a significant reduction in the duration of central zone exploration ( Fig. 1 E–G), and the time spent in the open arms of the elevated plus maze and the number of entries into the open arms were significantly reduced ( Fig. 1 H–J), suggesting that CUMS mice exhibited hallmark indices of anxiety-like behaviors comorbid with depression. Fig. 1. Open in a new tab Oxidative stress, neuroinflammation, apoptosis, and neuronal structural deficits were observed in the hippocampal CA1 region of CUMS mice. (A) Schematic of the experimental design for the CUMS model. (B-J) Depressive- and anxiety-like behaviors in the different experimental groups of the CUMS model (n = 16 animals per group). SPT (B), FST (C), TST (D), OFT (E-G) and EPM (H-J). (K–M) The levels of MDA (K), SOD (L) and GSH-PX (M) in each group (n = 6 animals per group). (N) Representative images of DHE staining (red) within the CA1 area from each group of mice. Scale bar: 5 μm. (O) ROS relative intensity analysis in each group (n = 6 animals per group). (P) Representative images of Iba1 + immunostaining. (Q) The numbers of Iba1 + cells in the CA1 region of each group (n = 6 animals per group). (R) Representative images of Iba1 + immunostaining and 3D reconstruction of microglia in the CA1 region. scale bars: 20 μm and 5 μm. (S–U) IMARIS-based semi-automatic quantification of cell morphometry, including total process length (S), endpoints (T), and number of intersections at different distances from microglial soma (U) of Iba1 + microglia in the CA1 region (n = 6 cells from 6 mice). (V–W) qPCR analysis of the mRNA levels of pro - inflammatory cytokines(V) and apoptotic regulators(W) in the CA1 region of each group (n = 6 animals per group). (X-Z) Representative images of Golgi staining and reconstructions of hippocampal CA1 pyramidal neurons (X), quantitative analysis showing intersections (Y), intersection number (Z). (n = 6 neurons from 6 mice). Scale bars: 20 μm. (AA-AD) Representative images of the synaptic ultrastructure (AA) and active zone length (AB), postsynaptic density area (AC), number of synaptic vesicles located at active zone (AD) in the CA1 region of the mouse hippocampus (n = 9 synapses from 3 mice). SV: Synaptic vesicles. For all statistical tests: two-tailed unpaired Student's t-test, data represent means ± SEMs. ns, not significant, P > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. The neuronal damage induced by the cascade reaction or synergistic effect of oxidative stress, neuroinflammation, and apoptosis in specific brain regions serves as a crucial factor in the onset and progression of depression [ [36] , [37] , [38] ]. Given that the hippocampal CA1 region is well-documented to be implicated in the pathogenesis of depression and anxiety-like disorders, we assessed the level of MDA, an indicator of oxidative damage, in the CA1 region of the hippocampus in mice, which was significantly elevated in the CUMS group ( Fig. 1 K); in contrast, the activities of key antioxidant enzymes such as SOD and GSH-PX, exhibited a significant decreasing trend ( Fig. 1 L–M). Furthermore, DHE staining analysis demonstrated that the ROS level in the CA1 region of CUMS mice was significantly increased ( Fig. 1 N–O). Immunostaining for ionized calcium-binding adapter molecule 1 (Iba1 + ) revealed a significant expansion in the microglial population within the CA1 region of CUMS mice ( Fig. 1 P–Q). Given that microglial morphology is tightly linked to their activation status [ 39 ], we further analyzed microglial morphology via multi-layer scanning and three-dimensional reconstruction. The results demonstrated that microglia in CUMS-exposed mice exhibited shortened protrusion lengths, along with a significant reduction in the number of intersections and branch points ( Fig. 1 R–U; Movie S1-4.). qPCR assays revealed that the expression levels of multiple key pro-inflammatory cytokines (including IL-1β, IL-6, TNF-α, and IFN-γ) and apoptotic regulators (including caspase 3, caspase 9, BAX, and Bcl-2) were significantly elevated in CUMS mice ( Fig. 1 V–W). Supplementary video related to this article can be found at doi: 10.1016/j.redox.2026.104154 The following is/are the supplementary data related to this article: Multimedia component 5 Download video file (4.7MB, mp4) Multimedia component 6 Download video file (4.7MB, mp4) Multimedia component 7 Download video file (4.7MB, mp4) Multimedia component 8 Download video file (4.7MB, mp4) Impairment of neuronal plasticity is widely recognized as one of the core pathological hallmarks of depression [ 40 ]. We next investigated whether CUMS-induced stress elicits aberrant morphological alterations in CA1 neurons. Pyramidal neurons were reconstructed from Golgi-stained images, and Sholl analysis was performed to quantify dendritic complexity. Results demonstrated that CUMS exposure reduced the number of dendritic intersections across radial distances from the soma ( Fig. 1 X–Z), alongside a significant decrease in the total spine density of CA1 pyramidal neurons ( Fig. S1A–B ). TEM analyses demonstrated that CUMS-exposed mice exhibited a significant reduction in synaptic density ( Fig. S1C–D ), the length of the presynaptic active zone, the thickness of the postsynaptic density (PSD), and alongside marked decreases in the number of synaptic vesicles within the presynaptic active zone, relative to the control group ( Fig. S1E ; Fig. 1 AA-AD). Furthermore, immunofluorescence colocalization assays revealed a CUMS-induced reduction in the colocalization of vesicular glutamate transporter 1 (VGLUT1), a presynaptic excitatory neurotransmitter transporter, and PSD95 (postsynaptic density protein 95) ( Fig. S1F–G ). To summarize, the CA1 region of mice subjected to CUMS induction exhibits oxidative stress, inflammatory responses, apoptosis, impaired neuronal structural plasticity, accompanied by depressive- and anxiety-like behaviors. 3.2. SYNJ2BP is downregulated within the CA1 hippocampus of CUMS mice The heatmap reveals a substantial number of differentially expressed proteins in the hippocampus between the control group and the CUMS-induced group ( Fig. 2 A). Gene ontology (GO) analysis showed that the differentially expressed proteins in CUMS group were closely related to oxidative stress, inflammation and apoptosis pathways ( Fig. 2 B; Fig. S2A–B ). The differentially expressed proteins obtained between the control versus CUMS groups are displayed with use of volcano plot filtering. Notably, the SYNJ2BP protein, synaptojanin-2-binding protein, was significantly decreased in the CUMS group ( Fig. 2 C). For further validation, we found the expression of SYNJ2BP was significantly decreased in the CA1 region of CUMS mice ( Fig. 2 D–E, Fig. S2C–D ). Protein-protein interaction (PPI) network analysis uncovered interaction between SYNJ2BP and SYNJ2 (Synaptojanin-2) ( Fig. 2 F). Protein-protein docking and co-immunoprecipitation (CoIP) assays further validated the interaction between SYNJ2BP and SYNJ2 ( Fig. 2G–I, Fig. S2 E). GO and KEGG analyses of SYNJ2 were performed using String database ( https://cn.string-db.org/ ). The results showed that, SYNJ2 is associated with inositol phosphate dephosphorylation, synaptic vesicle uncoating, synaptic vesicle endocytosis, phosphatidylinositol signaling system is closely related ( Fig. 2 J, Fig. S2F–G ). The above findings suggest that the downregulated expression of SYNJ2BP in the hippocampal CA1 region may play a critical role in the pathogenesis of CUMS-induced depression, which is likely mediated by its functional interaction with SYNJ2 and constitutes a key regulatory pathway in stress responses. Fig. 2. Open in a new tab CUMS exposure downregulated the protein expression of SYNJ2BP. (A) Heatmap diagram indicated differentially expressed proteins. (n = 3 animals). (B) The bar plot of GO results in proteomic analysis. BP, biological process. (C) Volcano plots indicating differentially expressed proteins. (D-E) Representative images (D) and quantitative analyses (E) for western blots of SYNJ2BP. (n = 6 animals per group). (F) Protein-protein interaction network of SYNJ2BP and SYNJ2. (G) The proposed interaction model between SYNJ2BP and SYNJ2. (H–I) Representative western blots of the co-immunoprecipitation of SYNJ2BP and SYNJ2. (J) The GO results of SYNJ2 in the String database. BP, biological process; MF, molecular function. For all statistical tests: two-tailed unpaired Student's t-test, data represent means ± SEMs. ***P < 0.001. 3.3. Overexpression of SYNJ2BP ameliorates oxidative stress, neuroinflammation, apoptosis, and neuronal structural damage in CUMS-exposed mice To determine whether SYNJ2BP serves as a key risk factor for CUMS-induced depression, we first injected pAAV-Syn-SYNJ2BP-eGFP-WPRE into the bilateral hippocampal CA1 regions of mice to achieve targeted overexpression of SYNJ2BP ( Fig. 3 A–D). Behavioral testing was conducted three weeks after injection, and the results of SPT, FST, and TST showed that overexpression of SYNJ2BP augmented sucrose intake and reduced immobility time in CUMS mice ( Fig. 3 E–G). Meanwhile, overexpression of SYNJ2BP significantly extended the time of entering the central OFT region ( Fig. S3A–C ), and increased the time of residence in the EPM open arm and the number of times in and out of the open arm ( Fig. S3D–F ). These findings suggest that overexpression of SYNJ2BP expression alleviates depressive-like and anxiety-like behaviors in CUMS mice. Fig. 3. Open in a new tab SYNJ2BP overexpression rescues oxidative stress, neuroinflammation and apoptosis in CUMS-exp osed mice. (A) Schematic diagram of experimental design. CUMS procedure was conducted from day 0 to day 42. AAV-SYNJ2BP-eGFP was injected on day 21. (B)The accuracy of the virus injection site. (C-D) Representative western blots images (C) and quantitative analysis (D) of viral injection efficiency. (E-G) Depressive-like behaviors in the different experimental groups of the CUMS model (n = 12 animals per group). SPT (E), FST (F), TST (G). (H-J) Representative western blots images (H) and quantitative analysis SYNJ2 in total protein (I) and membrane protein (J) after overexpression of SYNJ2BP (n = 6 animals per group). (K-M) The ACP activity(K), the expression of PIP 2 (L), and the expression of IP 3 (M) in each group (n = 6 animals per group). Acid phosphatase (ACP), Phosphatidylinositol 4,5-bisphosphate (PIP 2 ), Inositol 1,4,5-trisphosphate (IP 3 ). (N) SYNJ2BP mechanism diagram. (O) Representative images of DHE staining (red) within the CA1 area from each group of mice. Scale bar: 5 μm. (P) ROS relative intensity analysis in each group (n = 4 animals per group). (Q-S) The levels of SOD (Q), GSH-PX (R) and MDA (S) in each group (n = 6 animals per group). (T-U) Representative western blots images (T) and quantitative analysis inflammation-related proteins (U) in each group (n = 6 animals per group). (V–Y) Representative western blots images (V, X) and quantitative analysis apoptosis-related proteins (W, Y) in each group (n = 6 animals per group). For all statistical tests: two-way analysis of variance (ANOVA) with Bonferroni post-hoc test, data represent means ± SEMs. ns, not significant, P > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. Subsequently, we investigated the downstream mechanisms through which SYNJ2BP mediates the regulation of oxidative stress, neuroinflammation, and apoptosis in the hippocampal CA1 region ( Fig. 3 N). Previous studies have demonstrated that SYNJ2BP facilitates the stable anchoring of SYNJ2 at the plasma membrane by binding to its C-terminal domain [ 41 , 42 ]. Accordingly, via Western blot analysis, we observed that overexpression of SYNJ2BP exerted no effect on the total protein expression of SYNJ2 ( Fig. 3 H–I), but rescued the CUMS-induced reduction in membrane expression of SYNJ2 in mice ( Fig. 3 H–J). Prior studies have established that SYNJ2 exhibits dual phosphatase activity (encompassing both 4-phosphatase and 5-phosphatase activities), enabling it to dephosphorylate PIP 2 (phosphatidylinositol-4,5-bisphosphate) to PI (phosphatidylinositol); this enzymatic conversion is critical for sustaining the dynamic homeostasis of the cell membrane [ [43] , [44] , [45] ]. Therefore, we conducted acid phosphatase assay and PIP 2 assay. The results indicated that overexpression of SYNJ2BP could alleviate the reduction of acid phosphatase level and reverse the elevation of phosphatidylinositol-4, 5-bisphosphate level in CUMS mice ( Fig. 3 K–L). Previous studies have shown that PIP2 is hydrolyzed to IP3 (inositol triphosphate) in response to PLC (phospholipase C) [ [46] , [47] , [48] ]. Accordingly, IP3 assays were performed and the results showed that overexpression of SYNJ2BP reversed the increased IP3 levels in CUMS mice ( Fig. 3 M). Subsequently, we investigated the downstream mechanisms regulated by the SYNJ2BP/SYNJ2/PIP2/IP3 signaling pathway in the hippocampal CA1 region ( Fig. 3 N). DHE staining analysis showed that overexpression of SYNJ2BP ameliorated the increase of ROS levels in the CA1 region of CUMS mice ( Fig. 3 O–P). In addition, overexpression of SYNJ2BP ameliorated the decrease of SOD and GSH-PX levels in CUMS mice ( Fig. 3 Q–R), as well as reversed the increase of MDA levels in CUMS mice ( Fig. 3 S). It has been documented that IP3 activates p38 and JNK signaling pathways [ 49 , 50 ]. Accordingly, via Western blot analysis, we demonstrated that overexpression of SYNJ2BP attenuated the CUMS-induced upregulation of inflammation-related proteins, including phosphorylated p38, phosphorylated p65, and IL-1β ( Fig. 3 T–U); it also mitigated the CUMS-induced elevation of apoptosis-related proteins such as phosphorylated JNK, phosphorylated c-Jun, phosphorylated p53, BAX, and BAK ( Fig. 3 V–Y). p- c -Jun and Cleaved-caspase 3 staining analysis further confirmed that overexpression of SYNJ2BP could improve the level of apoptosis in CA1 of CUMS mice ( Fig. 4 A–D). Iba1 + staining analysis showed that overexpression of SYNJ2BP ameliorated the shortened process length and significantly reduced the number of crossing points and branch points in microglia from CUMS mice ( Fig. 4 E–H; Movie S5-10). Fig. 4. Open in a new tab SYNJ2BP overexpression rescues apoptosis and neuronal structural damage in CUMS-exp osed mice. (A) Representative images of p- c -Jun immunostaining. (B) Quantitation of p- c -Jun and DAPI co-localization densities in the CA1 region (n = 4 animals per group). (C) Representative images of Cleaved Caspase-3 immunostaining. (D) Quantitation of Cleaved Caspase-3 in the CA1 region (n = 4 animals per group). (E) Representative images of Iba1 + immunostaining in the CA1 region. scale bars: 20 μm and 5 μm. (V-X) IMARIS-based semi-automatic quantification of cell morphometry, including total process length (F), endpoints (G), and number of intersections at different distances from microglial soma (H) of Iba1 + microglia (n = 6 cells from 6 mice). (I-J) Representative images of Golgi staining and reconstructions of hippocampal CA1 pyramidal neurons (I), quantitative analysis showing intersections (J) (n = 6 neurons from 6 mice). Scale bars: 200 mm. (K–N) Representative images of the synaptic ultrastructure (K) and number of synaptic vesicles located at active zone (L), active zone length (M), postsynaptic density area (N) in the CA1 region of the mouse hippocampus (n = 9 synapses from 3 mice). For all statistical tests: two-way analysis of variance (ANOVA) with Bonferroni post-hoc test, data represent means ± SEMs. ns, not significant, P > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. Supplementary video related to this article can be found at doi: 10.1016/j.redox.2026.104154 The following is/are the supplementary data related to this article: Multimedia component 9 Download video file (1.1MB, mp4) Multimedia component 10 Download video file (4.5MB, mp4) Multimedia component 11 Download video file (4.8MB, mp4) Multimedia component 12 Download video file (4.7MB, mp4) Multimedia component 13 Download video file (4.7MB, mp4) Multimedia component 14 Download video file (4.5MB, mp4) Employing Golgi staining, we additionally discovered that overexpression of SYNJ2BP reversed the dendritic complexity of neurons and increased the spine density of these dendrites, providing direct evidence that overexpression of SYNJ2BP restores the synaptic architecture of CA1 pyramidal neurons in CUMS-exposed mice ( Fig. 4 I–J; Fig. S4A–B ). By TEM, we also found that SYNJ2BP overexpression significantly reduced the number of synapses, the number of synaptic vesicles in the active band of presynaptic membrane, the length of the active band of presynaptic membrane and the thickness of PSD in the postsynaptic membrane ( Fig. 4 K–N, Fig. S4C–E ). This provides further direct evidence that overexpression of SYNJ2BP can restore neuronal synaptic structure damage. Collectively, these findings suggest that SYNJ2BP may facilitate the stable anchoring of SYNJ2 at the plasma membrane via binding to SYNJ2. In this membrane-localized state, SYNJ2 exerts its phosphatase activity to catalyze the dephosphorylation of PIP 2 into PI. This enzymatic conversion likely reduces the hydrolysis of PIP 2 to IP 3 , thereby potentially suppressing oxidative stress, neuroinflammation, and apoptosis, and ultimately mitigating the susceptibility to depressive- and anxiety-like behaviors in mice. 3.4. Knockdown of SYNJ2BP exacerbates neuroinflammation and apoptosis, thereby contributing to neuronal damage Primary neurons were isolated from the cerebral cortex and hippocampus of neonatal mice pups, followed by in vitro culture; subsequently, LV-SYNJ2BPshRNAq was transfected into the neurons to achieve SYNJ2BP knockdown ( Fig. 5 A). Western blot analysis showed that SYNJ2BP knockdown effect was reliable ( Fig. 5 B–C). PCR results showed that knockdown of SYNJ2BP resulted in a significant increase in the levels of several key proinflammatory and apoptotic cytokines in primary neurons, such as IL-1β, IL-6, TNF-α, caspase 3, and BAX ( Fig. 5 D–H). Knockdown of SYNJ2BP increased MDA levels in CUMS mice ( Fig. 5 I), as well as decreased of SOD, GSH-PX and T-AOC levels in CUMS mice ( Fig. 5 J–L). Analysis of Map2 staining showed that knockdown of SYNJ2BP resulted in a decrease in the number of dendritic intersections in primary neurons ( Fig. 5 M–O). A glutamate fluorescent probe, LV-hSyn–SF–iGluSnFR.S72A-WPRE, was transfected into primary neurons with SYNJ2BP knockdown to image glutamate in real time and at high resolution. The working principle of LV-iGluSnFR is as follows: The circularly permuted green fluorescent protein (cpEGFP) is embedded into Glutamate Transporter-1 (Glt1) to form a novel fusion protein. Upon binding to glutamate, this fusion protein undergoes a conformational change, which in turn results in the enhancement of the GFP fluorescence signal. Live-cell confocal imaging demonstrated that SYNJ2BP knockdown resulted in a reduction in glutamate levels in primary neurons ( Fig. 5 P–Q). The aforementioned results imply that the decrease in the expression level of SYNJ2BP might exacerbate the degrees of neuroinflammation and apoptosis, thereby resulting in neuronal damage. Fig. 5. Open in a new tab Knockdown of SYNJ2BP exacerbates neuroinflammation and apoptosis, consequently contributing to neuronal damage. (A) Knockdown of SYNJ2BP in cultured primary neurons. (B–C) Representative western blots images (B) and quantitative analysis SYNJ2BP (C) in each group (n = 4 independent cultures per group). (D-H) qPCR analysis of the mRNA levels of pro - inflammatory cytokines and apoptotic regulators in the CA1 region of each group (n = 6 animals per group). IL-1β (D), IL-6 (E), TNF-α (F), Caspase-3 (G), BAX (H). (I-L) The levels of MDA (I), SOD (J), GSH-PX (K) and T-AOC (L) in each group (n = 6 animals per group). (M) Representative images of Map2 immunostaining. (N–O) The quantitative analysis showing intersections (N), intersection number (O) (n = 3 independent cultures per group). (P) Representative images of LV-iGluSnFR and 3D reconstruction of neuron and glutamate. (Q) The quantitative analysis of glutamate (n = 6 from 3 independent cultures). For all statistical tests: two-way analysis of variance (ANOVA) with Bonferroni post-hoc test, data represent means ± SEMs. ns, not significant, P > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. 3.5. Exogenous PIP2 administration induces oxidative stress, neuroinflammation, apoptosis, neuronal damage, as well as depressive-like and anxiety-like behaviors in mice To evaluate the contribution of the SYNJ2BP/SYNJ2/PIP2 pathway to depressive- and anxiety-like behaviors, we injected PIP2 into the CA1 region of the hippocampus in mice following SYNJ2BP overexpression ( Fig. 6 A–B). Behavioral results showed that PIP2 treatment reversed the improvement of depression-and anxiety-like behaviors induced by SYNJ2BP overexpression in CUMS mice. Specifically, the proportion of sucrose intake in the SPT of mice was reduced under PIP2 treatment ( Fig. 6 C), whereas immobility time in the FST and TST was increased ( Fig. 6 D–E). In the OFT, PIP2 treatment shortened the time that mice entered the central zone ( Fig. S5A–C ). DHE staining experiments showed that ROS content in the CA1 region increased after PIP2 treatment ( Fig. 6 F–G). Meanwhile, SOD and GSH-PX contents decreased ( Fig. 6 H–I) and MDA content increased ( Fig. 6 J) in the CA1 region after PIP2 treatment. In addition, p-p38 and p -JNK expression levels were increased after PIP2 treatment ( Fig. 6 K–L). IBA1 + staining analysis showed that exogenous PIP2 administration reduced the number of microglial dendritic intersections ( Fig. 6 M–N); in addition, the critical radius was significantly decreased in the PIP2-treated group compared, indicating a retraction of processes towards the soma ( Fig. 6 O). Analysis of p- c -Jun and Cleaved-caspase 3 staining indicated that PIP2 exacerbated apoptosis in the CA1 region ( Fig. S5D–E ; Fig. 6 P–Q). These findings provide additional support for the hypothesis that SYNJ2BP may directly target the SYNJ2 - PIP2 pathway, thereby inducing depressive and anxious behaviors in mice. Moreover, inhibition of this pathway leads to an improvement in the behaviors of CUMS mice. Fig. 6. Open in a new tab Exogenous PIP2 administration induces oxidative stress, neuroinflammation, apoptosis, neuronal damage, and depressive-like behaviors in mice. (A) Schematic diagram of experimental design. CUMS procedure was conducted from day 0 to day 42. AAV-SYNJ2BP-eGFP was injected on day 21. PIP 2 was administered on days 35, 38, and 41. (B) Mechanism diagram of exogenous PIP2 administration. (C-E) Depressive-like behaviors in the different experimental groups of the CUMS model (n = 8 animals per group). SPT (C), FST (D), TST (E). (F) Representative images of DHE staining (red) within the CA1 area from each group of mice. Scale bar: 5 μm. (G) ROS relative intensity analysis in each group (n = 4 animals per group). (H-J) The levels of SOD (H), GSH-PX (I) and MDA (J) in each group (n = 6 animals per group). (K-L) Representative western blots images (K) and quantitative analysis of p-p38 and p -JNK (L) in each group (n = 6 animals per group). (M − N) Representative images of Iba1 + immunostaining (M) and number of intersections at different distances from microglial soma (N) of Iba1 + microglia (n = 4 cells from 4 mice). (O) Quantitative statistical analysis of the critical radius (n = 4 cells from 4 mice). (P-Q) Representative images of Cleaved Caspase-3 immunostaining (P) and quantitation of Cleaved Caspase-3 (Q) in the CA1 region (n = 4 animals per group). For all statistical tests: two-way analysis of variance (ANOVA) with Bonferroni post-hoc test, data represent means ± SEMs. ns, not significant, P > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. 3.6. Inhibition of IP3 effectively alleviate oxidative stress, neuroinflammation, apoptosis, nerve injury, and depression- and anxiety-like behaviors in mice To further investigate the impacts of the SYNJ2BP/SYNJ2/PIP2/IP3 pathway on depression and anxiety, we injected the IP3 inhibitor, 2-APB, into the CA1 region of the hippocampus bilaterally in CUMS mice ( Fig. 7 A–B). Behavioral tests demonstrated that mice treated with 2-APB displayed a significant reduction in depression- and anxiety-like behaviors. Specifically, these 2-APB-treated CUMS mice showed an enhanced preference for sucrose water in the SPT ( Fig. 7 C), reduced immobility time in the FST and TST ( Fig. 7 D–E), and significantly longer time spent in the central region of the OFT ( Fig. S6A–C ). As well as a significant increase in the time and number of entries into the open arm of the EPM ( Fig. S6D–F ). The results of DHE staining showed that 2-APB treatment significantly reduced ROS levels in the CA1 region of CUMS mice ( Fig. 7 F–G). Simultaneously, the activities of key antioxidant enzymes, such as SOD and GSH-PX, were significantly enhanced ( Fig. 7 H–I), while the activity of the oxidative damage marker MDA was significantly reduced ( Fig. 7 J). Western blot analysis showed that 2-APB treatment significantly reduced inflammation- and apoptosis-related proteins, such as p-p38, p-p65, IL-1β, p -JNK, p-p53 and BAK ( Fig. 7 K–M). Iba1 + staining analysis showed that 2-APB treatment ameliorated the shortening of neurite length and a significant reduction in the number of crossing and branching points in microglia from CUMS mice ( Fig. 7 N–Q; Movie S11-16). p- c -Jun and Cleaved-caspase 3 staining analysis further confirmed that 2-APB treatment could effectively ameliorate apoptosis in CUMS mice ( Fig. 7 R–S; Fig. S6G–H ). TEM analysis showed that 2-APB treatment ameliorated the significant reduction in the number of synapses in CUMS mice, as well as the reduction in the number of synaptic vesicles in the active band of the presynaptic membrane, the length of the active band of the presynaptic membrane, and the PSD thickness of the postsynaptic membrane ( Fig. 7 T–W). These data suggest that the SYNJ2BP/SYNJ2/PIP2/IP3 pathway may be involved in the generation of CUMS-induced depression-like and anxiety-like behaviors by activating oxidative stress, neuroinflammation, apoptosis, and causing damage to synaptic structures. Fig. 7. Open in a new tab Inhibition of IP3 effectively alleviated oxidative stress, neuroinflammation, apoptosis, nerve injury, and depression-like behaviors in mice. (A) Schematic diagram of experimental design. CUMS procedure was conducted from day 0 to day 42. 2-APB was administered on days 35, 38, and 41. (B) Mechanism diagram of 2-APB treatment. (C-E) Depressive-like behaviors in the different experimental groups of the CUMS model (n = 8 animals per group). SPT (C), FST (D), TST (E). (F) Representative images of DHE staining (red) within the CA1 area from each group of mice. Scale bar: 5 μm. (G) ROS relative intensity analysis in each group (n = 4 animals per group). (H-J) The levels of SOD (H), GSH-PX (I) and MDA (J) in each group (n = 6 animals per group). (K-M) Representative western blots images (K) and quantitative analysis inflammation-related proteins (L) and apoptosis-related proteins (M) in each group (n = 6 animals per group). (N) Representative images of Iba1 + immunostaining and 3D reconstruction of microglia in the CA1 region. scale bars: 20 μm and 5 μm. (O-Q) IMARIS-based semi-automatic quantification of cell morphometry, including endpoints (O), total process length (P), and number of intersections at different distances from microglial soma (Q) of Iba1 + microglia (n = 6 cells from 6 mice). (R–S) Representative images of Cleaved Caspase-3 immunostaining (R) and quantitation of Cleaved Caspase-3 (S) in the CA1 region (n = 4 animals per group). (T-W) Representative images of the synaptic ultrastructure (T) and number of synaptic vesicles located at active zone (U), active zone length (V), postsynaptic density area (W) in the CA1 region of the mouse hippocampus (n = 9 synapses from 3 mice). SV: Synaptic vesicles. For all statistical tests: two-way analysis of variance (ANOVA) with Bonferroni post-hoc test, data represent means ± SEMs. ns, not significant, P > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. Supplementary video related to this article can be found at doi: 10.1016/j.redox.2026.104154 The following is/are the supplementary data related to this article: Multimedia component 15 Download video file (1MB, mp4) Multimedia component 16 Download video file (4.6MB, mp4) Multimedia component 17 Download video file (1MB, mp4) Multimedia component 18 Download video file (4.5MB, mp4) Multimedia component 19 Download video file (1.1MB, mp4) Multimedia component 20 Download video file (4.7MB, mp4) 4. Discussion The pathogenesis of MDD is complex, involving the interplay of biological, psychological, and/or socio-environmental factors. Dysregulated oxidative stress and neuroinflammation are recognized as critical contributors to the pathophysiological processes underlying MDD [ 51 , 52 ]. This study aimed to investigate the synaptic-molecular mechanisms underlying CUMS-induced depressive-like phenotypes, with a focus on the role of SYNJ2BP and its downstream signaling cascades ( Fig. 8 ) . In this study, CUMS leads to significant downregulation of SYNJ2BP in neurons of the hippocampal CA1 region; loss of SYNJ2BP disrupts the membrane localization of SYNJ2, resulting in PIP 2 accumulation and excessive IP 3 production; IP 3 activates the p38/JNK MAPK pathway, driving an oxidative stress-neuroinflammation-apoptosis cascade; and the SYNJ2BP/SYNJ2/PIP 2 /IP 3 signaling axis mediates dendritic spine loss and synaptic ultrastructural damage, ultimately contribute to depressive- and anxiety-like behaviors. Fig. 8. Open in a new tab Schematic diagram illustrating the SYNJ2BP-SYNJ2-PIP 2 -IP 3 signaling axis in CUMS-induced depressive-like behaviors. Schematic diagram illustrating the SYNJ2BP-SYNJ2-PIP 2 -IP 3 signaling axis in CUMS-induced depressive-like behaviors. Chronic stressors are considered to be one of the important factors leading to the pathogenesis of depression [ 53 ]. In the present study, the CUMS model successfully recapitulated the core behavioral phenotypes of depressive disorders, anhedonia and behavioral despair, and concomitantly induced anxiety-like comorbid phenotypes. As a key higher-order structure of the central nervous system involved in emotion regulation, the hippocampus exhibits structural and functional abnormalities that are closely linked to the pathogenesis of MDD. Notably, the hippocampal CA1 subregion, a critical locus for cognition and spatial learning, also serves as a core hub for the processing of memory and emotional information [ 54 , 55 ]. Previous studies have demonstrated that redox imbalance frequently occurs during the onset and progression of MDD, accompanied by excessive generation of reactive oxygen species. These reactive oxygen species attack neurons and compromise mitochondrial dysfunction. Moreover, the mitochondrial pathway is one of the core pathways involved in apoptosis [ [56] , [57] , [58] ]. In addition, there are increasing evidence that MDD is accompanied by immune system activation and elevated levels of inflammatory factors such as IL-1β, IL-6, TNF-α, which are neurotoxic and induce apoptosis [ 59 , 60 ]. Our results are highly consistent with the multi-system interaction hypothesis in the pathogenesis of MDD. In this study, oxidative stress, neuroinflammation, apoptosis and neuronal structural damage were simultaneously captured in the CA1 region of CUMS mice, providing a regional evidence chain for the multi-system interaction pathogenic theory of MDD. Specifically, the ROS surge revealed by DHE staining and the collapse of antioxidant enzyme activity suggest that oxidative stress is not only the initiating factor but also the driving force for maintaining the pathological state. Morphometric analysis showed that stress induced the transformation of microglia to a pro-inflammatory phenotype (process retraction and branch simplification), and this morphological remodeling formed a positive feedback loop with the release of pro-inflammatory factors such as IL-1β and TNF-α. Most importantly, we observed a synergistic increase of oxidative stress marker MDA and apoptosis execution molecule caspase-3, suggesting that oxidative injury may directly trigger neuronal programmed death through the opening of mitochondrial permeability transition pore and activation of caspase cascade. As a likely morphological consequence of this apoptotic process, Golgi staining and TEM analysis revealed significant dendritic spine loss and synaptic ultrastructural damage in CA1 neurons of CUMS mice. This structural deterioration was further corroborated at the molecular level by a marked reduction in VGLUT1/PSD95 colocalization in the CA1, indicating that the excitatory synaptic inputs from CA3 pyramidal neuron axons onto CA1 pyramidal neuron dendrites are specifically impaired. The resultant disruption of the CA3-CA1 pathway may therefore be a key circuit-level substrate for the emergence of depressive-like behaviors. These structural deficits were accompanied by increased oxidative stress, neuroinflammation, and apoptosis, further exacerbating neuronal dysfunction. This vicious cycle of oxidative stress-neuroinflammation-apoptosis ternary axis in the hippocampal CA1 region may be the structural basis of the high sensitivity of this region to stress and dysfunctions in MDD. SYNJ2BP is a small membrane-anchored protein for Synaptojanin-2, which its function and the interactions with the later have not been previously implicated in the pathological framework of MDD. SYNJ2BP consists of 145 amino acids that mediate multiple protein interactions via the PDZ domain [ 61 ]. The N-terminus of SYNJ2BP harbors a PDZ protein-interaction domain that constitutes its functional core; the C-terminal transmembrane segment mediates the insertion of SYNJ2BP into target membranes [ 62 ]. SYNJ2 belongs to the inositol polyphosphate 5-phosphatase family and is a phosphoinositide phosphatase. The N-terminal Sac1 homology domain of SYNJ2 has 3′- and 4' -phosphatase activities, dephosphorylating PI(3)P, PI(4)P and PI(3,5)P2. The central inositol 5' -phosphatase domain specifically hydrolyzes the phosphate at position 5 of PI(4,5)P2 and PI(3,4,5)P3 to generate PI(4)P and PI(3,4)P2. The C-terminal proline-rich domain (PRD) regulates its intracellular localization [ 63 ]. Proteomic screening indicated that SYNJ2BP was markedly downregulated. Moreover, the deficiency of SYNJ2BP leads to unstable membrane localization of SYNJ2 and reduction in PIP 2 hydrolysis efficiency. The abnormal accumulation of PIP 2 and elevated level of its metabolite IP 3 activate the calcium - dependent p38/JNK stress kinase pathway, which in turn drives NF-κB-mediated inflammation and p53-dependent apoptosis. The exogenous administration of PIP2 reversed the behavioral and biochemical improvements induced by the overexpression of SYNJ2BP. In contrast, the inhibition of IP3 signaling (e.g., through the use of 2-APB) mimicked the protective effects of SYNJ2BP overexpression. Specifically, the overexpression of SYNJ2BP inhibited the activation of the p38/JNK MAPK pathway by promoting the dephosphorylation of PIP 2 and reducing the levels of its metabolite, IP 3 . This phenomenon was fully replicated in the 2-APB treatment group. As a second messenger, IP 3 not only triggers the release of calcium stores from the endoplasmic reticulum, resulting in mitochondrial calcium overload and generation of reactive oxygen species (ROS), but also activates calcium/calmodulin-dependent kinase, promotes the nuclear translocation of NF-κB, and facilitates the transcription of pro-inflammatory cytokines [ [64] , [65] , [66] , [67] ]. Our data show that IP 3 level is positively correlated with p-p38 and p -JNK expression, and that 2-APB can simultaneously improve oxidative stress, neuroinflammation and apoptosis, and restore synaptic ultrastructure, indicating that IP3k may be an upstream node for the integration of multi-system pathology. Traditionally, PIP 2 is considered as a crucial second-messenger precursor, and its hydrolysis into IP 3 /DAG initiates normal cellular signaling [ 68 ]. However, in this study, we found that PIP 2 accumulation itself was pathological toxic, and its overexpression directly reversed the protective effect of SYNJ2BP. This discrepancy may arise on both temporal and spatial levels. At the compartmentization level, PIP 2 is located in the inner leaf of plasma membrane under physiological conditions [ 69 , 70 ], while chronic stress may lead to abnormal accumulation of PIP 2 in non-lipid rafts and interfere with actin-membrane skeleton coupling. At the temporal level, previous studies mostly focused on the transient metabolism of PIP 2 under acute stimulation [ [71] , [72] , [73] , [74] ], while CUMS induces chronic accumulation over several weeks, which may exceed the clearance capacity of phosphatase, leading to covalent modification of lipid peroxidation products and membrane proteins. In contrast to traditional antidepressant targets that primarily focus on the monoaminergic system (e.g., serotonin receptors) or neurotrophic factors (e.g., BDNF), the SYNJ2BP pathway represents a pathological continuum spanning from metabolic dysregulation to structural damage. While conventional targets mainly modulate neurotransmitter signaling or neuronal survival, the SYNJ2BP/SYNJ2/PIP 2 /IP 3 axis is directly implicated in stress-induced lipid metabolic reprogramming and cytoskeletal remodeling. Consequently, the pathway identified in this study operates in vertical complementarity to traditional targets: classical antidepressants (e.g., SSRIs) alleviate symptoms by enhancing 5-HT signaling but are often associated with a delayed onset of action. In contrast, targeting the SYNJ2BP pathway may intercept the stress-induced metabolic-inflammatory-apoptotic cascade at an upstream node, offering a novel intervention strategy for rapid-acting effects or treatment-resistant depression. The SYNJ2BP pathway acts at an early stage of the stress response, intervening in PIP 2 /IP 3 metabolism can concurrently block oxidative stress, neuroinflammation and apoptosis, as well as conferring a unique “multi-target single-agent” therapeutic advantage. Distinct from strategies that merely modulate neurotransmission, this pathway is directly involved in maintaining synaptic structure and plasticity, suggesting its potential to advance depression treatment from symptomatic relief to structural repair. However, the clinical relevance of this pathway in patients with MDD requires further validation, for instance, by assessing SYNJ2BP protein levels in postmortem brain tissues or neuronal-derived exosomes. Currently available pharmacological tools targeting PIP 2 /IP 3 metabolism, such as 2-APB, are small-molecule compounds whose blood-brain barrier penetrance and cerebral bioavailability necessitate systematic evaluation. Moreover, given that PIP 2 /IP 3 signaling is ubiquitously present across diverse cell types, systemic intervention poses a risk of off-target effects, potentially leading to adverse outcomes in peripheral systems, including cardiovascular and metabolic functions. Despite these advantages, this study has several limitations that warrant attention. The present study utilized male mice exclusively and did not examine the influence of sex on the SYNJ2BP signaling axis. The present study did not systematically examine the basal expression of SYNJ2BP in various hippocampal cell types or its dynamic changes under CUMS stress, nor did it perform SYNJ2BP knockdown/overexpression functional validation tests in primary microglia. Therefore, the observed glial phenotypic changes may represent secondary effects resulting from microenvironmental improvements following neuronal SYNJ2BP overexpression, and cannot be definitively attributed to direct actions of SYNJ2BP within glial cells. The inability of the generic acid phosphatase assay to specifically reflect SYNJ2 phosphatase activity represents a methodological limitation of this study. Since the present study primarily employed in situ injection of 2-APB into the hippocampal region, we cannot exclude the possibility that 2-APB also act on other glial cells. In our future studies, we will employ more targeted approaches to intervene in IP 3 expression specifically in neurons. 2-APB, as an IP 3 receptor inhibitor, has off-target effects. This represents an inherent limitation of pharmacological interventions in the present study. This study only examined total PIP 2 levels and did not validate abnormalities in its compartmentalized localization at the plasma membrane using ultrastructural techniques and methods such as immunoelectron microscopy. Additionally, we did not perform PIP 2 intervention experiments with varying durations, precluding distinction between the differential effects of acute versus chronic accumulation on neuronal function and behavioral phenotypes. This study explicitly states to identify new potential therapeutic targets for depression; however, all experiments were confined to mouse models and lacked direct support from clinical samples or clinical data. In future studies, we should mine transcriptomic/proteomic data from hippocampal tissue of depression patients in public brain databases (e.g., GEO, Synapse), or detect SYNJ2BP mRNA levels, using peripheral blood mononuclear cells (PBMCs) isolated from independent clinical cohorts, and explore their correlations with depression severity, oxidative stress, and inflammatory markers. In conclusion, this study represents the first systematic revelation of the crucial hub role of SYNJ2BP in CUMS-induced depressive-like phenotypes. CUMS leads to down-regulation of SYNJ2BP in neurons of the hippocampal CA1 region, which subsequently perturbs the PIP2-IP3 metabolic balance by disrupting its binding to SYNJ2. IP3 activates the downstream p38/JNK signaling pathway and results in a cascade amplification of oxidative stress, neuroinflammation, and neuronal apoptosis, through which ultimately causing synaptic structure damage and triggering depression- and anxiety-like behaviors. Noticeably, the intervention of PIP2-IP3 by overexpression of SYNJ2BP or inhibition of IP3 significantly restores synaptic morphology, protein levels, and behavioral abnormalities. This finding not only reveals a novel signaling circuit between synaptic phospholipid metabolism and cellular stress response, but also provides direct theoretical and experimental basis for the development of novel antidepressant strategies targeting this pathway. Study approval The Ethics Committee at Shandong University Animal Care and Use Committee (Jinan, China) approved the protocols of this study (ECSBMSSDU-2022-2-65). CRediT authorship contribution statement Wenjing Wang: Data curation, Formal analysis, Investigation, Methodology, Software, Writing – original draft, Writing – review & editing. Xiao Chen: Formal analysis, Investigation, Methodology. Ye Li: Investigation, Methodology. Changmin Wang: Investigation, Methodology. Mengni Chang: Investigation, Methodology. Ruojing Guo: Investigation, Methodology. Penghui Wei: Methodology, Resources, Software, Supervision, Writing – review & editing. Zhipeng Xu: Conceptualization, Data curation, Funding acquisition, Project administration, Resources, Supervision, Writing – review & editing. Shuyan Yu: Conceptualization, Data curation, Funding acquisition, Project administration, Resources, Software, Supervision, Validation, Writing – original draft, Writing – review & editing. Declaration of competing interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Acknowledgements and funding This study was supported by grants to Shuyan Yu from the National Natural Science Foundation of China (NSFC 82471549 and 82271566), grants to Penghui Wei from the National Natural Science Foundation of China (NSFC 82571352) and grants to Zhipeng Xu and Shuyan Yu from the Scientific Research Foundation of Qilu Hospital of Shandong University (Qingdao) (QDKY2025LH06). We thank Translational Medicine Core Facility of Shandong University for consultation and instrument availability that supported this work. Footnotes Appendix A Supplementary data to this article can be found online at https://doi.org/10.1016/j.redox.2026.104154 . Contributor Information Penghui Wei, Email: [email protected]. Zhipeng Xu, Email: [email protected]. Shuyan Yu, Email: [email protected]. Appendix A. Supplementary data The following are the Supplementary data to this article: Multimedia component 1 mmc1.docx (14.4KB, docx) Multimedia component 2 mmc2.docx (4.1MB, docx) Multimedia component 3 mmc3.pdf (2.8MB, pdf) Multimedia component 4 mmc4.xlsx (51KB, xlsx) Data availability Data will be made available on request. References 1. Marx W., Penninx B., Solmi M., Furukawa T.A., Firth J., Carvalho A.F., Berk M. Major depressive disorder. Nat. Rev. Dis. Primers. 2023;9:44. doi: 10.1038/s41572-023-00454-1. [ DOI ] [ PubMed ] [ Google Scholar ] 2. Malhi G.S., Mann J.J. Depression. Lancet. 2018;392:2299–2312. doi: 10.1016/S0140-6736(18)31948-2. [ DOI ] [ PubMed ] [ Google Scholar ] 3. Otte C., Gold S.M., Penninx B.W., Pariante C.M., Etkin A., Fava M., Mohr D.C., Schatzberg A.F. Major depressive disorder. Nat. Rev. Dis. Primers. 2016;2 doi: 10.1038/nrdp.2016.65. [ DOI ] [ PubMed ] [ Google Scholar ] 4. Cui L., Li S., Wang S., Wu X., Liu Y., Yu W., Wang Y., Tang Y., Xia M., Li B. Major depressive disorder: hypothesis, mechanism, prevention and treatment. Signal Transduct. Targeted Ther. 2024;9:30. doi: 10.1038/s41392-024-01738-y. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 5. Monroe S.M., Harkness K.L. Major depression and its recurrences: life course matters. Annu. Rev. Clin. Psychol. 2022;18:329–357. doi: 10.1146/annurev-clinpsy-072220-021440. [ DOI ] [ PubMed ] [ Google Scholar ] 6. Bakunina N., Pariante C.M., Zunszain P.A. Immune mechanisms linked to depression via oxidative stress and neuroprogression. Immunology. 2015;144:365–373. doi: 10.1111/imm.12443. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 7. Maes M., Almulla A.F., You Z., Zhang Y. Neuroimmune, metabolic and oxidative stress pathways in major depressive disorder. Nat. Rev. Neurol. 2025;21:473–489. doi: 10.1038/s41582-025-01116-4. [ DOI ] [ PubMed ] [ Google Scholar ] 8. Jiménez-Fernández S., Gurpegui M., Garrote-Rojas D., Gutiérrez-Rojas L., Carretero M.D., Correll C.U. Oxidative stress parameters and antioxidants in adults with unipolar or bipolar depression versus healthy controls: systematic review and meta-analysis. J. Affect. Disord. 2022;314:211–221. doi: 10.1016/j.jad.2022.07.015. [ DOI ] [ PubMed ] [ Google Scholar ] 9. Jiménez-Fernández S., Gurpegui M., Díaz-Atienza F., Pérez-Costillas L., Gerstenberg M., Correll C.U. Oxidative stress and antioxidant parameters in patients with major depressive disorder compared to healthy controls before and after antidepressant treatment: results from a meta-analysis. J. Clin. Psychiatry. 2015;76:1658–1667. doi: 10.4088/JCP.14r09179. [ DOI ] [ PubMed ] [ Google Scholar ] 10. Liu T., Zhong S., Liao X., Chen J., He T., Lai S., Jia Y. A meta-analysis of oxidative stress markers in depression. PLoS One. 2015;10 doi: 10.1371/journal.pone.0138904. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 11. Al-Hakeim H.K., Al-Rubaye H.T., Al-Hadrawi D.S., Almulla A.F., Maes M. Long-COVID post-viral chronic fatigue and affective symptoms are associated with oxidative damage, lowered antioxidant defenses and inflammation: a proof of concept and mechanism study. Mol. Psychiatr. 2023;28:564–578. doi: 10.1038/s41380-022-01836-9. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 12. Cao P., Chen C., Liu A., Shan Q., Zhu X., Jia C., Peng X., Zhang M., Farzinpour Z., Zhou W., et al. Early-life inflammation promotes depressive symptoms in adolescence via microglial engulfment of dendritic spines. Neuron. 2021;109:2573–2589.e2579. doi: 10.1016/j.neuron.2021.06.012. [ DOI ] [ PubMed ] [ Google Scholar ] 13. Li N., Du J., Yang Y., Zhao T., Wu D., Peng F., Wang D., Kong L., Zhou W., Hao A. Microglial PCGF1 alleviates neuroinflammation associated depressive behavior in adolescent mice. Mol. Psychiatr. 2025;30:914–926. doi: 10.1038/s41380-024-02714-2. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 14. Li B., Yang W., Ge T., Wang Y., Cui R. Stress induced microglial activation contributes to depression. Pharmacol. Res. 2022;179 doi: 10.1016/j.phrs.2022.106145. [ DOI ] [ PubMed ] [ Google Scholar ] 15. Ruan Y., Cheng J., Dai J., Ma Z., Luo S., Yan R., Wang L., Zhou J., Yu B., Tong X., et al. Chronic stress hinders sensory axon regeneration via impairing mitochondrial cristae and OXPHOS. Sci. Adv. 2023;9:eadh0183. doi: 10.1126/sciadv.adh0183. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 16. Fu S., Chen H., Yang W., Xia X., Zhao S., Xu X., Ai P., Cai Q., Li X., Wang Y., et al. ROS-Targeted depression therapy via BSA-Incubated ceria nanoclusters. Nano Lett. 2022;22:4519–4527. doi: 10.1021/acs.nanolett.2c01334. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 17. Scaini G., Mason B.L., Diaz A.P., Jha M.K., Soares J.C., Trivedi M.H., Quevedo J. Dysregulation of mitochondrial dynamics, mitophagy and apoptosis in major depressive disorder: does inflammation play a role? Mol. Psychiatr. 2022;27:1095–1102. doi: 10.1038/s41380-021-01312-w. [ DOI ] [ PubMed ] [ Google Scholar ] 18. Li Y., Jia Y., Wang D., Zhuang X., Li Y., Guo C., Chu H., Zhu F., Wang J., Wang X., et al. Programmed cell death 4 as an endogenous suppressor of BDNF translation is involved in stress-induced depression. Mol. Psychiatr. 2021;26:2316–2333. doi: 10.1038/s41380-020-0692-x. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 19. Li Y., Fan C., Wang L., Lan T., Gao R., Wang W., Yu S.Y. MicroRNA-26a-3p rescues depression-like behaviors in male rats via preventing hippocampal neuronal anomalies. J. Clin. Investig. 2021;131 doi: 10.1172/JCI148853. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 20. Wu Y., Tang Y., Mei Y., Wang W., Deng Q., Gao T., Lyv X., Zhou F., Fu Y., Zhao Z., et al. Decoding depression: stress-derived formaldehyde initiates depressive symptoms in mouse and human. Mol. Psychiatr. 2025 doi: 10.1038/s41380-025-03405-2. Online ahead of print. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 21. Wang W., Li Y., Wang L., Chen X., Lan T., Wang C., Chen S., Yu S. FBXL20 promotes synaptic impairment in depression disorder via degrading vesicle-associated proteins. J. Affect. Disord. 2024;349:132–144. doi: 10.1016/j.jad.2024.01.055. [ DOI ] [ PubMed ] [ Google Scholar ] 22. Li Y., Fan C., Wang C., Wang L., Yi Y., Mao X., Chen X., Lan T., Wang W., Yu S.Y. Stress-induced reduction of Na(+)/H(+) exchanger isoform 1 promotes maladaptation of neuroplasticity and exacerbates depressive behaviors. Sci. Adv. 2022;8:eadd7063. doi: 10.1126/sciadv.add7063. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 23. Bijata M., Bączyńska E., Müller F.E., Bijata K., Masternak J., Krzystyniak A., Szewczyk B., Siwiec M., Antoniuk S., Roszkowska M., et al. Activation of the 5-HT7 receptor and MMP-9 signaling module in the hippocampal CA1 region is necessary for the development of depressive-like behavior. Cell Rep. 2022;38 doi: 10.1016/j.celrep.2022.110532. [ DOI ] [ PubMed ] [ Google Scholar ] 24. Gamper N., Reznikov V., Yamada Y., Yang J., Shapiro M.S. Phosphatidylinositol [correction] 4,5-bisphosphate signals underlie receptor-specific Gq/11-mediated modulation of N-type Ca2+ channels. J. Neurosci. 2004;24:10980–10992. doi: 10.1523/JNEUROSCI.3869-04.2004. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 25. Nahorski S.R., Young K.W., John Challiss R.A., Nash M.S. Visualizing phosphoinositide signalling in single neurons gets a green light. Trends Neurosci. 2003;26:444–452. doi: 10.1016/S0166-2236(03)00178-4. [ DOI ] [ PubMed ] [ Google Scholar ] 26. Fernandes H.S., Popik B., de Oliveira Alvares L. Effects of hippocampal IP(3)R inhibition on contextual fear memory consolidation, retrieval, reconsolidation and extinction. Neurobiol. Learn. Mem. 2022;188 doi: 10.1016/j.nlm.2022.107587. [ DOI ] [ PubMed ] [ Google Scholar ] 27. Zhu H., Pan H., Fang Y., Wang H., Chen Z., Hu W., Tong L., Ren J., Lu X., Huang C. Apoptosis-induced decline in hippocampal microglia mediates the development of depression-like behaviors in adult mice triggered by unpredictable stress during adolescence. Eur. J. Pharmacol. 2024;978 doi: 10.1016/j.ejphar.2024.176763. [ DOI ] [ PubMed ] [ Google Scholar ] 28. Chen B., Zhao C., Zhu H., Lu X., Liu H., Lu Q., Zhu T., Huang C. β-glucan, a specific immuno-stimulant, produces rapid antidepressant effects by stimulating ERK1/2-dependent synthesis of BDNF in the hippocampus. Eur. J. Pharmacol. 2023;961 doi: 10.1016/j.ejphar.2023.176161. [ DOI ] [ PubMed ] [ Google Scholar ] 29. Zhang K., Zhao Y., Chen X., Li Y., Lan T., Chang M., Wang W., Wang C., Zhuang X., Zhang B., Yu S. p53 promote oxidative stress, neuroinflammation and behavioral disorders via DDIT4-NF-κB signaling pathway. Redox Biol. 2025;86 doi: 10.1016/j.redox.2025.103836. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 30. Lee J.H., Kim J.Y., Noh S., Lee H., Lee S.Y., Mun J.Y., Park H., Chung W.S. Astrocytes phagocytose adult hippocampal synapses for circuit homeostasis. Nature. 2021;590:612–617. doi: 10.1038/s41586-020-03060-3. [ DOI ] [ PubMed ] [ Google Scholar ] 31. Szklarczyk D., Gable A.L., Lyon D., Junge A., Wyder S., Huerta-Cepas J., Simonovic M., Doncheva N.T., Morris J.H., Bork P., et al. STRING v11: protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res. 2019;47:D607–d613. doi: 10.1093/nar/gky1131. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 32. Kohl M., Wiese S., Warscheid B. Cytoscape: software for visualization and analysis of biological networks. Methods Mol. Biol. 2011;696:291–303. doi: 10.1007/978-1-60761-987-1_18. [ DOI ] [ PubMed ] [ Google Scholar ] 33. Perdok A., Van Acker Z.P., Vrancx C., Sannerud R., Vorsters I., Verrengia A., Callaerts-Végh Z., Creemers E., Gutiérrez Fernández S., D'Hauw B., et al. Altered expression of Presenilin2 impacts endolysosomal homeostasis and synapse function in Alzheimer's disease-relevant brain circuits. Nat. Commun. 2024;15 doi: 10.1038/s41467-024-54777-y. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 34. Bretou M., Sannerud R., Escamilla-Ayala A., Leroy T., Vrancx C., Van Acker Z.P., Perdok A., Vermeire W., Vorsters I., Van Keymolen S., et al. Accumulation of APP C-terminal fragments causes endolysosomal dysfunction through the dysregulation of late endosome to lysosome-ER contact sites. Dev. Cell. 2024;59:1571–1592.e1579. doi: 10.1016/j.devcel.2024.03.030. [ DOI ] [ PubMed ] [ Google Scholar ] 35. Pan S., Ma Y., Yang R., Lu X., You Q., Ye T., Huang C. Indole-3-Carbinol selectively prevents chronic stress-induced depression-but not anxiety-like behaviors via suppressing pro-inflammatory cytokine production and oxido-nitrosative stress in the brain. Front. Pharmacol. 2022;13 doi: 10.3389/fphar.2022.829966. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 36. Ren Y., Sun-Waterhouse D., Ouyang F., Tan X., Li D., Xu L., Li B., Wang Y., Li F. Apple phenolic extracts ameliorate lead-induced cognitive impairment and depression- and anxiety-like behavior in mice by abating oxidative stress, inflammation and apoptosis via the miR-22-3p/SIRT1 axis. Food Funct. 2022;13:2647–2661. doi: 10.1039/d1fo03750a. [ DOI ] [ PubMed ] [ Google Scholar ] 37. Huang F., Pariante C.M., Borsini A. From dried bear bile to molecular investigation: a systematic review of the effect of bile acids on cell apoptosis, oxidative stress and inflammation in the brain, across pre-clinical models of neurological, neurodegenerative and neuropsychiatric disorders. Brain Behav. Immun. 2022;99:132–146. doi: 10.1016/j.bbi.2021.09.021. [ DOI ] [ PubMed ] [ Google Scholar ] 38. Islam M.R., Rauf A., Akash S., Trisha S.I., Nasim A.H., Akter M., Dhar P.S., Ogaly H.A., Hemeg H.A., Wilairatana P., Thiruvengadam M. Targeted therapies of curcumin focus on its therapeutic benefits in cancers and human health: molecular signaling pathway-based approaches and future perspectives. Biomed. Pharmacother. 2024;170 doi: 10.1016/j.biopha.2023.116034. [ DOI ] [ PubMed ] [ Google Scholar ] 39. Jia X., Gao Z., Hu H. Microglia in depression: current perspectives. Sci. China Life Sci. 2021;64:911–925. doi: 10.1007/s11427-020-1815-6. [ DOI ] [ PubMed ] [ Google Scholar ] 40. Rantamäki T., Kohtala S. Encoding, consolidation, and renormalization in depression: synaptic homeostasis, plasticity, and sleep integrate rapid antidepressant effects. Pharmacol. Rev. 2020;72:439–465. doi: 10.1124/pr.119.018697. [ DOI ] [ PubMed ] [ Google Scholar ] 41. Nemoto Y., De Camilli P. Recruitment of an alternatively spliced form of synaptojanin 2 to mitochondria by the interaction with the PDZ domain of a mitochondrial outer membrane protein. EMBO J. 1999;18:2991–3006. doi: 10.1093/emboj/18.11.2991. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 42. Hees J.T., Wanderoy S., Lindner J., Helms M., Murali Mahadevan H., Harbauer A.B. Insulin signalling regulates Pink1 mRNA localization via modulation of AMPK activity to support PINK1 function in neurons. Nat. Metab. 2024;6:514–530. doi: 10.1038/s42255-024-01007-w. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 43. Nemoto Y., Arribas M., Haffner C., DeCamilli P. Synaptojanin 2, a novel synaptojanin isoform with a distinct targeting domain and expression pattern. J. Biol. Chem. 1997;272:30817–30821. doi: 10.1074/jbc.272.49.30817. [ DOI ] [ PubMed ] [ Google Scholar ] 44. Chuang Y., Xu X., Kwiatkowska A., Tsapraillis G., Hwang H., Petritis K., Flynn D., Symons M. Regulation of synaptojanin 2 5'-phosphatase activity by src. Cell Adhes. Migrat. 2012;6:518–525. doi: 10.4161/cam.22139. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 45. Smith S.M., Smith C.J. Capturing the mechanics of clathrin-mediated endocytosis. Curr. Opin. Struct. Biol. 2022;75 doi: 10.1016/j.sbi.2022.102427. [ DOI ] [ PubMed ] [ Google Scholar ] 46. Kobayashi K., Shaver J.K., Liang W., Siperstein A.E., Duh Q.Y., Clark O.H. Increased phospholipase C activity in neoplastic thyroid membrane. Thyroid. 1993;3:25–29. doi: 10.1089/thy.1993.3.25. [ DOI ] [ PubMed ] [ Google Scholar ] 47. Falzone M.E., MacKinnon R. The mechanism of Gα(q) regulation of PLCβ3-catalyzed PIP2 hydrolysis. Proc. Natl. Acad. Sci. U. S. A. 2023;120 doi: 10.1073/pnas.2315011120. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 48. Ivanova A., Atakpa-Adaji P., Rao S., Marti-Solano M., Taylor C.W. Dual regulation of IP(3) receptors by IP(3) and PIP(2) controls the transition from local to global Ca(2+) signals. Mol. Cell. 2024;84:3997–4015.e3997. doi: 10.1016/j.molcel.2024.09.009. [ DOI ] [ PubMed ] [ Google Scholar ] 49. Hsu Y.C., Ip M.M. Conjugated linoleic acid-induced apoptosis in mouse mammary tumor cells is mediated by both G protein coupled receptor-dependent activation of the AMP-activated protein kinase pathway and by oxidative stress. Cell. Signal. 2011;23:2013–2020. doi: 10.1016/j.cellsig.2011.07.015. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 50. Lim M.H., Jeung I.C., Jeong J., Yoon S.J., Lee S.H., Park J., Kang Y.S., Lee H., Park Y.J., Lee H.G., et al. Graphene oxide induces apoptotic cell death in endothelial cells by activating autophagy via calcium-dependent phosphorylation of c-Jun N-terminal kinases. Acta Biomater. 2016;46:191–203. doi: 10.1016/j.actbio.2016.09.018. [ DOI ] [ PubMed ] [ Google Scholar ] 51. Dantzer R., O'Connor J.C., Freund G.G., Johnson R.W., Kelley K.W. From inflammation to sickness and depression: when the immune system subjugates the brain. Nat. Rev. Neurosci. 2008;9:46–56. doi: 10.1038/nrn2297. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 52. Shi M., Li X., Fan Z., Wang Y., Li C., Ning Y., Ma Y., Sun M., Xia X., Du J., Zheng J.C. N-Acetylcysteine-Capped TLQP21-Containing Au Nanocages Alleviate Depression in Mice. ACS Nano. 2025;19:37186–37205. doi: 10.1021/acsnano.5c11681. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 53. Ding Y., Dai J. Advance in stress for depressive disorder. Adv. Exp. Med. Biol. 2019;1180:147–178. doi: 10.1007/978-981-32-9271-0_8. [ DOI ] [ PubMed ] [ Google Scholar ] 54. Bartsch T., Döhring J., Rohr A., Jansen O., Deuschl G. CA1 neurons in the human hippocampus are critical for autobiographical memory, mental time travel, and autonoetic consciousness. Proc. Natl. Acad. Sci. U. S. A. 2011;108:17562–17567. doi: 10.1073/pnas.1110266108. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 55. Ma Z.Z., Guzikowski N.J., Kim J.W., Kavalali E.T., Monteggia L.M. Enhanced ERK activity extends ketamine's antidepressant effects by augmenting synaptic plasticity. Science. 2025;388:646–655. doi: 10.1126/science.abb6748. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 56. Foo J., Bellot G., Pervaiz S., Alonso S. Mitochondria-mediated oxidative stress during viral infection. Trends Microbiol. 2022;30:679–692. doi: 10.1016/j.tim.2021.12.011. [ DOI ] [ PubMed ] [ Google Scholar ] 57. Hohorst L., Ros U., Garcia-Saez A.J. Mitochondrial dynamics and pore formation in regulated cell death pathways. Trends Biochem. Sci. 2025;50:1001–1014. doi: 10.1016/j.tibs.2025.09.001. [ DOI ] [ PubMed ] [ Google Scholar ] 58. Yang B., Wang L., Nie Y., Wei W., Xiong W. proBDNF expression induces apoptosis and inhibits synaptic regeneration by regulating the RhoA-JNK pathway in an in vitro post-stroke depression model. Transl. Psychiatry. 2021;11:578. doi: 10.1038/s41398-021-01667-2. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 59. Ji X., Liu R., Guo J., Li Y., Cheng W., Pang Y., Zheng Y., Zhang R., Tang J. Olfactory bulb microglia activation mediated neuronal death in real-ambient particulate matter exposure mice with depression-like behaviors. Sci. Total Environ. 2022;821 doi: 10.1016/j.scitotenv.2022.153456. [ DOI ] [ PubMed ] [ Google Scholar ] 60. Oladapo A., Kannan M., Deshetty U.M., Singh S., Buch S., Periyasamy P. Methamphetamine-mediated astrocytic pyroptosis and neuroinflammation involves miR-152-NLRP6 inflammasome signaling axis. Redox Biol. 2025;80 doi: 10.1016/j.redox.2025.103517. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 61. Carr H.S., Chang J.T., Frost J.A. The PDZ domain protein SYNJ2BP regulates GRK-Dependent Sst2A phosphorylation and downstream MAPK signaling. Endocrinology. 2021;162 doi: 10.1210/endocr/bqaa229. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 62. Wang M., Wu H., Li S., Xu Z., Li X., Yang Y., Li B., Li Y., Guo J., Chen H. SYNJ2BP promotes the degradation of PTEN through the lysosome-pathway and enhances breast tumor metastasis via PI3K/AKT/SNAI1 signaling. Oncotarget. 2017;8:89692–89706. doi: 10.18632/oncotarget.21058. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 63. Jo S.I., Kim S., Lim J.M., Rhee S.G., Jeong B.G., Cha S.S., Chang J.B., Kang D. Control of the signaling role of PtdIns(4)P at the plasma membrane through H(2)O(2)-dependent inactivation of synaptojanin 2 during endocytosis. Redox Biol. 2024;71 doi: 10.1016/j.redox.2024.103097. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 64. Miyata M., Finch E.A., Khiroug L., Hashimoto K., Hayasaka S., Oda S.I., Inouye M., Takagishi Y., Augustine G.J., Kano M. Local calcium release in dendritic spines required for long-term synaptic depression. Neuron. 2000;28:233–244. doi: 10.1016/s0896-6273(00)00099-4. [ DOI ] [ PubMed ] [ Google Scholar ] 65. Jo J., Son G.H., Winters B.L., Kim M.J., Whitcomb D.J., Dickinson B.A., Lee Y.B., Futai K., Amici M., Sheng M., et al. Muscarinic receptors induce LTD of NMDAR EPSCs via a mechanism involving hippocalcin, AP2 and PSD-95. Nat. Neurosci. 2010;13:1216–1224. doi: 10.1038/nn.2636. [ DOI ] [ PubMed ] [ Google Scholar ] 66. Niciu M.J., Ionescu D.F., Mathews D.C., Richards E.M., Zarate C.A., Jr. Second messenger/signal transduction pathways in major mood disorders: moving from membrane to mechanism of action, part II: bipolar disorder. CNS Spectr. 2013;18:242–251. doi: 10.1017/S1092852913000138. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 67. Prager P., Hollborn M., Steffen A., Wiedemann P., Kohen L., Bringmann A. P2Y1 receptor signaling contributes to high salt-induced priming of the NLRP3 inflammasome in retinal pigment epithelial cells. PLoS One. 2016;11 doi: 10.1371/journal.pone.0165653. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 68. Uno I., Fukami K., Kato H., Takenawa T., Ishikawa T. Essential role for phosphatidylinositol 4,5-bisphosphate in yeast cell proliferation. Nature. 1988;333:188–190. doi: 10.1038/333188a0. [ DOI ] [ PubMed ] [ Google Scholar ] 69. Balla T. Finding partners for PI3Kgamma: when 84 is better than 101. Sci. Signal. 2009;2:pe35. doi: 10.1126/scisignal.274pe35. [ DOI ] [ PubMed ] [ Google Scholar ] 70. Suh B.C., Hille B. PIP2 is a necessary cofactor for ion channel function: how and why? Annu. Rev. Biophys. 2008;37:175–195. doi: 10.1146/annurev.biophys.37.032807.125859. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 71. Hackelberg S., Oliver D. Metabotropic acetylcholine and glutamate receptors mediate PI(4,5)P(2) depletion and oscillations in hippocampal CA1 pyramidal neurons in situ. Sci. Rep. 2018;8 doi: 10.1038/s41598-018-31322-8. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 72. Kim S.J., Jeong M.J., Jo H.J., Jung J.H., Kaang B.K., Choi Y.B., Kim J.H. Identification of postsynaptic phosphatidylinositol-4,5-bisphosphate (PIP(2)) roles for synaptic plasticity using chemically induced dimerization. Sci. Rep. 2017;7:3351. doi: 10.1038/s41598-017-03520-3. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 73. Samoilov M.O., Semenov D.G., Tulkova E.I., Lazarewicz J.W. Early postanoxic changes of polyphosphoinositides and bound Ca2+ content in relation to neuronal activity in brain cortex. Resuscitation. 1992;23:33–43. doi: 10.1016/0300-9572(92)90160-e. [ DOI ] [ PubMed ] [ Google Scholar ] 74. Yang Z., Zheng Y., Ma D., Wang L., Zhang J., Song T., Wang Y., Zhang Y., Nan F., Su N., et al. Phosphatidylinositol 4,5-bisphosphate activation mechanism of human KCNQ5. Proc. Natl. Acad. Sci. U. S. A. 2025;122 doi: 10.1073/pnas.2416738122. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Associated Data This section collects any data citations, data availability statements, or supplementary materials included in this article. Supplementary Materials Multimedia component 5 Download video file (4.7MB, mp4) Multimedia component 6 Download video file (4.7MB, mp4) Multimedia component 7 Download video file (4.7MB, mp4) Multimedia component 8 Download video file (4.7MB, mp4) Multimedia component 9 Download video file (1.1MB, mp4) Multimedia component 10 Download video file (4.5MB, mp4) Multimedia component 11 Download video file (4.8MB, mp4) Multimedia component 12 Download video file (4.7MB, mp4) Multimedia component 13 Download video file (4.7MB, mp4) Multimedia component 14 Download video file (4.5MB, mp4) Multimedia component 15 Download video file (1MB, mp4) Multimedia component 16 Download video file (4.6MB, mp4) Multimedia component 17 Download video file (1MB, mp4) Multimedia component 18 Download video file (4.5MB, mp4) Multimedia component 19 Download video file (1.1MB, mp4) Multimedia component 20 Download video file (4.7MB, mp4) Multimedia component 1 mmc1.docx (14.4KB, docx) Multimedia component 2 mmc2.docx (4.1MB, docx) Multimedia component 3 mmc3.pdf (2.8MB, pdf) Multimedia component 4 mmc4.xlsx (51KB, xlsx) Data Availability Statement Data will be made available on request. Articles from Redox Biology are provided here courtesy of Elsevier ACTIONS View on publisher site PDF (35.7 MB) Cite Collections Permalink PERMALINK Copy RESOURCES Similar articles Cited by other articles Links to NCBI Databases Cite Copy Download .nbib .nbib Format: AMA APA MLA NLM Add to Collections Create a new collection Add to an existing collection Name your collection * Choose a collection Unable to load your collection due to an error Please try again Add Cancel Follow NCBI NCBI on X (formerly known as Twitter) NCBI on Facebook NCBI on LinkedIn NCBI on GitHub NCBI RSS feed Connect with NLM NLM on X (formerly known as Twitter) NLM on Facebook NLM on YouTube National Library of Medicine 8600 Rockville Pike Bethesda, MD 20894 Web Policies FOIA HHS Vulnerability Disclosure Help Accessibility Careers NLM NIH HHS USA.gov Back to Top