Extracts From Grapefruit (Citrus paradisi) Peel via Microwave-Assisted and Conventional Extractions: Evaluation of Nosema Infection and Toxicity in Honey Bees.

Skip to main content An official website of the United States government Here's how you know Here's how you know Official websites use .gov A .gov website belongs to an official government organization in the United States. Secure .gov websites use HTTPS A lock ( Lock Locked padlock icon ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites. Search Log in Dashboard Publications Account settings Log out Search… Search NCBI Primary site navigation Search Logged in as: Dashboard Publications Account settings Log in Search PMC Full-Text Archive Search in PMC Journal List User Guide PERMALINK Copy As a library, NLM provides access to scientific literature. Inclusion in an NLM database does not imply endorsement of, or agreement with, the contents by NLM or the National Institutes of Health. Learn more: PMC Disclaimer | PMC Copyright Notice Vet Med Sci . 2026 Apr 10;12(3):e70917. doi: 10.1002/vms3.70917 Search in PMC Search in PubMed View in NLM Catalog Add to search Extracts From Grapefruit ( Citrus paradisi ) Peel via Microwave‐Assisted and Conventional Extractions: Evaluation of Nosema Infection and Toxicity in Honey Bees Muhammet Mükerrem Kaya Muhammet Mükerrem Kaya 1 Faculty of Veterinary Medicine, Department of Pharmacology and Toxicology, Burdur Mehmet Akif Ersoy University, Burdur, Türkiye Find articles by Muhammet Mükerrem Kaya 1, ✉ , Hidayet Tutun Hidayet Tutun 1 Faculty of Veterinary Medicine, Department of Pharmacology and Toxicology, Burdur Mehmet Akif Ersoy University, Burdur, Türkiye Find articles by Hidayet Tutun 1 , Nilüfer Vural Nilüfer Vural 2 Institute of Public Health, Department of Traditional Complementary and Integrative Medicine, Biotherapeutic Products Research and Development Program, University of Ankara Yıldırım Beyazit, Ankara, Türkiye Find articles by Nilüfer Vural 2 , Özlem Özmen Özlem Özmen 3 Faculty of Veterinary Medicine, Department of Pathology, Burdur Mehmet Akif Ersoy University, Burdur, Türkiye Find articles by Özlem Özmen 3 , Samet Okuyan Samet Okuyan 4 Apiculture Research Institute, Ordu, Türkiye Find articles by Samet Okuyan 4 Author information Article notes Copyright and License information 1 Faculty of Veterinary Medicine, Department of Pharmacology and Toxicology, Burdur Mehmet Akif Ersoy University, Burdur, Türkiye 2 Institute of Public Health, Department of Traditional Complementary and Integrative Medicine, Biotherapeutic Products Research and Development Program, University of Ankara Yıldırım Beyazit, Ankara, Türkiye 3 Faculty of Veterinary Medicine, Department of Pathology, Burdur Mehmet Akif Ersoy University, Burdur, Türkiye 4 Apiculture Research Institute, Ordu, Türkiye ✉ Corresponding author. Revised 2026 Feb 27; Received 2026 Jan 1; Accepted 2026 Mar 14; Collection date 2026 May. © 2026 The Author(s). Veterinary Medicine and Science published by John Wiley & Sons Ltd. This is an open access article under the terms of the http://creativecommons.org/licenses/by-nc/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes. PMC Copyright notice PMCID: PMC13067986  PMID: 41961239 ABSTRACT Background and Objectives This study aimed to assess the effects of grapefruit peel extract on bee health and its anti‐nosema activity. Methods Conventional and microwave‐assisted extractions of grapefruit peels were optimized by using the response surface method based on a central composite design approach. HPLC was used to determine the polyphenolic content of the optimal extracts. The effects of optimum extracts on honeybees were evaluated through acute (4%, 2%, 1%, 0.5%, and 0.25%) and chronic (2%, 1%, 0.5%, and 0.25%) toxicity tests, as well as longevity assessments (2%, 1%, 0.5%, and 0.25%). Furthermore, the effects of the extracts on intestinal health were evaluated by histopathological examination, and the anti‐nosema activity of the optimum extracts (1%) was assessed. Results In the toxicity tests, histopathological examinations showed that the extracts had no adverse effects on midgut health. While a 10‐day feeding with the optimized extracts did not show a significant difference in overall lifespan, the longevity study showed that bees given 1% of the conventional optimal extract survived longer than the control group. The optimal extracts did not produce high anti‐nosema activity at the applied dose. Conclusions Optimized phenolic‐rich extracts have mild health‐promoting effects and may offer mild support against Nosema , encouraging further research into bee health and disease management. Keywords: grapefruit, honeybee, Nosema , optimization Conventional and microwave‐assisted extractions of grapefruit peels were optimized using response surface methodology (RSM) based on TPC, TFC, and antioxidant activity (DPPH). The phytochemical profiles of the two optimum extracts were characterized via HPLC before evaluating their acute and chronic toxicity, as well as their effects on honey bee ( Apis mellifera ) longevity. The effects of these optimized extracts on the overall health of honeybees and their anti‐nosema potential were investigated. 1. Introduction Honey bees, Apis mellifera L., contribute significantly to the pollination of many agricultural products and are responsible for the production of various products, such as honey, pollen, propolis, royal jelly, and beeswax. They are distributed in many regions of the world except for Antarctica (Boncristiani et al. 2020 ; Hung et al. 2018 ). The nutrition of honeybees is largely shaped by the environment, namely the floral composition in nature. Honeybees encounter dynamically changing floral resources in their environment. The quantity and quality of these floral resources are also dynamic throughout the year. Therefore, honeybees may face significant challenges in terms of pollen diversity, quantity, and quality depending on their geographical location (Tsuruda et al. 2021 ). In recent years, agricultural areas have changed greatly due to the increasing food demand, causing loss of biodiversity. Accordingly, significant bee losses have occurred in Europe and North America (Requier et al. 2015 ). Due to these changes in agricultural areas and the environment, studies on plant‐based food supplements for honeybees have increased in recent years (Potrich et al. 2020 ). In recent years, increasing colony losses have led to a decline in bee populations. Various factors cause colony losses, which can be caused alone or in combination. These factors are microsporidia, mites, viruses, bacteria, and fungi. In addition to these, pesticides, climate change, environmental pollution, and urbanization are among the factors causing bee losses (Hristov et al. 2020 ; Insolia et al. 2022 ; Aurell et al. 2023 ; García‐Vicente et al. 2024 ). Nosemosis is a disease triggered by the single‐celled spore‐forming fungi Vairimorpha apis ( Nosema apis ) and Vairimorpha ceranae ( Nosema ceranae ), which can cause severe colony losses in honeybees. Fumagillin is an effective drug in the treatment of nosema infection. However, it has been banned in many countries due to its toxicity (Burnham 2019 ). The search for natural therapeutic agents with strong anti‐nosema activity, non‐toxic or low toxicity to bees, and no residue problems has gained importance in the prevention and treatment of nosemosis disease in honeybee colonies. Numerous studies demonstrated that various plant extracts can be effective in the treatment of nosema infection (El‐Sayed et al. 2024 ; Chaimanee et al. 2021 ; Iorizzo et al. 2022 ). Citrus fruits belonging to the genus Citrus L. in the Rutaceae family are among the most important fruit crops in the world with grapefruit, pomelo, orange, lemon, lime, citron, kumquat, and hybrids obtained from them. Citrus fruits, which are mostly consumed as fresh products or juices, have been reported to have many effects, such as anti‐inflammatory (Milenkovic et al. 2011 ; Sánchez‐Moreno et al. 2003 ), anti‐cancer (Cirmi et al. 2016 ; Narayanankutty et al. 2022 ), anti‐fungal (Liu et al. 2021 ), anti‐oxidant (García‐Nicolás et al. 2023 ; Saleem et al. 2023 ), and anti‐aging (Kim et al. 2016 ). Citrus fruits contain many bioactive compounds such as phenolic compounds (flavonoids, phenolic acids, and coumarins) and terpenoids (limonoids and carotenoids) (Maqbool et al. 2023 ; Saini et al. 2022 ). Citrus peels have a very high bioactive content. The peel part consists of the flavedo part, which forms the coloured outer part, and the albedo part, which forms the white inner part (Andrade et al. 2022 ). Grapefruit peels are used in health and industrial applications due to their various biological activities. The peels can be used as cell protectors due to their high anti‐oxidant activity (Castro‐Vázquez et al. 2016 ). Grapefruit peels contain flavonoids with high anti‐oxidant activity and show cell protective effects with these properties. The phenolic compounds in their composition can have positive effects on cardiovascular diseases (Ademosun et al. 2015 ; Flori et al. 2022 ; Sanchez Macarro et al. 2020 ). Nanoemulsion of polyphenolics can be used in food packaging and increasing the oxidative stability of oils (Nishad et al. 2021 ). In addition, citrus peels are very rich in pectin, a carbohydrate with a colloidal structure and capable of forming gels. The peels of citrus contain approximately 20%–30% pectin (Güzel and Akpınar 2017 ). The most common method used to obtain pectin is to solubilize and extract it using heat and acid solution. In addition to this method, methods such as microwave and ultrasonic and enzymatic extraction are also being developed to obtain pectin (Taşan and Akpınar 2020 ). However, a study has shown that pectin exhibited toxic effect on honey bees. All bees fed with 4% pectin‐containing sugar syrup for 16 days died. For this reason, pectin levels should be kept to a minimum in the diet of honeybees (Barker 1977 ). In recent years, approaches aimed at recycling raw materials considered waste to the economy have gained importance as a result of the decrease in natural resources. In this context, the circular economy model aims to reuse and recycle products considered waste and ensures that materials are put back into use and integrated into the supply chain. Thus, it is aimed to minimize environmental losses (Campos et al. 2020 ). Citrus fruits are among the most consumed fruits and the resulting amount of waste is also quite high. These wastes can be reevaluated and added to the economy, due to their high polyphenolic compound content, and this process can contribute directly or indirectly to the circular economy. In recent years, various studies have been conducted to evaluate citrus waste in this direction (Mateus et al. 2024 ; Taghizadeh‐Alisaraei et al. 2017 ). It has been reported that there are widely present many polyphenolic compounds, such as gallic acid, p‐hydroxybenzoic acid, caffeic acid, coumaric acid, ferulic acid, naringin, narirutin, and hesperidin in the peel of the grapefruit fruit (Goulas and Manganaris 2012 ; Suleria et al. 2020 ; Islam et al. 2023 ; Giannuzzo et al. 2003 ). These phenolic compounds have been demonstrated to have a positive impact on honeybee health and disease management (Hýbl et al. 2021 ; Bava et al. 2023 ). Previous research has established that polyphenolic compounds are abundant, and some of these compounds in grapefruit may be effective against nosemosis (Balamurugan et al. 2022 ; Kunat‐Budzyńska et al. 2022 ; Pașca et al. 2021 ). The separation of phenolic compounds and pectin in grapefruit peel and extraction with the highest efficiency is important not only in terms of waste management but also in providing sustainable and economical solutions in the health, food, and animal nutrition sectors. Reprocessing agricultural wastes, such as grapefruit peels, into useful products both protects the environment and creates economic value. The aim of this study is (1) to obtain the most optimal extracts in terms of total phenolic content (TPC), total flavonoid content (TFC), and anti‐radical activity (2,2‐diphenyl‐1‐picrylhydrazyl [DPPH]) by conventional and microwave‐assisted extraction methods and (2) to investigate the effects of the optimal extracts on the bee health and Nosema . 2. Material and Methods 2.1. Sample Collection and Preparation In this study, grapefruit ( Citrus paradisi ) obtained from local producers in the Serik district of Antalya was harvested in January 2023, and the peels of grapefruit were separated from the fruit part and dried at room temperature in the shade for 7 days. The dried peels were ground with a spice grinder and stored at −20°C until use. 2.2. Experimental Design Response surface methodology (RSM) was used to determine the optimum extraction conditions for extracts to be obtained from grapefruit peels. Central composite design (CCD) was used for experimental design. The independent variables determined for conventional extraction are solvent ratio ( X 1 ; %), solvent/solid ratio ( X 2 ; mL/g), time ( X 3 ; hours), and temperature ( X 4 ; °C) (Table 1 ). The independent variables determined for microwave‐assisted extraction are solvent ratio ( X 1 ; %) (EtOH: H 2 O), solvent/solid ratio ( X 2 ; mL/g), time ( X 3 ; minute), and microwave power ( X 4 ; W) (Table 3 ). The microwave device (IFTECH (R&D), Türkiye) was designed at 2450 MHz fixed frequency and max 1000W power. The best optimization solution was solved with the desirability function. A multi‐objective optimization approach was used in the studies to achieve the highest amounts of TPC, TFC, and anti‐radical activity (DPPH) with the specified extraction methods. The extracts with the highest amount in terms of response variables (TPC, TFC, DPPH) were determined for both methods. The experimental design was created using the Design Expert v22.0 software, and the experimental conditions for conventional extraction were applied as specified in Table 2 . The experimental design created with microwave‐assisted extraction was given in Tables 2 and 3 . In order to ensure the meaningfulness of the model, backward elimination was applied in some models. Y = β 0 + ∑ i = 1 k β i X i + ∑ i = 1 k β i i X i 2 + ∑ i = 1 k − 1 ∑ j = i + 1 k β i j X i X j + ε , in the second‐order model given above, Y is the response variable; β 0 is the constant term; X i and X i 2 are the independent variables; β i β ii are the regression coefficients; and ε is the residual, or random error, associated with the experiments. TABLE 1. Experimental design for conventional extraction. Coded levels Independent variables −α −1 0 1 +α Solvent ratio ( X 1 ) (%) 0 25 50 75 100 Solvent/solid ratio ( X 2 ) (mL/g) 10 20 30 40 50 Time ( X 3 ) (h) 2 8 14 20 26 Temperature ( X 4 ) (°C) 20 30 40 50 60 Open in a new tab TABLE 3. Experimental design for microwave‐assisted extraction (MAE). Coded levels Independent variables −α −1 0 1 +α Solvent ratio ( X 1 ) (%) 0 25 50 75 100 Solvent/solid ratio ( X 2 ) (mL/g) 10 30 50 70 90 Time ( X 3 ) (min) 2 3 4 5 6 Microwave power ( X 4 ) (W) 175 350 425 525 700 Open in a new tab TABLE 2. Central composite design (CCD) for the conventional extraction from grapefruit peel. Conventional extraction Microwave‐assisted extraction Run X 1 : Solvent ratio (%) X 2 : Solvent/solid ratio (mL/g) X 3 : Time (h) X 4 : Temperature (°C) X 1 : Solvent ratio (%) X 2 : Solvent/solid ratio (mL/g) X 3 : Time (h) X 4 : Microwave power (W) 1 50 30 14 40 75 70 5 525 2 50 30 2 40 25 30 5 525 3 75 40 8 30 75 30 5 350 4 50 10 14 40 75 70 3 525 5 25 40 8 50 50 50 4 425 6 50 30 26 40 25 30 5 350 7 75 40 20 30 25 70 5 350 8 100 30 14 40 50 50 4 175 9 75 40 20 50 25 70 3 525 10 50 30 14 40 75 30 5 525 11 75 20 8 50 75 70 3 350 12 75 40 8 50 50 50 4 425 13 25 40 20 30 50 50 4 425 14 0 30 14 40 75 70 5 350 15 50 30 14 40 50 50 4 425 16 25 40 8 30 50 50 4 425 17 50 30 14 40 50 90 4 425 18 75 20 20 30 50 50 4 700 19 50 30 14 20 50 10 4 425 20 50 30 14 40 75 30 3 525 21 50 30 14 60 25 70 3 350 22 50 50 14 40 75 30 3 350 23 75 20 8 30 0 50 4 425 24 75 20 20 50 100 50 4 425 25 25 20 8 30 25 70 5 525 26 25 20 20 30 50 50 2 425 27 25 20 8 50 50 50 6 425 28 25 40 20 50 50 50 4 425 29 50 30 14 40 25 30 3 350 30 25 20 20 50 25 30 3 525 Open in a new tab 2.3. Extracts Analysis 2.3.1. Total Phenolic Content, Total Flavonoid Content, and 2,2‐Diphenyl‐1‐Picrylhydrazyl The modified Folin–Ciocalteu method was used to quantify TPC in grapefruit extract (Pełka et al. 2021 ; Zhang et al. 2006 ). The TPC was expressed as micrograms of gallic acid equivalent (GAE) per millilitre of extract. The TFC was determined by the aluminium chloride colorimetric method as described by Sembiring et al. ( 2018 ) with minor modifications using quercetin as a reference compound. The TFC was expressed as micrograms of quercetin equivalents (QE) per millilitre of extract. Anti‐radical activities of the extracts were estimated by using DPPH test according to the methods of Ben Mansour et al. ( 2016 ) and Herald et al. ( 2012 ) with minor modifications. In the experiments created in the design, DPPH values were given as % inhibition. DPPH values ​​of the optimum extracts were given as milligram ascorbic acid equivalent/g grapefruit peel dry matter. All measurements were carried out in duplicate. 2.3.2. High‐Performance Liquid Chromatography‐Photodiode Array Analysis Analysis of polyphenolic compounds (flavanone, phenolic acid, etc.) from grapefruit extracts was performed according to the method reported by Wen et al. ( 2021 ). The regression parameters performed for the high‐performance liquid chromatography (HPLC) method are given in Table 4 . It was carried out with an HPLC system (Shimadzu) equipped with an Inertsil C18 (250 × 4.60 mm) 5‐µm analytical column, autosampler, degasser, column oven, and a photodiode array (PDA) detector. In the analytical column, a linear step gradient mobile phase consisting of 0.2% phosphoric acid (solvent A) and acetonitrile (solvent B), starting from 70% of solvent A and decreasing to 20%, was applied at a solvent flow rate of 0.6 mL/min. The column temperature was 40°C ± 1. The injection volume in the system using the autosampler was 20 µL. Scanning was performed with the PDA detector in the wavelength range of 190–650 nm, the appropriate maximum absorbance wavelength was used for each standard substance, and quantitative analysis was performed for the peaks determined in the chromatograms at the wavelength at which each standard substance had maximum absorption (230, 280, 320, 330 and 360). Minitab software (version 17 for PC; Minitab Inc.) was used for the correlation coefficient analysis. Standard solutions are gallic acid, chlorogenic acid, caffeic acid, ferulic acid, hesperidin, naringenin, narirutin, rosmarinic acid, kaempferol, quercetin, and galacturonic acid. TABLE 4. Regression parameters of polyphenolic compounds determined by HPLC method. Wavelength (nm) Regression equation y = m (x) + n Correlation coefficient ( r ) Linear range a (µg mL −1 ) LOD b (µg mL −1 ) LOQ b (µg mL −1 ) Gallic acid 280 y = 1.8 10 5 ( x ) + 11345 0.9998 0.5–150 0.220 0.73 Chlorogenic acid 320 y = 567.22 ( x ) − 18.44 0.9988 0.2–150 0.065 0.22 Caffeic acid 320 y = 4238.34 ( x ) − 345.87 0.9994 0.25–150 0.080 0.27 Ferulic acid 320 y = 396.78 ( x ) −123.55 0.9991 0.20–150 0.055 0.18 Hesperidin 280 y = 3476.45 ( x ) − 698.21 0.9989 0.5–250 0.125 0.41 Naringenin 280 y = 59831.22 ( x ) + 2256 0.9993 0.5–250 0.205 0.68 Narirutin 280 y = 687.21 ( x ) + 113 0.9988 0.5–250 0.083 0.27 Rosmarinic acid 330 y = 2768 ( x ) + 13.65 0.9988 0.1–150 0.085 0.28 Kaempferol 280 y = 3845 ( x ) − 398.71 0.9965 0.1–200 0.055 0.18 Quercetin 360 y = 398 ( x ) − 42.67 0.9969 0.2–150 0.075 0.25 Galacturonic acid 230 y = 1865 ( x ) + 143 0.9984 0.5–150 0.015 0.05 Open in a new tab a Ten calibration points were studied for linearity range ( n = 10). b Three replicates were performed ( n = 3), LOD (µg/mL) = 3.3 (SD of the response/slope), LOQ (µg/mL) = 10 (SD of the response/slope). 2.3.3. Pectin Analysis Analysis of pectin content from unused pulp parts of extracts obtained by RSM was performed according to Bagherian et al. ( 2011 ) and Taşan and Akpınar ( 2020 ). Extracts optimized according to RSM were centrifuged at 4000 rpm for 10 min. After centrifugation, pulp part and extract were separated. Extracts collected in the upper part were collected to be used in bee studies. Pectin analysis was performed by drying in pulp part. Pectin was obtained from dried pulp parts under conditions of pH 1, 30 mL/g solvent solid ratio, 3 h, and 80°C. Accordingly, 150 mL of sulfuric acid solution was added to 5 g of pulp to be pH 1 and kept at 80°C for 3 h. Then, 96% ethyl alcohol was added and kept at +4°C for 24 h to precipitate pectin. After 24 h, pectin was isolated by filtration and washed three times using 96% ethyl alcohol. It was then dried in an oven at 34°C. After drying, pectin was ground to powder. The yield of pectin obtained was calculated using the following formula: Yield = ( m 0 / m ) × 100, where m 0 is the weight of dried pectin in grams and m is the weight of dried grapefruit peels in grams. 2.4. Preparation of Optimized Grapefruit Peel Extracts We used the optimal grapefruit peel extracts, obtained using the RSM and desirability function, in our bee studies. Both extraction methods prepared extracts from 20 g of grapefruit peel. After the extraction processes, the extracts were filtered using Whatman filter paper. TPC, DPPH, and TFC analyses were performed on the prepared extracts to determine the suitability of the estimated optimum values ​​determined by the RSM. Next, we used a rotary evaporator to remove the ethanol from the extracts. After removing the ethanol, the extracts were lyophilized for use in honeybee and anti‐nosemal activity tests. 2.5. Honeybee Studies Honeybees ( A. mellifera ) were provided by a local beekeeper in Burdur province, Türkiye. The effects of optimal extracts obtained from grapefruit peels on honeybees were evaluated in cage tests consisting of 1.15 L plastic containers. Air flow was provided by opening holes in the top and sides of the container. A hole was opened in the top for a 5‐mL feeding syringe. The tips of the feeding syringes were cut to ensure easy access of the bees to the nutrients. Sugar syrup (1:1 [w/v] sucrose:water solution) was given to the bees as feeding solution. The cages were kept in a dark incubator (33 ± 2°C, 60 ± 5% RH). Bee mortality was recorded daily. Feeding solution consumption was recorded daily, and the feeding solution was renewed daily. 2.5.1. Acute Toxicity Optimum extracts obtained from both extraction methods were used for toxicity tests. Acute toxicity tests were performed on forager bees collected from healthy colonies free of nosema and varroa according to the guideline (OECD‐213) established by the Organization for Economic Co‐operation and Development ( OECD) (1998) . The bees were randomly grouped into cages. Before starting the study, the bees were allowed to get used to the cages for 1 day. During this period, they were fed with 50% sugar syrup. The bees were fasted 4 h before the start of the test. The bees were fed with 50% sugar syrup containing the optimal extracts for 6 h. For each extract, six groups were formed that were given sugar syrup containing the relevant extract in amounts of 4%, 2%, 1%, 0.5%, 0.25% and 0% (control). Three cages (>8–11 bees per cage) were used for each concentration. After 6 h, 50% sucrose solution was given instead of the sucrose‐containing extract solution. All groups were fed with 50% sucrose solution for 96 h. The number of deaths and the amount of feeding solution consumption were recorded daily. At the end of the study, live bees were collected from the groups for histopathological examination. 2.5.2. Chronic Toxicity and Longevity Chronic oral toxicity tests (10‐day feeding) were performed according to the guideline (OECD‐245) established by the OECD ( 2017 ). Chronic oral toxicity tests were performed on newly emerged (0‐day old) honeybees. Slats with closed brood eyes from a colony with a healthy queen and no signs of disease were kept in the incubator at 33 ± 2°C and 60 ± 5% relative humility (RH) for 1 day. The next day, newly emerged bees were randomly placed in cages. In order to adapt the bees, they were fed with 50% sucrose solution on the first day. Each extract was given to the bees at the rates of 2%, 1%, 0.5%, 0.25%, and 0% (control) in 50% sugar syrup for 10 days. Three plastic cages (1.15 L) containing approximately 40 bees per cage were used for each concentration of each optimal extract. Since 4% concentration of both extracts was consumed less in acute toxicity tests, chronic oral toxicity studies were not included. The number of deaths and the amount of feeding solutions consumed were recorded for 10 days. At the end of 10 days, some bees were collected from each experimental group for histopathological examination. When no significant toxic effects were observed in the 10‐day toxicity tests, the remaining bees were continued to be given test solutions for longevity test. Longevity tests were performed until all bees died. Daily bee deaths were recorded during the life test. 2.6. Histopathological Analysis In the histopathological analysis, at the end of the 10‐day toxicity test, the intestines of randomly selected bees from the groups were carefully removed and fixed in 10% buffered formalin. Tissue samples were placed individually in tissue processing cassettes after 2 days of fixation. The cassettes were dehydrated by passing through alcohol series (70%–100%) in a fully automatic tissue processing device (Leica ASP300S; Leica Microsystem) then degreased with xylol and embedded in paraffin wax. The paraffin‐embedded tissues were stored in the refrigerator until sectioning. For histopathological examination, 5‐µm thick sections were prepared with a rotary microtome (Leica 2155) and placed on slides. After drying the sections for 2 h at 60°C, deparaffinization was performed with xylol and alcohol series. Tissue sections were stained with Harris haematoxylin and eosin, dehydrated by passing through series alcohols, cleared with xylol, covered, and evaluated under a microscope. Histopathological scoring criteria was given in the Supporting Information (a) . 2.7. Anti‐ Nosema ( Vairimorpha ) Activity Nosema spores were taken from infected A. mellifera colonies Ordu province in Türkiye, and the spores were confirmed to belong to V. ceranae . To identify the species of Nosema , polymerase chain reaction (PCR) was performed with both V. ceranae specific primers (MITOC‐F CGGCGACGATGTGATATGAAAATATTAA, MITOC‐R CCCGGTCATTCTCAAACAAAAAACCG) and V. apis specific primers (APIS‐F GGGGGCATGTCTTTGACGTACTATGTA, APIS‐R GGGGGGCGTTTAAAATGTGAAACAACTATG) (Martín‐Hernández et al. 2007 ). Genomic DNA (gDNA) isolation was performed with the DNeasy Blood & Tissue Kit (Qiagen). PCR reactions were performed with EmeraldAmp Mastermix (Takara). As a result of PCR reactions performed with MITOC‐F and MITOC‐R primers, a 220‐bp long band was obtained in gel electrophoresis, while no band was obtained with APIS‐F and APIS‐R primers ( Supporting Information (i )). The sequence of the N. ceranae 18S rRNA (these sequence data have been submitted to the GenBank databases under the accession number PV336005 ) gene was performed using an online tool Primer‐Blast. Honey bees were kept at 34 ± 2°C and 60 ± 5% RH and were experimentally infected. Fourteen days after inoculation, the bees were gutted, and the midguts were crushed in distilled water using a sterile pestle and centrifuged at 5000× g for 5 min. The supernatant was removed, and this process was repeated three times. In the experiment where the anti‐nosemal activity of the extracts was investigated, the pellets obtained were used to infect the bees (Fries et al. 2013 ). Nosema infection in bees was established according to the method described by Williams et al. ( 2013 ). Combs with capped brood eyes were taken from three healthy colonies of the same species and kept in an incubator at 32°C and 65 ± 5% relative humidity for 24 h. The 1‐day‐old young bees that emerged from the closed brood cells were grouped into 100 individuals per cage. Pollen paw and queen bee mandibular pheromone were added to the cages for the first 4 days. Note that 50% sugar syrup containing 33.000 spores per bee was prepared and applied, and a total of 4 mL of sugar syrup containing 3.300.000 spores was given to each cage, and it was ensured that the syrup was completely consumed. Spore‐inoculated bees were randomly divided into groups. The groups were determined as follows: control group: infected with Nosema but not given the test substance; microwave extract group: fed with 50% sugar syrup containing 1% microwave‐assisted extract; and conventional extract group: fed with 50% sugar syrup containing 1% conventional extract. In addition, healthy bees fed with only 50% sugar syrup were used as control group (nosema‐free). Extract‐containing syrups were renewed daily, and the number of dead bees in each cage was recorded daily after inoculation. On the 5th, 10th and 15th days after inoculation, 10 bees were randomly selected from each cage, their intestines were removed and crushed in 10 mL of distilled water, and nosema spore counts were performed. Spore counts were performed under a microscope by transferring 10 µL of tissue suspension to a haemocytometer. 2.8. Statistical Analysis The results of this study are presented as mean ± standard deviation. All assays were conducted in triplicate. The data from acute, 10‐day toxicity, survival and anti‐nosemal activity tests were subjected to normality tests using Shapiro–Wilk tests. Then, The distribution of variances in the data was investigated showing normal distribution. One‐way analysis of variance (ANOVA) (Fisher's) test was performed on the data showing homogeneous variance distribution. Tukey HSD test was performed on the data showing significance, and the significance between groups was examined. The data not showing normal distribution were analyzed using non‐parametric test (Kruskal–Wallis test). Repeated measures ANOVA test was used for the analysis of syrup consumption. In acute studies, 6‐h feeding trials were used as covariates variable, and its effect on feeding in the following days was examined. In toxicology analyses, differences in survival rates between groups over time were determined by Kaplan Meier and log rank tests. Correlation analysis between TPC, TFC, and DPPH was determined by Pearson correlation test. The significance level was accepted as p < 0.05, and the analyses were performed within the Rstudio software. 3. Results 3.1. Conventional Extraction and Microwave‐Assisted Extraction TPC, TFC, and DPPH values obtained under experimental CCD conditions in conventional extraction and microwave‐assisted extraction are given in Tables 5 , 6 , 7 . The TPC values ​​were determined between 426.38 and 1114.50 µg GAE/mL. TFC values ​​were determined between 61.96 and 263.98 µg QE/mL. DPPH radical scavenging rate, which is an indicator of anti‐oxidant capacity, varies between 42.00% and 96.39% in conventional extraction. TPC values were determined between 149,111 and 910.222 µg GAE/mL, and TFC values were determined between 18.2982 and 97.435 µg QE/mL. DPPH radical scavenging rate, which is an indicator of anti‐oxidant capacity, varies between 29.89% and 81.43% in microwave‐assisted extraction. TABLE 5. CCD with observed response of the dependent variables from conventional extraction of grapefruit peel. Run TPC (µg GAE/mL) TFC (µg QE/mL) DPPH (%) 1 565.75 107.515 80.012 2 632.938 61.955 44.221 3 516.688 89.0526 67.332 4 1114.5 185.903 88.123 5 587.938 75.6866 48.329 6 635.281 131.516 83.378 7 537.625 91.9689 88.879 8 426.375 178.224 73.388 9 515.438 132.215 82.044 10 565.75 107.515 80.159 11 729.5 144.049 70.068 12 479.5 71.4857 58.499 13 655.125 88.7732 67.877 14 697.313 92.8429 42.000 15 565.75 107.515 80.123 16 612.156 66.8239 48.456 17 565.75 107.515 80.312 18 822.625 189.557 96.391 19 796.875 86.955 83.196 20 565.75 107.515 80.495 21 695.75 124.319 75.878 22 502.938 99.1522 68.376 23 866.063 117.557 77.031 24 736.063 263.985 92.234 25 791.531 104.44 55.149 26 911.844 153.057 75.068 27 803.25 157.414 58.038 28 559.5 113.874 60.443 29 565.75 107.515 80.985 30 785.75 211.691 68.976 Open in a new tab TABLE 6. Regression coefficient ( β ) and ANOVA of the predicted second‐order polynomial models for conventional assisted extractions of TPC, TFC, and DPPH from grapefruit peels. Regression coefficients Conventional extraction Total phenolic content Total flavonoid content DPPH Eq. coefficients F ‐value p value Eq. coefficients F ‐value p value Eq. coefficients F ‐value p value Model 565.75 32.01 <0.0001 107.47 23.58 <0.0001 79.57 216.40 <0.0001 X 1 −43.56 31.72 <0.0001 12.45 14.03 0.0013 8.87 549.76 <0.0001 X 2 −133.57 298.20 <0.0001 −32.72 96.89 <0.0001 −4.61 148.31 <0.0001 X 3 5.92 0.5853 0.4561 23.24 48.86 <0.0001 9.47 626.67 <0.0001 X 4 −29.96 15.00 0.0015 14.33 18.58 0.0003 −2.17 33.03 <0.0001 X 1 X 2 −14.21 2.25 0.1544 −3.06 0.4987 0.4909 X 1 X 3 −6.08 0.4124 0.5304 5.78 1.78 0.2020 1.51 10.68 0.0037 X 1 X 4 −3.02 0.1015 0.7545 −1.37 0.1003 0.7558 −1.00 4.67 0.0424 X 2 X 3 0.3418 0.0013 0.9717 −10.69 0.0013 0.0162 0.2653 0.3668 0.5538 X 2 X 4 9.89 1.09 0.3129 −9.74 1.09 0.0266 −0.5566 1.62 0.2231 X 3 X 4 −9.01 0.9053 0.3565 7.98 0.9053 0.0642 −0.7177 2.69 0.1220 X 1 2 −1.95 0.0725 0.7913 8.57 0.0725 0.0109 −5.59 258.74 <0.0001 X 2 2 59.77 68.24 <0.0001 10.32 68.24 0.0030 −0.5486 2.69 0.1218 X 3 2 16.12 4.96 0.0416 −1.13 0.1172 0.7369 −4.06 136.74 <0.0001 X 4 2 44.17 37.26 <0.0001 1.09 0.1088 0.7461 −0.2266875 0.4593 0.5083 Lack of fit NS NS NS R 2 (%) 0.96 0.91 0.98 CV (%) 5.74 13.29 2.58 AP 22.81 18.77 57.21 Open in a new tab Abbreviations: AP, adequate precision; CV, coefficients of variances; NS, not significant. TABLE 7. CCD with observed response of the dependent variables from MAE of grapefruit peel. Run TPC (µg GAE/mL) TFC (µg QE/mL) DPPH (%) 1 599.27 18.2982 48.3484 2 456.611 46.9268 62.3694 3 494.111 25.1519 41.4913 4 799.33 97.435 81.4376 5 314.296 35.6726 48.541 6 875.685 58.2476 73.028 7 523 37.4957 42.2327 8 313.185 29.9804 29.8941 9 648.926 49.7042 50.2356 10 599.27 18.2982 48.3484 11 740.593 76.2085 63.1978 12 495.037 35.5894 43.3259 13 231.148 29.5134 48.4711 14 149.111 19.6723 39.5082 15 599.27 18.2982 48.3484 16 378.926 19.4685 44.1913 17 599.27 18.2982 48.3484 18 852.259 81.4603 69.783 19 611.296 32.435 70.8016 20 599.27 18.2982 48.3484 21 904.481 53.4231 52.3901 22 396.407 18.2982 37.0652 23 863.556 74.1795 71.4747 24 910.222 88.202 62.1072 25 421.981 79.9095 80.5688 26 569.852 63.8681 72.1363 27 511.611 68.3023 69.0896 28 500.407 30.6645 42.9206 29 599.27 18.2982 48.3484 30 643.37 51.2537 62.3771 Open in a new tab The regression coefficients and second‐order polynomial equations for the relationship between the extraction parameters TPC, TPC, and DPPH from dried grapefruit peels are as follows: (a) conventional extraction and (b) microwave‐assisted extraction: TP C a = + 565 . 75 − 43 . 56 X 1 − 133 . 57 X 2 + 5 . 92 X 3 − 29 . 96 X 4 − 14 . 21 X 1 X 2 − 6 . 08 X 1 X 3 − 3 . 02 X 1 X 4 + 0 . 3418 X 2 X 3 + 9 . 89 X 2 X 4 − 9 . 01 X 3 X 4 − 1 . 95 X 1 2 + 59 . 77 X 2 2 + 16 . 12 X 3 2 + 44 . 17 X 4 2 TF C a = + 107.47 + 12 . 45 X 1 − 32 . 72 X 2 + 23 . 24 X 3 + 14 . 33 X 4 − 10 . 69 X 2 X 3 − 9 . 74 X 2 X 4 + 7 . 98 X 3 X 4 + 8 . 57 X 1 2 + 10 . 32 X 2 2 DPP H a = + 79 . 57 + 8 . 87 X 1 − 4 . 61 X 2 + 9 . 47 X 3 − 2 . 17 X 4 + 1 . 51 X 1 X 3 − 1 . 00 X 1 X 4 − 5 . 59 X 1 2 − 4 . 06 X 3 2 TP C b = + 602 . 15 + 96 . 62 X 1 − 115 . 18 X 2 + 58 . 98 X 3 + 38 . 88 X 4 − 30 . 22 X 1 X 2 + 1 . 45 X 1 X 3 − 17 . 31 X 1 X 4 − 13 . 55 X 2 X 3 + 15 . 49 X 2 X 4 + 40 . 81 X 3 X 4 − 88 . 53 X 1 2 + 3 . 15 X 2 2 + 20 . 22 X 3 2 + 22 . 88 X 4 2 TF C b = + 19 . 93 + 4 . 34 X 1 − 20 . 26 X 2 + 1 . 74 X 3 + 2 . 28 X 4 − 1 . 51 X 1 X 2 + 4 . 61 X 1 X 3 + 2 . 88 X 1 X 4 + 2 . 83 X 2 X 3 + 3 . 92 X 2 X 4 − 0 . 7727 X 3 X 4 + 3 . 39 X 1 2 + 11 . 65 X 2 2 + 10 . 33 X 3 2 + 3 . 84 X 4 2 DPP H b = + 48 . 83 − 1 . 92 X 1 − 11 . 85 X 2 + 0 . 4278 X 3 − 3 . 25 X 4 + 0 . 6732 X 1 X 2 + 1 . 33 X 1 X 3 + 1 . 21 X 1 X 4 + 1 . 51 X 2 X 3 + 3 . 21 X 2 X 4 − 0 . 2834 X 3 X 4 − 2 . 90 X 1 2 + 3 . 24 X 2 2 + 5 . 35 X 3 2 + 2 . 07 X 4 2 The regression coefficients and ANOVA results of the response variables obtained with both extraction methods from grapefruit peel are given in Tables 6 and 8 . The second‐order polynomial model was created using the RSM to analyze the effects on the responses. Tables 6 and 8 show that the R 2 value in all three models was determined as 0.96, 0.91 and 0.96, respectively, in conventional extraction, as 0.91, 0.94 and 0.96, respectively, in microwave‐assisted extraction. The high R 2 values ​​obtained indicate that the created models are compatible with the experimental data. As stated in Tables 6 and 8 , the lack of Fit values ​​were determined as insignificant ( p > 0.05). The insignificance of this value indicates that the variables in the dataset are explained to a high extent. The adequate precision (AP) values ​​obtained from the model were determined as 22.81, 18.77 and 57.21, respectively, in conventional extraction, as 15.50, 15.80 and 20.67, respectively, in microwave‐assisted extraction. The AP values ​​higher than 4 indicate that the variability in the dataset is well explained by the models. The coefficients of variance values ​​obtained from the models were determined as 5.74, 13.29 and 2.58, respectively, in conventional extraction, as 13.81, 15.81 and 20.67, respectively, in microwave‐assisted extraction. The low values ​​indicate that the models created are repeatable. Table 6 illustrates that models created were determined to be statistically significant for conventional extraction ( p < 0.0001). X 1 , X 2 and X 4 ( p < 0.05) were the independent variables used in the model created for TPC. The effects of X 1 and X 2 on extraction efficiency are higher than other independent variables ( p < 0.0001). Since all interaction terms are p > 0.05, they are all insignificant. The effects of X 2 2 , X 3 2 , and X 4 2 from quadratic terms on TPC were determined to be significant ( p < 0.05). For TFC, it was determined that X 1 , X 2 , X 3 and X 4 had significant effects on the model. The effects of X 2 X 3 and X 2 X 4 from interactions terms were determined to be significant. The effects of X 1 2 and X 2 2 from quadratic terms were determined to be significant. For DPPH, the linear effects of all independent variables ( X 1 , X 2 , X 3 and X 4 ) were determined to be highly significant on the model. From interaction terms, the effects of X 1 X 3 and X 1 X 4 were determined to be significant. For DPPH, the effects of X 1 2 and X 3 2 from quadratic terms were determined to be significant. TABLE 8. Regression coefficient ( β ) and ANOVA of the predicted second‐order polynomial models for MAE of TPC, TFC, and DPPH from grapefruit peels. Regression coefficients Microwave‐assisted extraction Total phenolic content Total flavonoid content DPPH Eq. coefficients F ‐ value p value Eq. coefficients F ‐ value p value Eq. coefficients F ‐ value p value Model +602.51 11.85 <0.0001 +19.93 17.18 <0.0001 +48.83 29.60 <0.0001 X 1 +96.62 35.28 <0.0001 +4.34 6.38 0.0233 −1.92 6.88 0.0192 X 2 −115.18 50.13 <0.0001 −20.26 138.83 <0.0001 −11.85 262.06 <0.0001 X 3 +58.98 13.15 0.0025 +1.74 1.03 0.3264 +0.4278 0.3413 0.5678 X 4 +38.88 6.09 0.0261 +2.28 1.87 0.1912 −3.25 20.97 0.0004 X 1 X 2 −30.22 2.33 0.1476 −1.51 0.5183 0.4827 +0.6732 0.5710 0.4616 X 1 X 3 +1.45 0.0053 0.9427 +4.61 4.86 0.0435 +1.33 2.24 0.1548 X 1 X 4 −17.31 0.5899 0.4544 +2.88 1.46 0.2457 +1.21 1.41 0.2533 X 2 X 3 −13.55 0.4690 0.5039 +2.83 1.83 0.1958 +1.51 2.89 0.1097 X 2 X 4 +15.49 0.4720 0.5025 +3.92 2.71 0.1205 +3.21 10.02 0.0064 X 3 X 4 +40.81 3.28 0.0903 −0.7727 0.1052 0.7502 −0.2834 0.0780 0.7838 X 1 2 −88.53 33.10 <0.0001 +3.39 4.35 0.0546 −2.90 17.47 0.0008 X 2 2 +3.15 0.0419 0.8406 +11.65 51.32 <0.0001 +3.24 21.91 0.0003 X 3 2 +20.22 1.73 0.2086 +10.33 40.35 <0.0001 +5.35 59.75 <0.0001 X 4 2 +22.88 5.97 0.0274 +3.84 15.02 0.0015 +2.07 24.07 0.0002 Lack of fit NS NS NS R 2 (%) 0.91 0.94 0.96 CV (%) 13.81 19.12 6.48 AP 15.50 15.81 20.67 Open in a new tab Abbreviations: AP, adequate precision; CV, coefficients of variances; NS, not significant. Figure 1 illustrates the three‐dimensional (3D) response surface graphs showing the interaction effect of grapefruit peel by conventional extraction on response variables. To increase the amount of TFC via conventional extraction, reducing the solvent volume and extending the extraction time is an effective method. Figure 1a presents that reducing the solvent volume to 20 mL instead of 40 mL and extending the extraction time increases the number of flavonoids, while it has been observed that long‐term extraction with high solvent volume has no significant effect on this increase. Similarly, when the extraction time is kept constant, reducing the solvent volume increases the total flavonoid amount. When the solvent volume is kept constant as 20 mL, increasing the time from 8 h to 20 h increases the total flavonoid yield. Therefore, reducing the solvent volume and applying longer extraction times together can increase the number of flavonoids in conventional extraction from grapefruit peel. Another significant interaction effect in the model design is between the solvent/solid ratio and temperature on TFC. The 3D graph of this interaction is shown in Figure 1b . Upon examination of the graph, it becomes evident that it is seen that increasing the solvent/solid ratio increases the TFC when the extraction time is kept constant, as in Figure 1b . However, when the solvent/solid ratio is kept constant and the extraction time is increased, a significant increase in the amount of TFC is observed at low solvent/solid ratios (20–30 mL/g), while no significant change is observed in the amount of TFC when this ratio increases to 30–40 mL/g levels. The results show that both reducing the solvent/solid ratio and increasing the temperature can increase the number of total flavonoids obtained by conventional extraction from grapefruit peel. As shown in Figure 1c, increasing the solvent ratio increases the anti‐radical activity obtained from grapefruit peel depending on the extraction time. When the solvent ratio is kept constant at 75% and the extraction time is increased, it was determined that this effect is more pronounced than that obtained with the same time increase at 25% solvent ratio. When the time is constant at 8 h, increasing the solvent ratio from 25% to 75% provides a limited increase in anti‐radical activity, while increasing the time to 20 h makes this increase more pronounced. The results show that both increasing the solvent ratio and longer extraction time significantly increase the anti‐radical activity obtained from grapefruit peel. According to Figure 1d , it is seen that temperature change does not have a significant effect on anti‐radical activity at low solvent ratios. On the other hand, when the solvent ratio is increased, it is determined that the anti‐radical activity increases even if the temperature remains constant. It was determined that when the solvent ratio was kept constant at 75% and the temperature was decreased from 50 to 30°C, the anti‐radical activity showed a partial increase. In summary, these results show that considering the ANOVA results, it was revealed that the increase in the solvent ratio had a stronger effect on the anti‐radical activity compared to the temperature change. FIGURE 1. Open in a new tab Three‐dimensional response surface graphs of grapefruit peel via conventional extraction (a) showing effect of solvent/solid ratio and time, (b) showing effect of solvent/solid ratio and temperature on TFC, (c) solvent ratio and temperature, and (d) solvent ratio and time on DPPH. Table 8 shows that the models created are statistically significant ( p < 0.0001) for microwave‐assisted extraction. In the model created for TPC, all independent variables ( X 1 , X 2 , X 3 and X 4 ) were determined to be significant ( p < 0.05). However, the effect of X 1 and X 2 on extraction efficiency was found to be higher compared to other independent variables ( p < 0.0001). It was observed that all interaction terms were statistically insignificant due to p > 0.05. However, the effect of X 1 2 and X 4 2 terms on TPC was determined to be significant ( p < 0.05). For TFC, X 1 and X 2 variables were found to have significant effects on the model. Only the X 1 X 3 term was significant among interaction terms. Among quadratic terms, the effects of X 2 2 , X 3 2 , and X 4 2 variables were found to be statistically significant. For DPPH radical scavenging activity, the linear effects of X 1 and X 2 from independent variables were found to be significant on the model. Only the effect of X 2 X 4 from interaction terms was found to be significant. In addition, for DPPH, the effects of all quadratic terms ( X 1 2 , X 2 2 , X 3 2 , and X 4 2 ) were found to be significant. These results show that the RSM is an effective approach in terms of optimization in the microwave‐assisted extraction process and that the obtained models can explain the response variables with high accuracy. As can be seen from Figure 2a , it is seen that the 3D graph passes through a minimum point and that the highest flavonoid yield is obtained with low solvent ratio and medium extraction time. Determining the extraction time as 3 or 5 min without changing the solvent ratio gives similar results in terms of flavonoid amount. However, setting the time as 4 min causes a slight decrease in flavonoid amount compared to 3 and 5 min. Figure 2b presents that the decrease in solvent/solid ratio leads to an increase in DPPH value. However, when the solvent/solid ratio is kept at 30 mL/g, increasing the microwave power causes a partial decrease in DPPH value. FIGURE 2. Open in a new tab Three‐dimensional response surface graphs of grapefruit peel via microwave‐assisted extraction (a) showing effect of solvent ratio and time on TFC and (b) solvent/solid ratio and microwave power on DPPH. 3.2. Model Validation Experimental design was carried out using RSM to obtain maximum TPC, TFC, and anti‐radical activity from grapefruit peel. CCD was applied for experimental design. Quadratic models were created based on the least squares method, and ANOVA analysis was performed to evaluate the statistical validity of the models. In the optimization process, in this study, which was considered a multivariate problem, desirability function was used to maximize all response variables simultaneously. After determining the optimum conditions, experiments were repeated for verification, and the results predicted by the model were compared with the experimental data. As a result of the analyses, it was determined that there was no statistically significant difference between the estimated and actual experimental values. The optimum conditions determined for conventional extraction are as follows: solvent ratio 74.336%, solvent/solid ratio 20 mL/g, extraction time 20 h, and temperature 50°C. The optimum conditions obtained for microwave‐assisted extraction were determined as solvent ratio 65%, solvent/solid ratio 30 mL/g, extraction time 5 min, and microwave power 525 W. When the phenolic and flavonoid contents of the extracts obtained under optimum conditions were evaluated, the phenolic content of the extract obtained by conventional solvent extraction was determined as 14.412 mg GAE/g dry matter and the flavonoid content as 4.743 mg QE/g dry matter. The phenolic content of the optimum extract obtained by microwave‐assisted extraction was determined as 26.251 mg GAE/g dry matter and the flavonoid content as 2.301 mg QE/g dry matter. Model estimation and experimental results are presented in detail in Table 9 . These findings show that microwave‐assisted extraction provides higher phenolic content compared to conventional solvent extraction and significantly reduces the extraction time. The results obtained reveal that the model is reliable in the optimization process and that the estimated values are experimentally verified. TABLE 9. Comparison of model estimation and actual experimental results for dependent variables. Dependent variables Extraction method Conventional extraction Microwave‐assisted extraction Predicted Actual Predicted Actual TPC (µg GAE/mL) 736.812 720.6 923.880 875.066 TPC (mg GAE/g) — 14.412 — 26.251 TFC (µg QE/mL) 236.740 238.173 78.985 76.714 TFC (mg QE/g) — 4.763 — 2.301 DPPH (%) 91.25 91.41 60.636 61.614 Anti‐radical activity (µg AAE/mL) — 89.43 — 58.34 Anti‐radical activity (mg GAE/g) — 1.788 — 1.75 Open in a new tab 3.3. High‐Performance Liquid Chromatography‐Photodiode Array Gallic acid is the polyphenolic compound with the highest concentration in extracts obtained with optimal conventional extraction, with a value of 48.27 ± 3.45 µg/g (dried weight [DW]) (see Table 10 ). Gallic acid ranks first, followed by kaempferol (46.98 ± 0.75 µg/g [DW]) and quercetin (23.56 ± 0.86 µg/g [DW]). The extracts obtained with optimal microwave‐assisted extraction contained the largest amount of chlorogenic acid, with a concentration of 79.65 ± 5.48 µg/g (DW). Chlorogenic acid ranks first, followed by kaempferol (44.98 ± 0.23 µg/g [DW]) and gallic acid (32.43 ± 2.75 µg/g [DW]). Furthermore, the fact that optimum extracts have a low amount of galacturonic acid shows that the amount of pectin is in very low amounts. TABLE 10. Polyphenolic compound profile of grapefruit peel extracts. Optimum conventional extraction (µg/g [DW]) Optimum microwave extraction (µg/g [DW]) Gallic acid 48.27 ± 3.45 32.43 ± 2.75 Chlorogenic acid 22.86 ± 1.27 79.65 ± 5.48 Caffeic acid 5.32 ± 0.03 2.98 ± 0.32 Ferulic acid 3.26 ± 0.07 1.98 ± 0.09 Hesperidin 22.45 ± 2.53 27.67 ± 0.55 Naringenin 16.35 ± 1.18 18.78 ± 1.44 Narirutin 1.78 ± 0.04 0.93 ± 0.02 Rosmarinic acid nd 0.11 ± 0.02 Kaempferol 46.98 ± 0.75 44.98 ± 0.23 Quercetin 23.56 ± 0.86 38.98 ± 0.77 Galacturonic acid 0.05 ± 0.00 0.11 ± 0.01 Open in a new tab Abbreviations: DW, dried weight; nd, not detected. 3.4. Correlation Between Dependent Variables Pearson's correlation matrix and significance levels between the values ​​of response variables obtained with conventional extract and microwave‐assisted extract are given in Figure 3 . There was a moderate correlation between TFC in conventional extract, TPC (0.45), and DPPH (0.51). There was a moderate correlation between TPC and TFC (0.58) and between TPC and DPPH (0.55) in microwave‐assisted extract. Also, there was a high correlation between TFC and DPPH (0.81). FIGURE 3. Open in a new tab Correlation matrix for response variables: (a) conventional extraction and (b) microwave‐assisted extraction. * p < 0.05, ** p < 0.01, *** p < 0.001. 3.5. Pectin Content in Grapefruit Pulp After the preparation of grapefruit extracts, pectin analysis was performed on the pulp part separated from the extracts. The pectin yield in the dry pulp obtained from the extract prepared with the conventional extraction was 31.2%, and the pectin yield in the dry pulp obtained with the microwave extract was 29.2%. 3.6. Acute Toxicity 3.6.1. Conventional Extract The average extract consumption of honey bees in the acute toxicity test performed with the optimum extract of conventional extraction is given in Table 11 . The consumption average of the syrup containing 4% extract was found to be lower than the other groups, and this consumption difference was found to be statistically significant ( p < 0.05). Repeated measures ANOVA test was applied to determine the differences in consumption per bee among the groups. In order to evaluate the effect of 6‐h extract consumption on sucrose solution consumption for the next 4 days, the extract amounts consumed for 6 h were included in the model as a covariance variable. The repeated measures ANOVA test results and individual consumption data regarding 4‐day sugar syrup consumption are presented in the Supporting Information (b–d) . According to the analysis results, a statistically significant difference was found in the 4‐day sugar syrup consumption ( p = 0.020). In addition, it was determined that 6‐h extract consumption had a significant effect on the 4‐day sugar syrup consumption ( p = 0.027). However, although the effect of 6‐h extract consumption on sugar syrup consumption was statistically significant, it was found that this effect did not vary depending on the concentration ( p = 0.117). TABLE 11. Average conventional extract containing syrup consumption per bee. Groups Concentration (%) Six‐hour average syrup consumption (mg/bee) Group 1 4 0.0091 ± 0.0026b Group 2 2 0.0205 ± 0.0354a Group 3 1 0.0233 ± 0.0029a * Group 4 0.5 0.0287 ± 0.0046a ** Group 5 0.25 0.0293 ± 0.0041a *** Group 6 (control) 0 0.0269 ± 0.0063a ** Open in a new tab Note : Different letters indicate a statistically significant difference between the groups. * p < 0.05, ** p < 0.01, *** p < 0.001. 3.6.2. Microwave‐Assisted Extract Sugar syrup containing grapefruit peel extract obtained by microwave‐assisted extraction method was offered to bees for 6 h. During this period, syrup consumption data per bee were recorded and presented in Table 12 . The average syrup consumption per bee, containing 4% extract, was lower than that of the other groups, and this difference was considered statistically significant ( p < 0.05). TABLE 12. Average microwave‐assisted extract containing syrup consumption. Groups Concentration (%) Six‐hour average syrup consumption (mg/bee) Group 1 4 0.0190 ± 0.0026c Group 2 2 0.0243 ± 0.0014d * Group 3 1 0.0243 ± 0.0016d * Group 4 0.5 0.0242 ± 0.0007d * Group 5 0.25 0.0269 ± 0.0012d ** Group 6 (control) 0 0.0263 ± 0.0016d ** Open in a new tab Note : Different letters indicate a statistically significant difference between the groups. * p < 0.05, ** p < 0.01, *** p < 0.001. After 6‐h acute application of grapefruit peel extract prepared with microwave extract, 50% sugar syrup was given to all 6 groups for 4 days. Four‐day sugar syrup consumption averages per bee are given in the Supporting Information (e) . The results of the repeated measures ANOVA test regarding the sugar syrup consumed in 4 days and the 4‐day sugar syrup consumption are given in the Supporting Information (f–h) . No significant difference was found between the 4‐day sugar syrup consumption ( p = 0.145). At the same time, the consumption of grapefruit peel extract prepared with the 6‐h microwave‐assisted system had no effect on the amount of sugar syrup consumption in the following 4 days ( p = 0.140). However, there is a significant effect that develops depending on the 6‐h extract concentration in 4‐day consumption ( p < 0.001). 3.7. Chronic Toxicity and Longevity 3.7.1. Conventional Extract The groups in the 10‐day toxicity test conducted by giving grapefruit peel extract prepared with the conventional method and the 10‐day average extract consumption are given in Supporting Information (j) . Differences in syrup consumption between the groups are given in the Supporting Information (h) . The amounts of sugar syrup consumed during the 10‐day period were statistically different between the groups ( p = 0.029). However, the effect of concentration on consumption was not significant ( p = 0.835). No statistically significant difference was found between the groups in terms of survival distributions in the 10‐day toxicity test performed with conventional extract ( p = 0.098) (Figure 4a ). The survival distributions between the groups in the survival test performed with the conventional extract showed statistically significant differences ( p < 0.001) (Figure 4b ). The bees fed with sugar syrup containing 1% extract lived longer than the control group. The average lifespan of the bees in the 1% extract group was determined as 22.5 days, while the bees in the control group lived an average of 22 days. FIGURE 4. Open in a new tab Chronic toxicity and longevity risk tables. 3.7.2. Microwave‐Assisted Extract The amount of extract consumed during the 10‐day period was statistically significant ( p ≤ 0.001). However, the effect of concentration on consumption was not significant ( p = 0.439) ( Supporting Information (k) ). The survival time distributions between the groups in the 10‐day toxicity test with microwave extract did not show a statistically significant difference ( p = 0.073) (Figure 4c ). The survival distributions between the groups in the survival test performed with microwave extract were found to be statistically significant ( p < 0.001) (Figure 4d ). The longest living group is the control group with 23.7 days. The bees fed with 2% microwave extract lived the least with 18.2 days. When the 95% confidence intervals of these two groups are examined, it is seen that they cover each other (%2‐control). Therefore, there is a significant difference in life span between the two groups. Thus, the group fed with 2% extract has a statistically significant shorter life span than the control group. 3.8. Histopathological Analysis 3.8.1. Conventional Extract The histopathological evaluation of the acute toxicity study conducted with the conventional extract was assessed according to the criteria specified in the Supporting Information (a) . The histopathological scoring results show that there is no statistically significant difference between the groups. Intestinal histology was observed to be normal in the 0.25%, 0.5% and 1% groups to which the conventional extract was applied. However, in the 2% and 4% groups, it was determined that the intestinal epithelium was partially shed in some samples, swelling and vacuolation in the degenerated epithelial cells, and nucleus loss in the necrotic cells (Figure 6a,b,c,d,f ; control, 0.25%, 0.5%, 1%, 2%, and 4%). However, the statistically insignificant difference between the groups shows that the conventional extract has no negative effect on the intestinal tissue. The results of the chronic toxicity study with the conventional extract revealed that the intestinal tissues in the control, 0.25% and 0.5% concentrations had normal histological structure, while partially degenerative and necrotic changes were observed in the cells in the 1% and 2% extract groups (Figure 6g,h,i,j,k ; control, 0.25%, 0.5%, 1%, and 2%). However, the fact that these changes did not create a statistically significant difference indicates that the microwave extract did not cause a significant toxic effect on the intestinal tissue. FIGURE 6. Open in a new tab CEAT: conventional extract acute toxicity (a,b,c,d,f; control, 0.25%, 0.5%, 1%, 2%, 4%). CECT: conventional extract chronic toxicity (g,h,i,j,k; control, 0.25%, 0.5%, 1%, 2%). 3.8.2. Microwave‐Assisted Extract In the acute toxicity study of microwave‐assisted extract, intestinal histology was normal in the control, 0.25%, 0.5%, and 1% concentration groups. However, in some samples in the 2% and 4% groups, partial degeneration and necrotic cells were detected in the intestinal epithelium (Figure 7a,b,c,d,f ; control, 0.25%, 0.5%, 1%, 2%, 4%, respectively). However, the absence of a statistically significant difference between the groups indicates that microwave extract did not cause a significant toxic effect on intestinal tissue. Similarly, in the chronic toxicity study, intestinal tissue had normal histological structure in the control, 0.25%, and 0.5% groups. However, partial degenerative changes and necrotic cells were detected in the intestinal epithelium in the 1% and 2% extract groups (Figure 7g,h,i,j,k ; control, 0.25%, 0.5%, 1%, 2%). However, despite these histopathological findings, the fact that the difference between the groups was not statistically significant reveals that microwave extract does not have a negative effect on intestinal tissue even in long‐term applications. FIGURE 7. Open in a new tab MEAT: microwave‐assisted extraction acute toxicity (a,b,c,d,f; control, 0.25%, 0.5%, 1%, 2%, 4%). MECT: microwave‐assisted extraction chronic toxicity (g,h,i,j,k; control, 0.25%, 0.5%, 1%, 2%). 3.9. Anti‐Nosemosis Activity The difference in Nosema spore counts between the groups was determined to be statistically insignificant ( p = 0.548) (Table 13 ). As of the 15th day, Nosema spore counts were found to be lower in the optimum extract applied groups compared to the control group, but this difference did not reach a statistically significant level. The survival graph as a result of using optimum extracts against Nosema infection is given in Figure 5 . TABLE 13. Nosema spore counts in groups on measurement days (nx10 6 ). Days Control Conventional extract Microwave‐assisted extract 5 0.06 ± 0.11 1.4 ± 1.27 0 10 5.85 ± 3.46 1.48 ± 11.27 2.55 ± 1.33 15 12.7 ± 3.00 11.5 ± 5.04 5.85 ± 1.73 Open in a new tab FIGURE 5. Open in a new tab Risk table for nosema infection. 4. Discussion Numerous studies have shown that grapefruit peels contain high amounts of phenolic substances, anti‐oxidant activity, and flavonoids (Peng et al. 2021 ; Sir Elkhatim et al. 2018 ; Castro‐Vázquez et al. 2016 ). In the current study, the TFC values ​​and anti‐radical activity in the conventional optimum extract were higher than in the microwave‐assisted optimum extract, while TPC was higher in the microwave‐assisted optimum extract. Microwave radiation causes a sudden increase in temperature and internal pressure in the plant or fruit cell walls, which accelerates cell lysis (M'hiri et al. 2014 ). Microwave‐assisted extraction provides deeper penetration into the cell matrix, interacts with polar molecules, and releases bound phenolic compounds. In one study, microwave‐assisted extraction (12.09 mg GAE/g DW) in Citrus sinensis yielded almost twice as high TPC value as conventional extraction (6.26 mg GAE/g DW) (Nayak et al. 2015 ). The grapefruit peels exhibit high anti‐radical activity, which attributed to the presence of phenolic compounds. It has been reported that radical (DPPH) scavenging rates of grapefruit peel extracts vary between 20.59% and 82.21% (Alrasheid et al. 2019 ; Xi et al. 2015 ; Ashraf et al. 2024 ). In the current study, the radical scavenging rate was found to be 91.41% and 61.614% in the conventional and microwave‐assisted extracts, respectively. These findings confirm that independent variables such as temperature, duration, solvent ratio, and solvent/solid in the extraction methods have an effect on the anti‐oxidant activity of the extract. In optimization studies conducted using RSM, different dependent and independent variables vary. In some studies, only solvent concentration (ethanol percentage) was used as an independent variable in conventional extraction (Garcia‐Castello et al. 2015 ), while in microwave extraction, the selected independent variables were determined as solvent concentration, time, solvent/solid ratio, and microwave power (Z. Wang et al. 2011 ). Garcia‐Castello et al. ( 2015 ) showed that while increasing the ethanol ratio increased the phenolic content in the optimum extract to a certain level, high ethanol ratio negatively affected the phenolic content increase. Our studies support these findings. Z. Wang et al. ( 2011 ) showed that the optimum points in microwave extraction are similar to the optimum values ​​we obtained in microwave extraction. Small differences may be due to the dependent variables determined by the researcher being different from those in the current study. In addition, many factors such as the geography and maintenance conditions where grapefruit is grown may explain the small differences in the results (Rydlewski et al. 2017 ). Pectin is a substance found in the primary cell walls and intercellular tissues of plants. At least 65% of its structure consists of galacturonic acid (Blanco‐Pérez et al. 2021 ). In this study, the galacturonic acid content was measured to determine the pectin content in the optimum extract. Grapefruit, especially in its acceptors, contains high amounts of pectin in its structure as well as bioactive substances (Öztürk et al. 2024 ). Studies have shown that pectin (around 4%) has a toxic effect on honey bees (Barker 1977 ). It was desired that the amount of pectin in our optimum extracts be low in order to have a minimum toxic effect on bees. Since very low amounts of galacturonic acid were detected in the optimum extracts maximized in terms of response variables (TPC, TFC, and anti‐radical activity), there was no need to minimize pectin with RSM. It was understood that a very high amount of pectin remained in the pulp part in both extraction methods, and the amount of pectin in the pulp was measured. In our study, while we obtained the highest yield in terms of TPC, TFC, and anti‐radical active in the optimum extracts to be evaluated for their effectiveness in bee health, we also obtained high pectin yield in the pulp part (31.2% in conventional extract and 29.2% in microwave extraction). The amounts of pectin obtained by conventional and microwave methods in the studies varied between 19.16%–26.48% and 20.93%–27.81% (Bagherian et al. 2011 ; Taşan and Akpınar 2020 ; Mohamed 2016 ; Xu et al. 2014 ). These pectin yields we obtained overlap with the values reported in previous studies. In addition, the reason for pectin remaining in the pulp may be the use of ethanol as a solvent in extraction. The effects of plants on bee health are variable. The addition of aqueous extracts of marjoram, pomegranate, and chamomile plants to high amounts (5%) of sugar syrup had a negative effect on bee health (Potrich et al. 2020 ). In the current study, the toxicity test demonstrated that the optimum extracts given at high rates (4%) did not have beneficial effects on bee health. Histopathological examination confirmed these results. In addition, it was observed that extract consumption decreased at high doses. Low consumption may be due to the bitter taste of compounds such as neoeriositrin, naringin, and neohesperidin found in grapefruit peel (Koolaji et al. 2020 ). In both our acute and 10‐day toxicity studies, sugar syrups containing 0.25% optimum extract were consumed more than the control group. The reason for this may be that the low amount of extract added to the sugar syrup gave a light aroma and made its taste attractive. In a study examining the effects of nutrition on life span in honeybees, the average life span of bees fed pollen and royal jelly was determined to be 24.79 days, while this period was determined to be 22.67 days in those fed only pollen and 17.89 days in those fed only sugar syrup. These results are parallel to the findings obtained in our study. It was determined that giving honeybees additional nutritional supplements rich in protein and phenolic compounds extended life span compared to bees fed only sugar syrup (H. Wang et al. 2014 ). Similarly, in another study, it was shown that adding phytochemicals such as gallic acid, p‐coumaric acid, quercetin, and caffeine to the sugar syrup of honeybees extended the life span of bees depending on the dose. Gallic acid used at a high dose (250 ppm) provided a longer life span compared to the low dose (25 ppm) and the control group (Bernklau et al. 2019 ). The results of the current study are also consistent with these findings. It has been determined that honey bees fed with sugar syrup prepared with the conventional extraction method and containing 1% grapefruit peel extract lived longer than bees fed with lower doses of extract or only sugar syrup. This can be explained by the fact that the presence of higher doses of anti‐oxidants and phenolic compounds contributes to the extension of life span by increasing the detoxification capacity (Hýbl et al. 2021 ; Schulz et al. 2019 ). Phytochemicals such as thymol, resveratrol, naringenin, and carvacrol have been reported to improve the health of honey bees and show anti‐nosemal activity (Borges et al. 2020 ; Klassen et al. 2021 ; Maistrello et al. 2008 ). In a study conducted by Chaimanee et al. ( 2021 ), 12 different plant extracts were tested, and it was determined that nine plant extracts had high anti‐microsporidian activity against Nosema ceranae in honey bees fed ad libitum with 50% sucrose solution containing 1% or 5% of these extracts. Arismendi et al. ( 2018 ) investigated the effects of plants native to Chile and propolis at different concentrations (2%, 4%, 8%, and 16%) on honey bees infected with nosema spores, and it was determined that both substances reduced the number of nosema spores and also increased the survival rate of infected honey bees. In addition to plant extracts, plant essential oils were also reported to be effective against nosema infection. In this study, it was determined that grapefruit peel extracts reduced the number of nosema spores ( p > 0.05). Our results show that grapefruit peel extracts have a suppressive effect on the increase of nosema spores compared to the control group. 5. Conclusion This study aimed to develop an alternative nutritional supplement for honey bees using grapefruit peels as waste material and also to obtain a potential protective agent against nosema infection. Optimum extracts were obtained with two different extraction methods. In long‐term feeding trials, adding 1% of the extract obtained with the conventional extraction to sugar syrup contributed to the extension of life span compared to the control. Although the 1% optimal extract showed a numerically lower Nosema spore count compared to the control group, this difference was not statistically significant ( p = 0.5). Therefore, no significant anti‐ Nosema effect was demonstrated under the conditions of this study. In the Nosema study, both optimal extracts shortened the lifespan of bees compared to the control group, contrary to expectations. Considering these findings, the effects of grapefruit peel extracts on bee health should be examined in more detail, the results obtained should be supported by further studies and the mechanism of action should be clarified in detail. Author Contributions Muhammet Mükerrem Kaya and Hidayet Tutun designed and performed the study. Nilüfer Vural contributed to the extraction methodology. Özlem Özmen contributed to the histopathological examination. Samet Okuyan helped with the anti‐nosemal activity study. All authors have actively contributed to the manuscript and are in full agreement regarding its content. All authors read and approved the final manuscript. Funding This research was supported by the Burdur Mehmet Akif Ersoy University Scientific Research Projects Commission (Project No. 0885‐DR‐23/2017K12‐41003) and TUBITAK (the Scientific and Technological Research Council of Türkiye) with the project, 222O253. Ethics Statement This study did not require approval from an animal ethics committee. The decision that ethical approval was not necessary was confirmed by the Burdur Mehmet Akif Ersoy Local Ethics Committee, dated 28 July 2022 (decision No: 939). Conflicts of Interest The authors declare no conflicts of interest. Supporting information Supporting File 1: vms370917‐sup‐0001‐SuppMat.docx VMS3-12-e70917-s001.docx (1MB, docx) Data Availability Statement All data are available in the Supporting Information. In addition, the data are available upon request to the corresponding author. References Ademosun, A. O. , Oboh G., Passamonti S., et al. 2015. “Phenolics From Grapefruit Peels Inhibit HMG‐CoA Reductase, Angiotensin‐I Converting Enzyme, Show Antioxidative Properties in Endothelial EA. Hy 926 Cells.” Food Science and Human Wellness 4: 80–85. [ Google Scholar ] Alrasheid, A. A. , Mohamed A. A., Mohieldin E. G., et al. 2019. “Phytochemical Investigation, Assessment of Antimicrobial, Anti‐Inflammatory, Antioxidant Activities of Sudanese Citrus paradisi Peel Extract.” Journal of Pharmacognosy and Phytochemistry 11: 1–8. [ Google Scholar ] Andrade, M. A. , Barbosa C. H., Shah M. A., et al. 2022. “Citrus By‐Products: Valuable Source of Bioactive Compounds for Food Applications.” Antioxidants 12: 38. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Arismendi, N. , Vargas M., López M. D., Barría Y., and Zapata N.. 2018. “Promising Antimicrobial Activity Against the Honey Bee Parasite Nosema ceranae by Methanolic Extracts From Chilean Native Plants and Propolis.” Journal of Apicultural Research 57: 522–535. [ Google Scholar ] Ashraf, H. , Ul Haq I., and Butt M. S., et al. 2024. “Phytochemical and Antioxidant Profile of Citrus Peel Extracts in Relation to Different Extraction Parameters.” International Journal of Food Properties 27: 286–299. [ Google Scholar ] Aurell, D. , Bruckner S., Wilson M., Steinhauer N., and Williams G. R.. 2023. “A National Survey of Managed Honey Bee Colony Losses in the USA: Results From the Bee Informed Partnership for 2020–21 and 2021–22.” Journal of Apicultural Research 63: 1–14. [ Google Scholar ] Bagherian, H. , Ashtiani F. Z., Fouladitajar A., and Mohtashamy M.. 2011. “Comparisons Between Conventional, Microwave‐, Ultrasound‐Assisted Methods for Extraction of Pectin From Grapefruit.” Chemical Engineering and Processing 50: 1237–1243. [ Google Scholar ] Balamurugan, R. , Park J. K., and Lee J. K.. 2022. “Anti‐Nosemosis Activity of Phenolic Compounds Derived From Artemisia dubia and Aster scaber .” Journal of Apicultural Research 61: 519–529. [ Google Scholar ] Barker, R. J.

1977. “Some Carbohydrates Found in Pollen and Pollen Substitutes Are Toxic to Honey Bees.” Journal of Nutrition 107: 1859–1862. [ DOI ] [ PubMed ] [ Google Scholar ] Bava, R. , Castagna F., Ruga S., et al. 2023. “Protective Role of Bergamot Polyphenolic Fraction (BPF) Against Deltamethrin Toxicity in Honeybees ( Apis mellifera ).” Animals 13: 3764. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Ben Mansour, R. , Ksouri W. M., Cluzet S., Krisa S., Richard T., and Ksouri R.. 2016. “Assessment of Antioxidant Activity and Neuroprotective Capacity on PC12 Cell Line of Frankenia thymifolia and Related Phenolic LC‐MS/MS Identification.” Evidence‐Based Complementary and Alternative Medicine 2016: 2843463. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Bernklau, E. , Bjostad L., Hogeboom A., Carlisle A., and HS A.. 2019. “Dietary Phytochemicals, Honey Bee Longevity and Pathogen Tolerance.” Insects 10: 14. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Blanco‐Pérez, F. , Steigerwald H., Schülke S., Vieths S., Toda M., and Scheurer S.. 2021. “The Dietary Fiber Pectin: Health Benefits and Potential for the Treatment of Allergies by Modulation of Gut Microbiota.” Current Allergy and Asthma Reports 21: 1–19. [ Google Scholar ] Boncristiani, H. , Ellis J. D., Bustamante T., et al. 2020. “World Honey Bee Health: The Global Distribution of Western Honey Bee ( Apis mellifera L.) Pests and Pathogens.” Bee World 98: 2–6. [ Google Scholar ] Borges, D. , Guzman‐Novoa E., and Goodwin P. H.. 2020. “Control of the Microsporidian Parasite Nosema ceranae in Honey Bees ( Apis mellifera ) Using Nutraceutical and Immuno‐Stimulatory Compounds.” PLoS ONE 15: e0227484. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Burnham, A. J.

2019. “Scientific Advances in Controlling Nosema ceranae (Microsporidia) Infections in Honey Bees ( Apis mellifera ).” Frontiers in Veterinary Science 6: 79. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Campos, D. A. , Gómez‐García R., Vilas‐Boas A. A., Madureira A. R., and Pintado M. M.. 2020. “Management of Fruit Industrial by‐Products—A Case Study on Circular Economy Approach.” Molecules 25: 320. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Castro‐Vázquez, L. , Alañón M. E., Rodríguez‐Robledo V., et al. 2016. “Bioactive Flavonoids, Antioxidant Behaviour, and Cytoprotective Effects of Dried Grapefruit Peels ( Citrus paradisi Macf.).” Oxidative Medicine and Cellular Longevity 2016: 8915729. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Chaimanee, V. , Kasem A., Nuanjohn T., et al. 2021. “Natural Extracts as Potential Control Agents for Nosema Ceranae Infection in Honeybees, Apis mellifera .” Journal of Invertebrate Pathology 186: 107688. [ DOI ] [ PubMed ] [ Google Scholar ] Cirmi, S. , Ferlazzo N., Lombardo G. E., et al. 2016. “Chemopreventive Agents and Inhibitors of Cancer Hallmarks: May Citrus Offer New Perspectives?” Nutrients 8: 698. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] El‐Sayed, A. S. , Fathy N. A., Labib M., El‐Baz A. F., El‐Sheikh A. A., and Moustafa A. H.. 2024. “Biological Control of Nosemosis in Apis mellifera L. With Acacia nilotica Extract.” Scientific Reports 14: 28340. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Flori, L. , Albanese L., Calderone V., et al. 2022. “Cardioprotective Effects of Grapefruit IntegroPectin Extracted via Hydrodynamic Cavitation From by‐Products of Citrus Fruits Industry: Role of Mitochondrial Potassium Channels.” Foods 11: 2799. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Fries, I. , Chauzat M. P., Chen Y. P., et al. 2013. “Standard Methods for Nosema Research.” Journal of Apicultural Research 52: 1–28. [ Google Scholar ] Garcia‐Castello, E. M. , Rodriguez‐Lopez A. D., Mayor L., Ballesteros R., and Conidi C.. 2015. “Optimization of Conventional and Ultrasound‐Assisted Extraction of Flavonoids From Grapefruit ( Citrus paradisi L.) Solid Wastes.” Lebensmittel‐Wissenschaft & Technologie‐Food Science and Technology 64: 1114–1122. [ Google Scholar ] García‐Nicolás, M. , Ledesma‐Escobar C. A., and Priego‐Capote F.. 2023. “Spatial Distribution and Antioxidant Activity of Extracts From Citrus Fruits.” Antioxidants 12: 781. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] García‐Vicente, E. J. , Benito‐Murcia M., Martín Domínguez M., et al. 2024. “Main Causes of Producing Honey Bee Colony Losses in Southwestern Spain: A Novel Machine Learning‐Based Approach.” Apidologie 55: 67. [ Google Scholar ] Giannuzzo, A. N. , Boggetti H. J., Nazareno M. A., and Mishima H. T.. 2003. “Supercritical Fluid Extraction of Naringin From the Peel of Citrus paradisi .” Phytochemical Analysis 14: 221–223. [ DOI ] [ PubMed ] [ Google Scholar ] Goulas, V. , and Manganaris G. A.. 2012. “Exploring the Phytochemical Content and the Antioxidant Potential of Citrus Fruits Grown in Cyprus.” Food Chemistry 131: 39–47. [ Google Scholar ] Güzel, M. , and Akpınar Ö.. 2017. “Turunçgil Kabuklarından Elde Edilen Pektinlerin Karakterizasyonu Ve Karşılaştırılması.” Akademik Gıda 15: 17–28. [ Google Scholar ] Herald, T. J. , Gadgil P., and Tilley M.. 2012. “High‐Throughput Microplate Assays for Screening Flavonoid Content and DPPH‐Scavenging Activity in Sorghum Bran and Flour.” Journal of the Science of Food and Agriculture 92: 2326–2331. [ DOI ] [ PubMed ] [ Google Scholar ] Hristov, P. , Shumkova R., Palova N., and Neov B.. 2020. “Factors Associated With Honey Bee Colony Losses: A Mini‐Review.” Veterinary Sciences 7: 166. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Hung, K. L. J. , Kingston J. M., Albrecht M., Holway D. A., and Kohn J. R.. 2018. “The Worldwide Importance of Honey Bees as Pollinators in Natural Habitats.” Proceedings of the Royal Society of London Series B 285: 20172140. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Hýbl, M. , Mráz P., Šipoš J., et al. 2021. “Polyphenols as Food Supplement Improved Food Consumption and Longevity of Honey Bees ( Apis mellifera ) Intoxicated by Pesticide Thiacloprid.” Insects 12: 572. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Insolia, L. , Molinari R., Rogers S. R., Williams G. R., Chiaromonte F., and Calovi M.. 2022. “Honey Bee Colony Loss Linked to Parasites, Pesticides and Extreme Weather Across the United States.” Scientific Reports 12: 20787. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Iorizzo, M. , Letizia F., Ganassi S., et al. 2022. “Recent Advances in the Biocontrol of Nosemosis in Honey Bees ( Apis mellifera L.).” Journal of Fungi 8: 424. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Islam, M. , Malakar S., Dwivedi U., et al. 2023. “Impact of Different Drying Techniques on Grapefruit Peels and Subsequent Optimization of Ultrasonic Extraction Conditions for Bioactive Compounds.” Journal of Food Process Engineering 46: e14331. [ Google Scholar ] Kim, D. B. , Shin G. H., Kim J. M., et al. 2016. “Antioxidant and Anti‐Ageing Activities of Citrus‐Based Juice Mixture.” Food Chemistry 194: 920–927. [ DOI ] [ PubMed ] [ Google Scholar ] Klassen, S. S. , VanBlyderveen W., Eccles L., et al. 2021. “Nosema Ceranae Infections in Honey Bees ( Apis mellifera ) Treated With Pre/Probiotics and Impacts on Colonies in the Field.” Veterinary Science 8, no. 6: 107. [ Google Scholar ] Koolaji, N. , Shammugasamy B., Schindeler A., Dong Q., Dehghani F., and Valtchev P.. 2020. “Citrus Peel Flavonoids as Potential Cancer Prevention Agents.” Current Developments in Nutrition 4, no. 3: nzaa025. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Kunat‐Budzyńska, M. , Budzyński M., Schulz M., et al. 2022. “Natural Substances, Probiotics, and Synthetic Agents in the Treatment and Prevention of Honeybee Nosemosis.” Pathogens 11, no. 11: 1269. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Liu, Y. , Benohoud M., Yamdeu J. H. G., Gong Y. Y., and Orfila C.. 2021. “Green Extraction of Polyphenols From Citrus Peel by‐Products and Their Antifungal Activity Against Aspergillus flavus .” Food Chemistry: X 12: 100144. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Maistrello, L. , Lodesani M., Costa C., et al. 2008. “Screening of Natural Compounds for the Control of Nosema Disease in Honeybees ( Apis mellifera ).” Apidologie 39, no. 4: 436–445. [ Google Scholar ] Maqbool, Z. , Khalid W., Atiq H. T., et al. 2023. “Citrus Waste as Source of Bioactive Compounds: Extraction and Utilization in Health and Food Industry.” Molecules 28, no. 4: 1636. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Martín‐Hernández, R. , Meana A., Prieto L., Salvador A. M., Garrido‐Bailón E., and Higes M.. 2007. “Outcome of Colonization of Apis mellifera by Nosema ceranae .” Applied and Environmental Microbiology 73, no. 20: 6331–6338. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Mateus, A. R. S. , Marino‐Cortegoso S., Barros S. C., et al. 2024. “Citrus by‐Products: A Dual Assessment of Antioxidant Properties and Food Contaminants Towards Circular Economy.” Innovative Food Science and Emerging Technologies 95: 103737. [ Google Scholar ] M'hiri, N. , Ioannou I., Ghoul M., and Boudhrioua N. M.. 2014. “Extraction Methods of Citrus Peel Phenolic Compounds.” Food Reviews International 30, no. 4: 265–290. [ Google Scholar ] Milenkovic, D. , Deval C., Dubray C., Mazur A., and Mor C.. 2011. “Hesperidin Displays Relevant Role in the Nutrigenomic Effect of Orange Juice on Blood Leukocytes in Human Volunteers: A Randomized Controlled Cross‐Over Study.” PLoS ONE 6, no. 11: e26669. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Mohamed, H.

2016. “Extraction and Characterization of Pectin From Grapefruit Peels.” MOJ Food Processing & Technology 2, no. 1: 31–38. [ Google Scholar ] Narayanankutty, A. , Visakh N. U., Sasidharan A., et al. 2022. “Chemical Composition, Antioxidant, Anti‐Bacterial, and Anti‐Cancer Activities of Essential Oils Extracted From Citrus limetta Risso Peel Waste Remains After Commercial Use.” Molecules 27, no. 24: 8329. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Nayak, B. , Dahmoune F., Moussi K., et al. 2015. “Comparison of Microwave, Ultrasound and Accelerated‐Assisted Solvent Extraction for Recovery of Polyphenols From Citrus sinensis Peels.” Food Chemistry 187: 507–516. [ DOI ] [ PubMed ] [ Google Scholar ] Nishad, J. , Dutta A., Saha S., et al. 2021. “Ultrasound‐Assisted Development of Stable Grapefruit Peel Polyphenolic Nano‐Emulsion: Optimization and Application in Improving Oxidative Stability of Mustard Oil.” Food Chemistry 334: 127561. [ DOI ] [ PubMed ] [ Google Scholar ] Organization for Economic Co‐operation and Development. 1998. OECD Guidelines for the Testing of Chemicals. Test No. 213: Honeybees, Acute Oral Toxicity Test. https://www.oecd‐ilibrary.org/environment/test‐no‐213‐honeybees‐acute‐oral‐toxicity‐test_9789264070165‐en . [ Google Scholar ] Organization for Economic Co‐operation and Development. 2017. OECD Guidelines for the Testing of Chemicals. Test No. 245: Honey Bee (Apis mellifera L.), Chronic Oral Toxicity Test (10‐Day Feeding). https://www.oecd‐ilibrary.org/environment/test‐no‐245‐honey‐bee‐apis‐mellifera‐l‐chronic‐oral‐toxicity‐test‐10‐day‐feeding_9789264284081‐en . Öztürk, T. , Özbek H. N., and Koçak Yanık D.. 2024. “Environmentally Friendly Approach to Pectin Extraction From Grapefruit Peel: Microwave‐Assisted High‐Pressure CO 2 /H 2 O.” Foods 13, no. 2: 476. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Pașca, C. , Matei I. A., Diaconeasa Z., Rotaru A., Erler S., and Dezmirean D. S.. 2021. “Biologically Active Extracts From Different Medicinal Plants Tested as Potential Additives Against Bee Pathogens.” Antibiotics 10, no. 8: 960. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Pełka, K. , Otłowska O., Worobo R. W., and Szweda P.. 2021. “Bee Bread Exhibits Higher Antimicrobial Potential Compared to Bee Pollen.” Antibiotics 10, no. 10: 125. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Peng, G. , Gan J., Dong R., et al. 2021. “Combined Microwave and Enzymatic Treatment Improve the Release of Insoluble Bound Phenolic Compounds From the Grapefruit Peel Insoluble Dietary Fiber.” LWT 149: 111905. [ Google Scholar ] Potrich, M. , Silva R. T. L., Maciel R. M., et al. 2020. “Are Plant Extracts Safe for Honey Bees ( Apis mellifera )?” Journal of Apicultural Research 59, no. 5: 844–851. [ Google Scholar ] Requier, F. , Odoux J. F., Tamic T., et al. 2015. “Honey Bee Diet in Intensive Farm Habitats Reveals an Unexpectedly High Flower Richness and a Major Role of Weeds.” Ecological Applications 25, no. 4: 881–890. [ DOI ] [ PubMed ] [ Google Scholar ] Rydlewski, A. A. , de Morais D. R., Rotta E. M., et al. 2017. “Bioactive Compounds, Antioxidant Capacity, and Fatty Acids in Different Parts of Four Unexplored Fruits.” Journal of Food Quality 2017: 8401074. [ Google Scholar ] Saini, R. K. , Ranjit A., Sharma K., et al. 2022. “Bioactive Compounds of Citrus Fruits: A Review of Composition and Health Benefits of Carotenoids, Flavonoids, Limonoids, and Terpenes.” Antioxidants 11, no. 2: 239. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Saleem, M. , Durani A. I., Asari A., et al. 2023. “Investigation of Antioxidant and Antibacterial Effects of Citrus Fruits Peels Extracts Using Different Extracting Agents: Phytochemical Analysis With in Silico Studies.” Heliyon 9, no. 7: e14613. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Sanchez Macarro, M. , Martinez Rodriguez J. P., Bernal Morell E., et al. 2020. “Effect of a Combination of Citrus Flavones and Flavanones and Olive Polyphenols for the Reduction of Cardiovascular Disease Risk: An Exploratory Randomized, Double‐Blind, Placebo‐Controlled Study in Healthy Subjects.” Nutrients 12, no. 5: 1475. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Sánchez‐Moreno, C. , Cano M. P., de Ancos B., et al. 2003. “Effect of Orange Juice Intake on Vitamin C Concentrations and Biomarkers of Antioxidant Status in Humans.” American Journal of Clinical Nutrition 78, no. 3: 454–460. [ DOI ] [ PubMed ] [ Google Scholar ] Schulz, M. , Łoś A., Grzybek M., Ścibior R., and Strachecka A.. 2019. “Piperine as a New Natural Supplement With Beneficial Effects on the Life‐Span and Defence System of Honeybees.” Journal of Agricultural Science 157, no. 2: 140–149. [ Google Scholar ] Sembiring, E. N. , Elya B., and Sauriasari R.. 2018. “Phytochemical Screening, Total Flavonoid and Total Phenolic Content and Antioxidant Activity of Different Parts of Caesalpinia Bonduc (L.) Roxb.” Pharmacognosy Journal 10, no. 1: 123–127. [ Google Scholar ] Sir Elkhatim, K. A. , Elagib R. A., and Hassan A. B.. 2018. “Content of Phenolic Compounds and Vitamin C and Antioxidant Activity in Wasted Parts of Sudanese Citrus Fruits.” Food Science & Nutrition 6, no. 5: 1214–1219. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Suleria, H. A. , Barrow C. J., and Dunshea F. R.. 2020. “Screening and Characterization of Phenolic Compounds and Their Antioxidant Capacity in Different Fruit Peels.” Foods 9, no. 9: 1206. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] Taghizadeh‐Alisaraei, A. , Hosseini S. H., Ghobadian B., and Motevali A.. 2017. “Biofuel Production From Citrus Wastes: A Feasibility Study in Iran.” Renewable and Sustainable Energy Reviews 69: 1100–1112. [ Google Scholar ] Taşan, N. T. , and Akpınar Ö.. 2020. “Microwave Assisted Extraction of Pectin From Grapefruit Peel and Optimization of Extraction Conditions.” Turkish Journal of Agriculture ‐ Food Science and Technology 8, no. 7: 1528–1535. [ Google Scholar ] Tsuruda, J. M. , Chakrabarti P., and Sagili R. R.. 2021. “Honey Bee Nutrition.” The Veterinary Clinics of North America Food Animal Practice 37, no. 3: 505–519. [ DOI ] [ PubMed ] [ Google Scholar ] Wang, H. , Zhang S. W., Zeng Z. J., and Yan W. Y.. 2014. “Nutrition Affects Longevity and Gene Expression in Honey Bee ( Apis mellifera ) Workers.” Apidologie 45, no. 5: 618–625. [ Google Scholar ] Wang, Z. , Shang Q., Wang W., and Feng X.. 2011. “Microwave‐Assisted Extraction and Liquid Chromatography/Mass Spectrometry Analysis of Flavonoids From Grapefruit Peel.” Journal of Food Process Engineering 34, no. 3: 844–859. [ Google Scholar ] Wen, L. , He M., Yin C., Jiang Y., Luo D., and Yang B.. 2021. “Phenolics in Citrus aurantium Fruit Identified by UHPLC‐MS/MS and Their Bioactivities.” LWT 147: 111671. [ Google Scholar ] Williams, G. R. , Alaux C., Costa C., et al. 2013. “Standard Methods for Maintaining Adult Apis mellifera in Cages Under in Vitro Laboratory Conditions.” Journal of Apicultural Research 52, no. 1: 1–36. [ Google Scholar ] Xi, W. , Zhang G., Jiang D., and Zhou Z.. 2015. “Phenolic Compositions and Antioxidant Activities of Grapefruit ( Citrus paradisi Macfadyen) Varieties Cultivated in China.” International Journal of Food Science and Nutrition 66, no. 8: 858–866. [ Google Scholar ] Xu, Y. , Zhang L., Bailina Y., et al. 2014. “Effects of Ultrasound and/or Heating on the Extraction of Pectin From Grapefruit Peel.” Journal of Food Engineering 126: 72–81. [ Google Scholar ] Zhang, Q. , Zhang J., Shen J., Silva A., Dennis D. A., and Barrow C. J.. 2006. “A Simple 96‐Well Microplate Method for Estimation of Total Polyphenol Content in Seaweeds.” Journal of Applied Phycology 18, no. 3–5: 445–450. [ Google Scholar ] Associated Data This section collects any data citations, data availability statements, or supplementary materials included in this article. Supplementary Materials Supporting File 1: vms370917‐sup‐0001‐SuppMat.docx VMS3-12-e70917-s001.docx (1MB, docx) Data Availability Statement All data are available in the Supporting Information. In addition, the data are available upon request to the corresponding author. Articles from Veterinary Medicine and Science are provided here courtesy of Wiley ACTIONS View on publisher site PDF (2.7 MB) Cite Collections Permalink PERMALINK Copy RESOURCES Similar articles Cited by other articles Links to NCBI Databases Cite Copy Download .nbib .nbib Format: AMA APA MLA NLM Add to Collections Create a new collection Add to an existing collection Name your collection * Choose a collection Unable to load your collection due to an error Please try again Add Cancel Follow NCBI NCBI on X (formerly known as Twitter) NCBI on Facebook NCBI on LinkedIn NCBI on GitHub NCBI RSS feed Connect with NLM NLM on X (formerly known as Twitter) NLM on Facebook NLM on YouTube National Library of Medicine 8600 Rockville Pike Bethesda, MD 20894 Web Policies FOIA HHS Vulnerability Disclosure Help Accessibility Careers NLM NIH HHS USA.gov Back to Top