ConceptioArchiveNCBI PubMed Central
NCBI PubMed Centralopen access

Metabolic capacities of large "pillotinaceous" spirochetes from termite guts and their placement among Breznakiellaceae.

Treitli SC et al. · ncbi_pmc
NCBI PubMed Central · Papers · License: Open Access
Open Source ↗Direct PDF ↓
machine learning systems

Skip to main content An official website of the United States government Here's how you know Here's how you know Official websites use .gov A .gov website belongs to an official government organization in the United States. Secure .gov websites use HTTPS A lock ( Lock Locked padlock icon ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites. Search Log in Dashboard Publications Account settings Log out Search… Search NCBI Primary site navigation Search Logged in as: Dashboard Publications Account settings Log in Search PMC Full-Text Archive Search in PMC Journal List User Guide PERMALINK Copy As a library, NLM provides access to scientific literature. Inclusion in an NLM database does not imply endorsement of, or agreement with, the contents by NLM or the National Institutes of Health. Learn more: PMC Disclaimer | PMC Copyright Notice BMC Biol . 2026 Apr 7;24:96. doi: 10.1186/s12915-026-02591-x Search in PMC Search in PubMed View in NLM Catalog Add to search Metabolic capacities of large “pillotinaceous” spirochetes from termite guts and their placement among  Breznakiellaceae Sebastian C Treitli Sebastian C Treitli 1 Research Group Insect Gut Microbiology and Symbiosis, Max Planck Institute for Terrestrial Microbiology, Marburg, Germany Find articles by Sebastian C Treitli 1 , Undine S Mies Undine S Mies 1 Research Group Insect Gut Microbiology and Symbiosis, Max Planck Institute for Terrestrial Microbiology, Marburg, Germany Find articles by Undine S Mies 1 , Renate Radek Renate Radek 2 Institute of Biology/Zoology, Free University of Berlin, Berlin, Germany Find articles by Renate Radek 2 , Patricia A Zinnhardt Patricia A Zinnhardt 1 Research Group Insect Gut Microbiology and Symbiosis, Max Planck Institute for Terrestrial Microbiology, Marburg, Germany Find articles by Patricia A Zinnhardt 1 , Joana Maria Kästle Silva Joana Maria Kästle Silva 1 Research Group Insect Gut Microbiology and Symbiosis, Max Planck Institute for Terrestrial Microbiology, Marburg, Germany Find articles by Joana Maria Kästle Silva 1 , Lisa Reuter Lisa Reuter 1 Research Group Insect Gut Microbiology and Symbiosis, Max Planck Institute for Terrestrial Microbiology, Marburg, Germany Find articles by Lisa Reuter 1 , Natalie A Röhr Natalie A Röhr 1 Research Group Insect Gut Microbiology and Symbiosis, Max Planck Institute for Terrestrial Microbiology, Marburg, Germany Find articles by Natalie A Röhr 1 , Katja Platt Katja Platt 1 Research Group Insect Gut Microbiology and Symbiosis, Max Planck Institute for Terrestrial Microbiology, Marburg, Germany Find articles by Katja Platt 1 , Vincent Hervé Vincent Hervé 3 Université Paris-Saclay, INRAE, AgroParisTech, UMR SayFood, Palaiseau, 91120 France Find articles by Vincent Hervé 3 , Rudy Plarre Rudy Plarre 4 Federal Institute for Materials Research and Testing (BAM), Berlin, Germany Find articles by Rudy Plarre 4 , Mario Marini Mario Marini 5 Department of Biological, Geological and Environmental Sciences, University of Bologna, Bologna, Italy Find articles by Mario Marini 5 , Andreas Brune Andreas Brune 1 Research Group Insect Gut Microbiology and Symbiosis, Max Planck Institute for Terrestrial Microbiology, Marburg, Germany Find articles by Andreas Brune 1, ✉ Author information Article notes Copyright and License information 1 Research Group Insect Gut Microbiology and Symbiosis, Max Planck Institute for Terrestrial Microbiology, Marburg, Germany 2 Institute of Biology/Zoology, Free University of Berlin, Berlin, Germany 3 Université Paris-Saclay, INRAE, AgroParisTech, UMR SayFood, Palaiseau, 91120 France 4 Federal Institute for Materials Research and Testing (BAM), Berlin, Germany 5 Department of Biological, Geological and Environmental Sciences, University of Bologna, Bologna, Italy ✉ Corresponding author. Received 2025 Oct 8; Accepted 2026 Mar 30; Collection date 2026. © The Author(s) 2026 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/ . PMC Copyright notice PMCID: PMC13067680  PMID: 41943061 Abstract Background Spirochetes are the most abundant bacterial group in the hindgut of termites. The largest species, with cell lengths of up to 100 µm, have been provisionally classified in the family “ Pillotinaceae ” based exclusively on morphological traits. However, in the absence of cultured representatives, their phylogenetic position and metabolism remain entirely unknown. Results We investigated phylogeny and metabolic capacities of “pillotinaceous” spirochetes using single-cell techniques, electron microscopy, and fluorescence in situ hybridization. All sequences of large spirochetes obtained from various termites fell into four distinct, well-supported clusters within the family Breznakiellaceae . Based on ultrastructural features, three of the clusters were assigned to the genera Pillotina , Hollandina , and the newly established genus Hollandinoides; a fourth cluster was tentatively assigned to the genus Clevelandina . Functional analysis of the single-cell genomes of Pillotina corrugata sp. nov., Hollandina grandis sp. nov., and Hollandinoides gharagozlouae gen. nov. sp. nov., combined with comparative genomics of other uncultured relatives, demonstrated differences in the capacity to degrade cellulose, hemicelluloses, and dextrins. While members of the genus Pillotina have a fermentative metabolism, members of the other genera encode a Wood–Ljungdahl pathway and, in the case of Hollandina , a group-III nitrogenase, suggesting roles in reductive acetogenesis and nitrogen fixation. Conclusions Our results provide the first molecular data on pillotinaceous spirochetes. We show that the three genera covered in our study belong to the family Breznakiellaceae , which harbors the majority of termite-gut spirochetes. Comparative genome analysis indicated that the large spirochetes in termite guts have distinct roles in symbiotic digestion. Supplementary Information The online version contains supplementary material available at 10.1186/s12915-026-02591-x. Keywords: Spirochetes, Phylogenomics, Single-cell techniques, Pillotinaceae , Gut microbiota, Ultrastructure Background The hindgut of termites has the highest abundance and diversity of spirochetes of any microbial habitat. Individual lineages of termite gut spirochetes are either free-swimming in the hindgut fluid or associated with flagellated protists [ 1 – 3 ]. Spirochetes can make up more than half of the prokaryotic gut microbiota in certain wood-feeding termite species and are considered important players in the symbiotic digestion of lignocellulose [ 4 – 6 ]. In live mounts of hindgut suspensions, spirochetal cells are easily recognized by their conspicuous helical shape and high motility. The more abundant morphotypes are small, but most termite species also harbor fewer but extremely large forms with a cell diameter of up to 1.5 µm and a length greater than 100 µm [ 7 – 9 ]. Despite their conspicuous morphology and many unusual ultrastructural features, individual species of the phylum Spirochaetota can only be identified by molecular techniques. The earliest 16S rRNA gene-based studies of termite-gut spirochetes revealed two distinct phylogenetic clades in the radiation of the genus Treponema , which were referred to as “termite cluster I” and “termite cluster II” [ 10 , 11 ] and recently reclassified in the families Breznakiellaceae and Treponemataceae (order Treponematales ), respectively [ 12 ]. The majority of termite-gut spirochetes belong to the family Breznakiellaceae , where they form numerous host-specific lineages. The representatives of Treponemataceae form only a small clade that comprises intracellular symbionts of termite-gut flagellates lacking the typical spirochetal morphology [ 13 , 14 ] . In addition, several other lineages of termite-gut spirochetes, comprising members of Sphaerochaetaceae , Alkalispirochaetaceae , and uncultured Leptospirales , have been detected in cultivation-based and metagenomic studies [ 5 , 15 – 17 ]; they fall outside the Treponematales and have so far received little attention. Already in the late nineteenth century, Joseph Leidy observed large free-swimming spirochetes in termite guts [ 18 , 19 ]. Their ultrastructural features were first documented by Hollande and Gharagozlou, who described Pillotina calotermitidis [ 8 ] and Diplocalyx calotermitidis [ 20 ] from dry-wood termites (Kalotermitidae). Their observations were expanded by formal descriptions of these and additional species, including Hollandina pterotermitidis from Pterotermes occidentis and Clevelandina reticulitermitidis from subterranean termites (Rhinotermitidae) [ 7 , 21 ]. Based on the unique morphological characteristics of these genera, the creation of a separate family, “ Pillotinaceae ”, has been proposed [ 22 ]. Like other termite gut spirochetes, also the large “pillotinaceous” forms possess periplasmic flagella that are inserted subterminally at each cell pole and wrap around the protoplasmic cylinder. These “endoflagella” are responsible for the helical shape and the high motility in viscous media typical for most members of the phylum Spirochaetota [ 23 , 24 ]. However, pillotinaceous spirochetes differ from the smaller forms in several features, including a larger size and increased degree of multiplication of the periplasmic flagella in all species, and a combination of other morphological traits, such as a crenulated outer sheath, a deep invagination of the outer membrane (groove or “sillon”), and various decorations of cytoplasmic and outer membranes, which are used to differentiate between individual genera [ 7 , 8 , 20 , 22 ]. The large spirochetes in termite guts are easily recognizable under both light and electron microscopy, yet not a single representative has been cultivated. Despite the absence of type strains, the species names of the above-mentioned morphotypes are considered validly published under the rules of the International Code of Nomenclature for Prokaryotes (ICNP). However, without molecular data, the relationship between the different genera and the validity of the family “ Pillotinaceae ” cannot be tested, and none of the species can be linked to the many genomes of uncultured termite-gut spirochetes that have been obtained in metagenomic studies and single-cell analyses of termite-gut microbiota (e.g., [ 5 , 15 , 25 , 26 ]). Therefore, their phylogenetic position and metabolic capacities have remained entirely obscure. In this work, we identified the large spirochetes in the hindgut of several lower termites using micromanipulation, single-cell genomics, and fluorescence in situ hybridization (FISH). We conducted phylogenetic and phylogenomic analyses and characterized the metabolic potential of selected representatives by functional genome analysis and comparative genomics. Based on the genome sequences, we describe a new genus and three new species under the rules of the Code of Nomenclature of Prokaryotes Described from Sequence Data (SeqCode) [ 27 ] and provide emended descriptions of existing genera and their taxonomic classification. Results Identification and phylogenetic position of large spirochetes Using micromanipulation, we isolated large spirochetal cells from the gut contents of Kalotermes flavicollis (8 individual cells) , Kalotermes italicus (5 individual cells) , Incisitermes tabogae (3 individual cells) , Incisitermes aff. schwarzi (5 individual cells), and Reticulitermes flavipes (9 individual cells). The DNA of each cell was amplified using whole genome amplification (WGA), and the 16S rRNA genes were sequenced with universal Bacteria primers. The resulting single-cell amplicon (SCA) sequences were placed into a reference alignment of 16S rRNA genes of Spirochaetota that comprised representatives from a wide range of termites and other arthropods. Phylogenetic analysis revealed that all SCAs of large spirochetes fall into the radiation of the family Breznakiellaceae , where they form four well-supported clusters (clusters A–D; Fig. 1 , Additional File 1: Fig. S1). Cluster A consists exclusively of sequences from the genus Reticulitermes , including three SCAs and one single-cell amplified genome (SAG) from R. flavipes . Cluster B comprises two subclades, one with SCAs and SAGs from the genus Kalotermes ( Pillotina corrugata sp. nov.; cluster B1), the other with representatives from the genus Reticulitermes (cluster B2), including two SAGs previously recovered from R. speratus [ 25 ]. Cluster C contains sequences from numerous members of the family Kalotermitidae (cluster C1), including SCAs and SAGs from the genus Incisitermes ( Hollandina grandis sp. nov.), and a subclade (cluster C2) with SCAs from the genus Kalotermes ( Candidatus Hollandina kalotermitidis). Cluster D consists exclusively of sequences from Rhinotermitidae, including a lineage comprising SCAs and a SAG from R. flavipes ( Hollandinoides gharagozlouae gen. nov. sp. nov.; cluster D1) and one containing only SCAs from R. flavipes (cluster D2). Fig. 1. Open in a new tab Maximum-likelihood (ML) phylogenetic tree showing the relationship of our isolated bacterial 16S rRNA phylotypes within the family Breznakiellaceae . Values at the nodes represent ML ultrafast bootstrap support values (> 90%) and SH-aLRT scores (> 80). Bullets represent full node support (ML: 100%; SH-aLRT: 100%). Sequences obtained from single cells are in red and sequences from investigated amplicon libraries are in purple. The number next to the collapsed clade represents the number of sequences in that clade. The tree was rooted with other members of Treponematales . Scale bar, 0.1 expected substitutions per site. A fully expanded version of the tree can be found in Additional File 1: Fig. S1 Linking phylogeny to morphology Electron microscopy (EM) of hindgut suspensions revealed that the investigated termites harbor four morphotypes of large spirochetes (Fig. 2 ). All morphotypes have numerous periplasmic flagella but differ in the structure of the outer membrane and additional features. One morphotype, found in K. flavicollis , K. italicus , and R. flavipes (Fig. 2 A–C), has a strongly crenulated outer membrane with an underlying electron-dense layer, which is attached to the cytoplasmic membrane at one point, creating an axial groove (sillon) along the cell body. This combination of traits is consistent with the descriptions of Pillotina calotermitidis from Postelectrotermes praecox and similar morphotypes observed in both Kalotermes and Reticulitermes spp. [ 8 , 28 ]. A second morphotype, present in K. flavicollis , K. italicus , I. tabogae, and R. flavipes (Fig. 2 D–G), lacks a sillon and has a smooth outer membrane decorated with a thick outer coat. These characteristics are consistent with the descriptions of Hollandina pterotermitidis from Pterotermes occidentis and similar morphotypes observed in other kalotermitids [ 7 , 21 , 29 ]. The two remaining morphotypes were found exclusively in R. flavipes . One resembles the morphotype of Hollandina but possesses a discrete sillon (Fig. 2 H). The other has a smooth outer membrane with a thick inner coat that forms a sillon, and a cup-like structure (calyx) partially engulfing the protoplast (Fig. 2 I). The same morphotype has been previously observed in R. flavipes [ 30 ] and matches the description of Clevelandina reticulitermitidis from Reticulitermes tibialis [ 7 ] . Fig. 2. Open in a new tab Transmission electron micrographs of spirochete morphotypes identified in different termites. A Pillotina from Kalotermes flavicollis, showing the protoplasmic cylinder (pc), numerous flagella (f), outer membrane (om), crenulations on the outer membrane (cr), cytoplasmic membrane (cm), and sillon (s). B Pillotina from Kalotermes italicus. C Pillotina from Reticulitermes flavipes. D Hollandina from K. flavicollis. E Hollandina from K. italicus. F Hollandina from Incisitermes tabogae. G Hollandina -like morphotype from Reticulitermes flavipes. H Hollandina -like morphotype with a sillon from Reticulitermes flavipes. I Clevelandina -like morphotype with a sillon and a calyx (cx) from Reticulitermes flavipes To link the 16S rRNA gene sequences obtained by single-cell analysis to their corresponding morphotypes and to determine whether all phylotypes of large spirochetes were detected, we conducted fluorescence in situ hybridization (FISH) with a previously published general probe [ 31 ] that targets the majority of termite gut spirochetes, except the representatives of cluster D, and several specifically designed oligonucleotide probes against individual phylogenetic clusters (Table 1 ). In the case of K. flavicollis and K. italicus , two specific probes targeting the phylotypes of Pillotina (subcluster B1) and Hollandina (subcluster C2) obtained from these termites allowed us to differentiate the two distinct morphotypes of large spirochetal cells present in the respective samples (Fig. 3 ). None of the large spirochetal cells hybridized exclusively with the general probe, suggesting that the Kalotermes spp. investigated in our study are colonized only by members of the genera Pillotina and Hollandina , which is consistent with the ultrastructural data. In the case of I. tabogae and I. aff. schwarzi , a specific probe targeting the phylotype of Hollandina (subcluster C1) obtained from these termites identified a single morphotype of large spirochetes in the respective samples (Fig. 4 ). Again, the congruence of the signal with that of the general probe confirmed that additional phylotypes of large spirochetes are absent. All samples contained smaller spirochetal cells that hybridized exclusively with the general probe. Table 1. Oligonucleotide probes used for the fluorescence in-situ hybridization of large spirochetes in different termites, the optimal formamide concentrations, and the (sub)cluster and phylotypes targeted by the respective probe Name Probe sequence (5'−3') Optimal formamide concentration (Sub-) cluster Targeted phylotypes It-Hol-183 CCATGCCACAGCACGATAAG 40% C1 Hollandina grandis from Incisitermes spp. Kf-Hol-193 GAGCCACAGCCCCTTTCCT 30% C2 Hollandina from Kalotermes spp. Kf-Pil-1449 GCAGCGCCCTCCTTTTACAA 30% B1 Pillotina corrugata from Kalotermes spp. Rf-Clev-140 CTAACAGATATCCCCAACCC 30% A Putative Clevelandina from Reticulitermes spp. Rf-Pil-129 CCCAACCTCTCGGGTAGATT 30% B2 Pillotina from Reticulitermes spp. Rf-HolD-1041 CCATGCAGCACCTGTAGT 30% D Hollandinoides from Reticulitermes flavipes Rf-HolD1-990 GGCTTCCCCACTATGTCAAA 20% D1 Hollandinoides gharagozlouae from Reticulitermes flavipes Open in a new tab Fig. 3. Open in a new tab FISH of spirochetes in the gut contents of Kalotermes spp. using different oligonucleotide probes. The Spiro-36 probe targets the majority of termite gut spirochetes. Phylotypes from K. flavicollis and K. italicus belonging to cluster C2 are targeted by the Kf-Hol-193 probe . Phylotypes from K. flavicollis and K. italicus belonging to cluster B1 are targeted by the Kf-Pil-1449 probe . Probe sequences are given in Table 1 . All scale bars are 20 µm Fig. 4. Open in a new tab FISH of spirochetes in the gut contents of Incisitermes spp. using different oligonucleotide probes. The Spiro-36 probe targets the majority of termite gut spirochetes. Phylotypes from I. tabogae and I. aff. schwarzi belonging to cluster C1 are targeted by the It-Hol-183 probe . Probe sequences are given in Table 1 . All scale bars are 20 µm In the case of R. flavipes , a set of specific probes targeting the phylotypes in clusters A, B2, and D that are represented in this termite species clearly differentiated three morphotypes of large spirochetes (Fig. 5 top row). Notably, the morphotype targeted by the probe against subcluster B2, represented by only a few amplicon sequences from R. flavipes , was very rare, which would explain the absence of this phylotype from the SCAs obtained from this termite and the low abundance of cells with the morphology of Pillotina in ultrathin sections of R. flavipes (Fig. 2 C). A combination of the probe for cluster D with an additional probe (Rf-HolD1-990) against subcluster D1 allowed us to distinguish two morphotypes that represent subclusters D1 and D2, both of which did not hybridize with the general probe (Fig. 5 , bottom row). Fig. 5. Open in a new tab FISH of spirochetes in the gut contents of Reticulitermes flavipes using different oligonucleotide probes. Probe Spiro-36 targets the majority of termite gut spirochetes, with the exception of representatives from cluster D. Phylotypes from R. flavipes belonging to the cluster A are targeted by the Rf-Clev-140 probe. Phylotypes from R. flavipes belonging to the cluster D are targeted by the Rf-HolD-1041 probe. Phylotypes from R. flavipes belonging to the cluster B2 are targeted by the Rf-Pil-129 probe . Phylotypes from R. flavipes belonging to the cluster D1 are targeted by the Rf-HolD1-990. Probe sequences are given in Table 1 . All scale bars are 20 µm Genome sequencing, assembly, and phylogenomic analysis Two WGA products of Pillotina corrugata from K. flavicollis, two WGA products of Hollandina grandis from I. tabogae, and two WGA products from R. flavipes were selected for short-read genome sequencing using an Illumina platform. After genome assembly and decontamination, we obtained a SAG for Pillotina corrugata with an assembly size of 3.06 Mbp and a GC content of 43.2 mol%. Based on CheckM, the genome completeness was estimated at 97.4% with no contamination. In the case of Hollandina grandis , one of the two WGA products (ItSP3) was contaminated with other bacteria and was discarded. After assembly and decontamination, the remaining sample yielded a SAG with an assembly size of 3.55 Mbp and an average GC content of 49.1 mol%. The genome completeness was estimated at 95.5% with 1.7% contamination. Sample RfSP5 from R. flavipes yielded a SAG for Hollandinoides gharagozlouae with an assembly size of 3.69 Mbp and a GC content of 47 mol%. Based on CheckM, the genome completeness was estimated at 91.7% with 0.1% contamination. The second WGA product from R. flavipes , RfSP9, yielded a SAG with an assembly size of 3.45 Mbp, an average GC content of 48.7 mol%, and a genome completeness of 78.3% with 3.4% contamination (Table 2 ). Table 2. General features of the single-cell assembled genomes obtained in this study. Completeness and contamination were estimated using CheckM (CheckM2 in parentheses). Estimated genome size is based on assembly size and completeness SAG Scaffolds Assembly size (bp) Estimated genome size (Mbp) N50 (kbp) GC content (mol%) Completeness (%) Contamination (%) Pillotina corrugata KfSPG140 147 3,056,337 3.14 49.0 43.2 97.4 (94.3) 0.0 (0.2) Hollandina grandis ItSP2 312 3,553,180 3.72 21.6 49.1 95.5 (84.7) 1.7 (1.3) Hollandinoides gharagozlouae RfSP5 121 3,691,541 4.02 42.6 47 91.7 (92.9) 0.1 (0.1) RfSP9 from Reticulitermes flavipes 211 3,452,027 4.41 23 48.7 78.3 (78.8) 3.4 (1.5) Open in a new tab In all cases, the 16S rRNA genes in the SAGs were identical to the SCA sequences obtained from the same samples. Phylogenomic analysis confirmed that all SAGs represent species that fall into the family Breznakiellaceae (Fig. 6 ). The genome of Pillotina corrugata is almost identical (99.7% average nucleotide identity) to a MAG (GCA_031273325.1) previously obtained from the gut content of K. flavicollis [ 15 ], and falls into a genus-level clade (g__BOBG01) that also comprises MAGs from other Kalotermitidae ( Incisitermes marginipennis and Neotermes cubanus ) and two SAGs from R. speratus. The genome of Hollandina grandis falls into another genus-level clade (g__JAIRLU01) of MAGs obtained from a wide range of Kalotermididae. A sister clade (g__JAITHW01) harbors the SAG of Hollandinoides gharagozlouae from R. flavipes and several MAGs obtained from other Rhinotermitidae. SAG RfSP9 falls into a genus-level clade (g__JAISNI01) comprising a SAG from R. flavipes and two MAGs from Kalotermitidae. Because of the low genome completeness, we did not attempt a full metabolic reconstruction of this MAG but we included it in a comparative genome analysis of important features. The topology and composition of the Pillotina, Hollandina , and Hollandinoides clades match the corresponding clusters in the 16S rRNA gene tree (Fig. 1 ). Fig. 6. Open in a new tab Maximum-likelihood (ML) phylogenomic tree showing the relationship of Pillotina corrugata, Hollandina grandis , and Hollandinoides gharagozlouae to other representatives of the family Breznakiellaceae . Values at the nodes represent ML ultrafast bootstrap support values (> 90%) and SH-aLRT scores (> 80). Bullets represent full node support (ML: 100%; SH-aLRT: 100%). The newly obtained genome sequences are in bold. The tree was rooted with other representatives of Spirochetales (not shown) . Scale bar, 0.5 expected substitutions per site Metabolic capacities of the new species The genomes of P. corrugata and Hollandinoides gharagozlouae both encode a high number of glycosyl hydrolases (GH) (41 GHs from 27 GH families and 42 GHs from 27 GH families, respectively), whereas their number in the genome of H. grandis is much lower (23 GHs from 17 families; Additional File 2: Table S1, S2 and S3). Homologs with a secretion signal present in P. corrugata comprise an endoglucanase (GH5), an endoxylanase (GH10), a chitinase (GH18), an endo-mannosidase (GH26), a β-galactosidase (GH39), and an α-glucuronidase (GH67). In Hollandinoides gharagozlouae , the number of secreted GHs was slightly higher, including two β-glucosidases (GH3), an endoxylanase (GH10), two chitinases (GH18) an endo-mannosidase (GH26), and three endo-xylanases (GH30), whereas H. grandis possesses only a single β-glucosidase (GH3), a chitinase (GH5_48), and a lichenase/laminarinase (GH16_3). A homolog of GH73 involved in chitin degradation is present in all species (Fig. 7 ). While all genomes encode a large number of ATP-binding cassette (ABC)-type sugar transporters, their number is about double as high in Hollandinoides gharagozlouae (34) than in the other species (16 in P. corrugata and 10 in H. grandis ). We confidently identified ABC transporters of xylose, arabinose, and aldouronates/hexuronates in all genomes, transporters of ribose in P. corrugata and Hollandinoides gharagozlouae , and several importers for pectin oligosaccharides and rhamnose in the genome of Hollandinoides gharagozlouae (Additional File 2: Table S4, S5 and S6). The substrate specificity of the remaining sugar transporters is unclear. All organisms encode putatively cytoplasmic β-glucosidases from various GH families that are involved in the degradation of sugar oligomers. One of the aldouronate transporters of H. grandis is part of an operon that contains a homolog of yesR , which is crucial for rhamnogalacturonan degradation in Bacillus subtilis [ 32 ], suggesting that H. grandis imports rhamnogalacturonan and possibly other hexuronates that are subsequently hydrolyzed by GH105. Fig. 7. Open in a new tab Predicted metabolic pathways of the new species. A Pillotina corrugata , B Hollandina grandis. C Hollandinoides gharagozlouae . Amino acids are shown in green; vitamins and cofactors are shown in pink. Pathways missing some enzymes are marked with a gray dashed arrow. Non-standard abbreviations: Ac, acetate; Ac-CoA, acetyl-coenzyme A; AcP, acetyl phosphate; Arb, arabinose; BCAA, branched-chain amino acid; DHAP, dihydroxyacetone phosphate; Ery-4P, erythrose 4-phosphate; For, formate; Fnr, ferredoxin:NADP + oxidoreductase; Fru6P, fructose 6-phosphate; Fum, fumarate; GAP, glyceraldehyde 3-phosphate; GalUro, galacturonate; Glc, glucose; Glc6P, glucose 6-phosphate; GlcNAc, N -acetyl glucosamine; GluUro, glucouronate; Gly3P, glycerate 3-phosphate; Lac, lactate; Lactalh, lactaldehyde; Mal, malate; OxAc, oxaloacetate; 2OG, 2-oxoglutarate; PEP, phosphoenolpyruvate; Pyr, pyruvate; Rha, rhamnose; Rib, ribose; Rib5P, ribose 5-phosphate; Rnf, ferredoxin:NAD + oxidoreductase complex; Rul5P, ribulose 5-phosphate; Sedo-7P, sedoheptulose 7-phosphate; Sedo-1,7P, sedoheptulose 1,7-diphosphate; THF, tetrahydrofolate; Xyl, xylose; Xyl5P, xylose 5-phosphate. End products of the energy metabolism are highlighted All organisms convert the imported sugars to pyruvate via glycolysis (Fig. 7 ). Pentoses and aldouronates are shuttled into the glycolytic pathway via the pentose-phosphate pathway and the KDPG pathway. In H. grandis and P. corrugata, pyruvate is converted to acetyl-CoA by pyruvate:ferredoxin oxidoreductase (PFOR), and the production of acetate by phosphate acetyltransferase and acetate kinase provides additional ATP by substrate-level phosphorylation . In Hollandinoides gharagozlouae , which lacks phosphate acetyltransferase, acetate production and substrate-level phosphorylation may proceed via an ADP-forming acetyl-CoA synthetase (acdAB, Additional File 2: Table S6). All species possess an electron-confurcating hydrogenase of group A3, which catalyzes the concomitant reoxidation of NADH and reduced ferredoxin generated during the conversion of sugars to acetate and CO 2 . In addition, both H. grandis and Hollandinoides gharagozlouae possess all enzymes for the reduction of CO 2 to acetyl-CoA via the Wood–Ljungdahl pathway (WLP), including a hydrogen-dependent CO 2 reductase (HDCR) and a CO dehydrogenase-acetyl-CoA synthase (ACS) complex, which allows regeneration of NADH and reduced ferredoxin by reductive acetogenesis. A Na + -translocating ferredoxin:NAD + oxidoreductase (Rnf) complex and an F-type ATP synthase allow both species to generate additional ATP by electron-transport phosphorylation. The complex is present also in P. corrugata , where it may serve to adjust the redox balance between NADH and ferredoxin and to generate membrane potential. Notably, a ferredoxin-NADP + reductase (FNR) is present only in the genome of P. corrugata. A classical (NADH-dependent) lactate dehydrogenase (Ldh) is present only in H. grandis ; in P. corrugata , we identified an Ldh family oxidoreductase with unclear substrate specificity. The genomes of all species encode the pathways for de novo biosynthesis of 11 proteinogenic amino acids. Branched-chain amino acids can be synthesized only by H. grandis and Hollandinoides gharagozlouae , and all species lack the capacity to synthesize asparagine, histidine and phenylalanine, indicating a dependence on an external supply of amino acids as growth factors. All genomes contain an ammonium transporter (Amt), but only H. grandis possesses a complete operon ( nifADHKENB ) encoding a group-III nitrogenase, indicating the capacity to fix dinitrogen. While nif-gene homologues were completely absent in Hollandinoides gharagozlouae , P. corrugata possesses several homologs of group-IV nitrogenase genes ( nifB , nifD , nifK, and nifH ) that are not part of a gene cluster but spread across distant loci. While nifB and nifH are associated with an AAA-family ATPase and a radical-SAM protein, nifK and nifD are part of an operon encoding leucine-rich repeat proteins and a cysteine synthase that might be involved in sulfur metabolism [ 33 , 34 ]. Discussion In the present study, we combined genomic data, fluorescence in situ hybridization, and ultrastructural characterization to provide a molecular basis for the taxonomic classification of the so-far-elusive pillotinaceous spirochetes in termite guts. We demonstrated that the large spirochetes colonizing the termite genera Kalotermes , Incisitermes , and Reticulitermes represent four distinct, genus-level lineages of Breznakiellaceae , a recently described family of Treponematales that harbors the majority of all termite gut spirochetes [ 12 ]. Comparative analysis of the high-quality genomes of P. corrugata, H. grandis, and Hollandinoides gharagozlouae revealed that the large spirochetes in termite guts differ in their metabolic potential, indicating distinct roles in symbiotic digestion. The genus Pillotina The description of the type species, Pillotina calotermitidis , is based on a morphotype that occurs in the gut of Postelectrotermes [syn. Calotermes, Kalotermes ] praecox [ 7 , 8 ]. Large spirochetes with a similar morphology have also been observed in R. flavipes , R. hesperus, and Incisitermes schwarzi [ 7 , 30 ], and have been tentatively assigned to the genus Pillotina [ 22 ]. However, the phylogenetic position of these species is not known. In the present study, we documented large spirochetes with ultrastructural features of the genus Pillotina in both K. flavicollis and K. italicus as well as R. flavipes (Fig. 2 A–C). Individual cells isolated from gut contents of Kalotermes spp. fall into cluster B1, which consists exclusively of sequences obtained from this genus (Fig. 1 ). Although we did not obtain any cells by capillary picking from R. flavipes that fell into subcluster B2, this subcluster comprises a sequence from an amplicon library from R. flavipes and 16S rRNA gene sequences of two SAGs from R. speratus . Since FISH with specific probes against subcluster B2 hybridized large spirochetes in gut homogenates of R. flavipes (Fig. 5 ), we are confident that the phylotypes in subcluster B2 represent the morphotype of Pillotina observed in species of the genus Reticulitermes in this and in previous studies. While the phylogenetic distances between representatives of subclusters B1 and B2 are high (85–88% sequence identity) and their sister position lacks bootstrap support (Fig. 1 ), the monophyly of cluster B is strongly supported in the phylogenomic analysis (Fig. 6 ). The low relative evolutionary divergence between the genome of Pillotina corrugata (subcluster B1) (this study), the two SAGs from R. speratus [ 25 ] (subcluster B2), and several MAGs from other kalotermitids [ 15 ] corroborates that cluster B (g__BOBG01 in GTDB) indeed represents a genus-level lineage (Fig. 6 ). Although the identity of the type species, Pillotina calotermitidis , remains to be established, we assign all representatives of cluster B to the genus Pillotina (see Taxonomy section). Notably, we found no evidence for the presence of members of this genus in termites of the genus Incisitermes . Phylotypes from cluster B were not represented among the large spirochetal cells isolated from I. tabogae and I. aff. schwarzi and were absent from the amplicon libraries obtained from these and three other species ( I. synderi , I. platycephalus, and I. incisus ) investigated to date. Moreover, FISH analysis of I. tabogae and I. aff. schwarzi corroborated the absence of large spirochetes other than those assigned to the genus Hollandina (see below), and no spirochetes with the ultrastructure of Pillotina were detected in the electron micrographs of I. tabogae . Therefore, the earlier identification of Pillotina in I. schwarzi [ 21 ] based only on light microscopy is potentially incorrect. The genus Hollandina The description of the type species, Hollandina pterotermitidis , is based on a morphotype that occurs in the gut of Pterotermes occidentis [ 7 , 21 ]. Similar morphotypes tentatively assigned to the genus Hollandina have also been observed in other members of the family Kalotermitidae, including several Incisitermes spp., members of the family Rhinotermitidae ( Coptotermes formosanus , several Reticulitermes spp.), the termite Mastotermes darwiniensis , and the wood roach Cryptocercus punctulatus [ 7 , 21 , 28 , 35 ]. Again, no isolates were obtained, and the phylogenetic position of these species remained unknown. In the present study, we documented morphotypes with the ultrastructural features of the genus Hollandina in Kalotermes spp., Incisitermes spp., and Reticulitermes flavipes (Fig. 2 D–H). The corresponding phylotypes from Kalotermes and Incisitermes fall into cluster C, which comprises also the 16S rRNA gene sequences from numerous other kalotermitids that were not investigated in the previous studies (Fig. 1 ). Although the phylogenetic position of the type species remains to be established, we assign all members of cluster C to the genus Hollandina . In large-scale amplicon libraries, members of this cluster are present in many kalotermitid hosts but absent from R. flavipes , C. formosanus , several other rhinotermitids, M. darwiniensis , and the wood roach Cryptocercus punctulatus , indicating that the large spirochetes with a Hollandina -like morphology present in these species belong to lineages outside the radiation of cluster C (Fig. 1 , Additional File 1: Fig. S1). The genus Hollandinoides Although the sister position of clusters C and D is only poorly supported in the 16S rRNA gene analysis (Fig. 1 ), the phylogenomic analysis strongly supports that the genomes in cluster D, which consist exclusively of representatives from Rhinotermitidae, represent a genus-level lineage (g__JAITHW01 in GTDB) that is sister to the genus Hollandina (Fig. 6 ). We therefore describe this lineage as a new genus, Hollandinoides , with Hollandinoides gharagozlouae from R. flavipes as the type species. Our ultrastructural data on the large spirochetes in R. flavipes revealed the presence of two distinct Hollandina- like morphotypes (Fig. 2 G and H). While this is concordant with the presence of two distinct phylotypes in the 16S rRNA gene libraries of this species (clusters D1 and D2; Fig. 1 ), it is presently not possible to assign a definitive morphotype to Hollandinoides gharagozlouae . Other large spirochetes Termites of the genus Reticulitermes harbor large spirochetes assigned to the genus Clevelandina , whose type species, Clevelandina reticulitermitidis , has been described in R. tibialis [ 7 ]. The morphotypes of Pillotina and Clevelandina have also been documented in R. flavipes [ 9 , 30 ] and a Hollandina -like morphotype in R. hesperus [ 7 ] (see above). We detected four morphotypes of large spirochetes (Fig. 2 C, G-I) in our electron micrographs of R. flavipes , which matches the presence of four phylotypes in this species (clusters A, B2, D1, and D2). Although the FISH analysis confirmed that all phylotypes are large spirochetes (Fig. 5 ), only one morphotype (Fig. 2 C) can be firmly linked to the genus Pillotina (see above). While the two Hollandina -like morphotypes (Fig. 2 G and H) most likely represent Hollandinoides gharagozlouae (Cluster D1) and the second, closely related phylotype (cluster D2) from R. flavipes in the genus Hollandoida (see above), the assignment of the morphotype matching the description of Clevelandina (Fig. 2 I) remains tentative. Spirochetes with the morphology of Clevelandina reportedly occur exclusively in the genus Reticulitermes [ 7 ], which is consistent with the exclusive presence of representatives from Reticulitermes spp. in cluster A, including the remaining, unassigned SCAs and SAGs from R. flavipes (Fig. 1 ). However, in the phylogenomic tree, the SAGs from this cluster form a genus-level clade (g__JAISNI01) that contains also two MAGs from K. flavicollis and I. marginipennis . While I. marginipennis was not investigated in our study, the FISH analysis of K. flavicollis showed no spirochetes other than those targeted by the Pillotina -specific and Hollandina- specific probes. If the morphotype of Clevelandina is indeed represented by cluster A, members of this genus may be rare or not consistently present in K. flavicollis . The same argument would explain also the absence of spirochetes with the morphology of Diplocalyx calotermitidis from the K. flavicollis samples investigated in the present study. The description of this species is based on a morphotype from Kalotermes [syn. Calotermes , Incisitermes ] flavicollis [ 7 , 20 ]. It is characterized by the presence of a sillon, a bundle of 70–80 flagella opposing the sillon, an inner coat on the outer membrane, and a thick outer coat on the inner membrane, forming a calyx. However, we did not observe any cells with these unique characteristics in our electron micrographs of K. flavicollis, which is consistent with the absence of a third phylotype among the SCAs from this species and corroborated by the results of our FISH analysis of this termite (Fig. 3 A). Therefore, we conclude that also Diplocalyx calotermitidis is either rare or not consistently present in K. flavicollis . In that context, it is important to note that K. flavicollis represents a species complex that comprises several regional subgroups, which include the recently described K. italicus and at least two distinct lineages of K. flavicollis from the Eastern and Western Mediterranean region [ 36 , 37 ] (Additional File 1: Fig. S2). The provenance of the sample investigated by Gharagozlou [ 20 ] is unclear, but it may differ from that of the samples used in our study. A second species, “ Diplocalyx cryptotermitidis ,” has been described based on a morphotype from Cryptotermes cavifrons [ 35 ]. This species is colonized by numerous phylotypes of Breznakiellaceae (Additional File 1: Fig. S1), but the identity and phylogenetic position of the large spirochetes in the genus Diplocalyx remain to be investigated. Nevertheless, the pillotinaceous spirochetes in termite guts are clearly polyphyletic. Since members of Breznakiellaceae are generally small and possess only two periplasmic flagella [ 12 ], we hypothesize that an increased cell size, flagellar multiplication, and other traits (sillon, decorations of outer and cytoplasmic membranes) must have developed independently and more than once during the evolutionary radiation of the family. This notion is corroborated by the epibiotic spirochetes attached to the gut flagellate Mixotricha paradoxa of Mastotermes darwiniensis . Here, a smaller, more abundant morphotype, which is responsible for the motility of the flagellate, has only two flagella [ 38 ]. It was recently described as Propulsinema mixotrichae , and its genome has been sequenced [ 39 ]. By contrast, the less abundant forms colonizing the posterior region of the host cell have multiple flagella that are arranged in a single row [ 38 ]. Based on their unique morphology, they have been described as “ Canaleparolina darwiniensis ” and were assigned to the “ Pillotinaceae ” even though they are considerably smaller than other species of the family [ 35 ]. However, molecular identification revealed that all ectosymbiotic spirochetes of M. paradoxa are closely related [ 40 ] and fall into a monophyletic clade of Breznakiellaceae (cluster M) that occurs exclusively in Mastotermes darwiniensis (Additional File 1: Fig. S1). Another example that supports the independent origin of larger cells with multiple flagella within the family is Helmutkoeniga isoptericolens from Incisitermes tabogae , which possesses eight periplasmic flagella and is significantly larger than all other isolates of Breznakiellaceae [ 41 ], but is only distantly related to the other lineages of large spirochetes (Fig. 1 ). Moreover, large pillotinaceous spirochetes were observed only in termites and Cryptocercus and are conspicuously absent also from amplicon libraries of other xylophagous insects. Functional role of large spirochetes For a long time, the functional role of spirochetes in termite guts was entirely obscure. Since the isolation of Treponema primitia , the first cultured termite gut spirochete and the first homoacetogenic representative of the phylum Spirochaetota [ 42 – 45 ], evidence has accumulated that spirochetes are responsible for the high activities of reductive acetogenesis in termite guts (reviewed by [ 4 , 14 ]). However, most isolates of the Breznakiellaceae possess a fermentative metabolism, and the ability to reduce CO 2 to acetate was most likely acquired by horizontal gene transfer [ 46 ]. It is therefore significant that the genomes of Hollandina grandis and Hollandinoides gharagozlouae encode the complete set of enzymes for an operational WLP (Fig. 7 B, C), which indicates the capacity for reductive acetogenesis and the ability to grow homoacetogenically on sugars. Comparative genome analysis of the available metagenome-assembled genomes (MAGs) and SAGs shows that the WLP is likely a common trait to all Hollandina species. For Hollandinoides , the picture is less clear, as only a few representatives contain the complete WLP (Fig. 8 ). However, many MAGs of Hollandinoides encode the HDCR complex, the key enzyme of reductive acetogenesis in spirochetes, suggesting that the apparent gaps in the pathway are caused by their incomplete genomes (Fig. 8 ). By contrast, all members of the genera Pillotina and JAISNI01 lack key enzymes of the WLP (e.g., HDCR and CODH/ACS) and must grow fermentatively on sugars, forming acetate as the oxidized and H 2 (and possibly lactate) as the reduced fermentation products (Figs. 7 and 8 ). The fermentative metabolism of Pillotina spp. will yield less ATP than the homoacetogenic metabolism of Hollandina and Hollandinoides spp., and hydrogen formation by an electron-confurcating hydrogenase may render the fermentative species sensitive to high H 2 partial pressures [ 47 ]. Fig. 8. Open in a new tab Key enzymes of energy metabolism encoded by MAGs and SAGs in the four genus-level lineages of pillotinaceous spirochetes. Newly sequenced genomes are marked in bold. GH abundance is for secreted enzymes. The phylogenetic tree is schematic and not drawn to scale. Genome completeness is calculated using CheckM2 The spectrum of potential substrates differs between the three genera (Fig. 8 ). While members of all genera possess the capacity to degrade chitin, the genomes of Pillotina and Hollandinoides species encode several GHs with secretion signals that are most likely involved in the extracellular degradation of hemicelluloses. Moreover, all members of the genus Pillotina encode a secreted GH5 endoglucanase involved in cellulose degradation; it is absent from the other lineages. By contrast, the genomes of Hollandina and Hollandinoides species encode several secreted β-glucosidases that might be involved in the degradation of sugar oligomers. Generally, Pillotina and Hollandinoides spp. encode more GHs than Hollandina (Fig. 8 ) . Also the non-secreted GHs, which are mostly involved in the intracellular degradation of oligomeric sugars, are twice as abundant in P. corrugata and Hollandinoides gharagozlouae than in H. grandis (Additional File 2: Table S1, S2, and S3) . The situation is similar among the ABC transporters for monomeric and oligomeric sugars (Fig. 7 ), with the highest number encoded in the genome of Hollandinoides gharagozlouae (34 transporters). A large number of ABC transporters in termite gut spirochetes had already been noticed in a broad genomic analysis of the transport proteins in treponemes [ 48 ]. The presence of ABC transporters translocating various pentoses corroborates that termite gut spirochetes generally use pentoses as substrates [ 41 , 42 , 47 ]. All species encode several ABC transporters for aldouronates. One of the transporters in P. corrugata might be involved in the translocation of aldouronates that result from methylglucuronoxylan depolymerization by the secreted endoxylanase (GH10) (Additional File 2: Table S4). Although not all genes are clustered in an operon, the subsequent intracellular metabolism of aldouronates proceeds via a pathway described in Paenibacillus [ 49 , 50 ]. In H. grandis , we identified a gene cluster encoding an aldouronate-like ABC transporter and an unsaturated rhamnogalacturonyl hydrolase (GH105) that resembles an operon in Bacillus subtilis involved in the degradation of unsaturated rhamnogalacturonan [ 51 ]. In the genome of Hollandinoides gharagozlouae , we detected several ABC transporters for rhamnose and pectin oligosaccharides. The capacity to metabolize rhamnose is present in both H. grandis and Hollandinoides gharagozlouae and seems to proceed via a non-conventional pathway . Both genomes lack a typical rhamnulokinase ( rhaB) but encode a sugar kinase ( rhaK ) similar to a homolog in Rhizobium leguminosarum , which requires interaction with the corresponding ABC transporter to phosphorylate rhamnose [ 52 ]. Like Breznakiella homolactica , Leadbettera azotonutricia, and “ Termitinema ” [ Treponema ] primitia , also the species investigated in this study possess the entire pathway for the conversion of N -acetyl-glucosamine (GlcNAc) to Fru6P but lack a GlcNAc kinase ( nagK ), indicating that GlcNAc metabolism in Breznakiellaceae involves an alternative pathway for GlcNAc phosphorylation. A deletion of the nagK gene in Escherichia coli does not lead to an accumulation of GlcNAc [ 53 ]. Compared to other members of the termite gut microbiota, the number of GHs putatively involved in the breakdown of cellulose and hemicellulose in the genomes of Pillotina, Hollandina, and Hollandinoides spp . is rather small, which agrees with the concept that the spirochetes in lower termites play no major role in the depolymerization of plant fiber [ 6 , 54 ]. However, the high abundance of ABC transporters for the uptake of monomeric and oligomeric products of fiber digestion suggests that Pillotina and Hollandinoides spp. are specialized on the metabolism of sugars and dextrins produced by (hemi)cellulolytic flagellates and other gut microbiota. The presence of a WLP and a functional type-III nitrogenase in H. grandis , which combines the metabolic capacities of “ Termitinema ” [ Treponema ] primitia for reductive acetogenesis [ 43 , 44 ] and Leadbettera azotonutricia for dinitrogen fixation [ 42 , 55 ], indicates adaptations to the hydrogen-rich gut microenvironment and nitrogen-poor diet of wood-feeding termites [ 4 ]. Taxonomy Pillotina calotermitidis and Hollandina pterotermitidis have been described in morphological studies of termite-gut spirochetes [ 8 , 21 ]. Since the names were not included in the Approved Lists of Bacterial Names [ 56 ], they had no standing in nomenclature [Rule 24a, International Code of Nomenclature of Prokaryotes (ICNP); [ 57 ]]. However, a few years later, the names were revived and validly published in the International Journal of Systematic and Evolutionary Microbiology based on type-descriptive material [ 7 ]. The same applies to the species descriptions of Diplocalyx calotermitidis and Clevelandina reticulitermitidis [ 7 , 20 ]. Subsequent species descriptions of other large termite-gut spirochetes (“ Diplocalyx cryptotermitidis” and “ Canaleparolina darwiniensis” ; [ 35 ]) were published after January 1, 1980 and—in the absence of type strains—these names are not validly published under the rules of the ICNP. The classification of the genera Clevelandina , Diplocalyx , Hollandina , and Pillotina in the family “ Pillotinaceae ” [ 8 , 22 ] was superseded by their placement in the family Spirochaetaceae [ 58 ]. Although the latter study acknowledged the lack of 16S rRNA gene sequence data for all representatives of these taxa, a rationale for this placement and the rejection of the family “ Pillotinaceae ” was not provided. In the present study, we identified three phylogenetic clades of large spirochetes with the morphology of Pillotina and Hollandina spp. from several lower termites. Using high-quality genome sequences obtained from single cells as type material, we describe Pillotina corrugata sp. nov. from K. flavicollis, Hollandina grandis sp. nov. from I. tabogae, and Hollandinoides gharagozlouae gen. nov., sp. nov. from R. flavipes under the rules of SeqCode [ 27 ]. The protologues can be found in the supplementary material (Additional File 3: Table S7). In addition, we propose reassigning members of the genera Pillotina and Hollandina that are currently assigned to Spirochaetaceae to the family Breznakiellaceae . While it is very likely that also members of Clevelandina , Diplocalyx , and “ Canaleparolina ” are members of Breznakiellaceae , their formal reassignment should be postponed until they have been firmly assigned to specific phylotypes with sequenced genomes. Breznakiellaceae Brune et al. 2022 emend. Treitli and Brune The description remains the same as that in Brune et al. (2022), with the following amendments: Large forms are up to 100 μm long and 0.4–1.5 μm in diameter and possess 15–100 flagella. GC content is 43.2–52.9 mol% (based on sequenced genomes). In addition to the genera Breznakiella , Gracilinema , Helmutkoenigia , Leadbettera, and Zuelzera , the family also comprises the newly described genus Hollandinoides and the genera Pillotina and Hollandina , which were previously classified in the families “ Pillotinaceae ” and Spirochaetaceae . Parent taxon: “ Treponematales”. Pillotina (ex Hollande and Gharagozlou 1968) Bermudes et al. 1988 emend. Treitli and Brune Pillotina (Pil.lo.ti'na. M.L. fem. n. Pillotina , in honor of J. Pillot, a French microbiologist). Helical cells are 0.6–1.5 μm in diameter. Transverse sections show a stellate profile with approximately 30–100 flagella distributed throughout the periplasmic space. The outer membrane is crenulated (pleated or folded) and has an underlying electron-dense layer. One of the grooves is in contact with the cytoplasmic cylinder, forming the sillon. They are anaerobes with a strictly fermentative metabolism (based on genome analysis of P. corrugata ). Members of the genus are defined by phylogenomic analysis as a monophyletic group that shows a relative evolutionary divergence (RED) similar to that of the neighboring genera. The description of the type species is based on a morphotype from the termite Postelectrotermes praecox . The only species with a sequenced genome is Pillotina corrugata . Type species: Pillotina calotermitidis. Parent taxon: Breznakiellaceae . Pillotina corrugata sp. nov. Treitli and Brune Pillotina corrugata (cor.ru.ga'ta). L. fem. part. adj. corrugata , wrinkled, corrugated. Helical cells are 0.9–1.2 µm in diameter, with 26–30 parallel ridges. The length varies between 40 and 90 µm. Approx. 70–100 periplasmic flagella. The protoplasmic cylinder is 0.4–0.5 µm in diameter. Members of this species colonize the hindgut of the genus Kalotermes . They can be detected with the 16S rRNA-targeted oligonucleotide probe Kf-Pil-1449 (5′-GCAGCGCCCTCCTTTTACAA-3′). The type genome is from Kalotermes flavicollis . Includes all genomes that show ≥ 95% average nucleotide identity (ANI) to the genome of the type strain. The type strain has an estimated genome size of 3.14 Mbp and a GC content of 43.2 mol%. Type genome: KfSPG140; JBQMQA000000000 , PX098836 (16S rRNA gene). Hollandina (ex To et al. 1978) Bermudes et al. 1988 emend. Treitli and Brune Hollandina (Hol.lan.di'na. M.L. fem. n. Hollandina , in honor of André Hollande, Jr., a French protistologist). Helical cells are rounded to oblong in cross sections, with a diameter of 0.4–0.9 µm at the widest point. Cells have 15–80 flagella distributed in the periplasmic space. The outer membrane is smooth and decorated with a thick external coat, in some cases forming a sillon. In cross sections, the outer membrane is in close proximity to the cytoplasmic membrane over about half of its circumference, restricting the distribution of the flagella to the remaining periplasmic space. Anaerobes with a fermentative metabolism (based on genome analysis of H. grandis ). The genus is defined by phylogenomic analysis as a monophyletic group that shows a relative evolutionary divergence (RED) similar to that of the neighboring genera. Members of the genus occur in termites of the family Kalotermitidae. The description of the type species is based on a morphotype from the termite Pterotermes occidentis . The only species with a sequenced genome is Hollandina grandis . Type species: Hollandina pterotermitidis. Parent taxon: Breznakiellaceae . Hollandina grandis sp. nov. Treitli and Brune Hollandina grandis (gran'dis). L. fem. adj. grandis , large. Helical cells are rounded to oblong in cross sections, with a diameter of 0.5–0.7 µm at the widest point. The length varies between 30 and 80 µm. Approx. 70–80 periplasmic flagella. The rounded protoplasmic cylinder is 0.4–0.5 µm in diameter. Members of this species colonize the hindgut of the genus Incisitermes . They can be detected with the 16S rRNA-targeted oligonucleotide probe It-Hol-183 (5′-CCATGCCACAGCACGATAAG-3′). The type genome is from the hindgut of the termite Incisitermes tabogae . Includes all genomes that show ≥ 95% average nucleotide identity (ANI) to the type genome. The type genome has an estimated size of 3.72 Mbp and a GC content of 49.1 mol%. Type genome: ItSP2; JBQLJB000000000 ; PX098833 (16S rRNA gene). “ Candidatus Hollandina kalotermitidis” sp. nov. Treitli and Brune Candidatus Hollandina kalotermitidis (ka.lo.ter.mi'ti.dis) M.L. gen. n. kalotermitidis , of Kalotermes , a genus of termites. Helical cells are rounded to oblong in cross section, with a diameter of 0.7–0.8 µm at the widest point. The length varies between 20 and 50 µm. Approx. 40–60 periplasmic flagella. The rounded protoplasmic cylinder is 0.5–0.6 µm in diameter. Members of this species are present in Kalotermes flavicollis and K. italicus . They can be detected with the 16S rRNA-targeted oligonucleotide probe Kf-Hol-193 (5′-GAGCCACAGCCCCTTTCCT-3′). Type material is picked from cells of K. flavicollis ( PX098799 ; 16S rRNA gene). Hollandinoides gen. nov. Treitli and Brune Hollandinoides (Hol.lan.di.no'i.des. N.L. neut. n. Hollandina , a genus of spirochetes; L. neut. suff. -oides , -like, similar; N.L. neut. n. Hollandinoides , a Hollandina -like genus). The description is the same as that of the type species . Type species: Hollandinoides gharagozlouae. Parent taxon : Breznakiellaceae. Hollandinoides gharagozlouae sp. nov. Treitli and Brune Hollandinoides gharagozlouae (gha.ra.goz'lou.ae). N.L. gen. fem. n. gharagozlouae , in honor of Iran Dokht Gharagozlou, an Iranian/French structural biologist. Large helical cells that colonize the hindgut of the termite Reticulitermes flavipes . They can be detected with the 16S rRNA-targeted oligonucleotide probe Rf-HolD1-990 (5'-GGCTTCCCCACTATGTCAAA-3'). The type genome is from the hindgut of the termite Reticulitermes flavipes . The species is most likely represented by one of the two Hollandina -like morphotypes present in this host species. Includes all genomes that show ≥ 95% average nucleotide identity (ANI) to the type genome. The type genome has an estimated size of 4.02 Mbp and a GC content of 47 mol%. Type genome: RfSP5; JBUAPY000000000 ; PX098808 (16S rRNA gene). Conclusions Using single-cell techniques, we provide the first insights into the evolutionary relationships and metabolic functions of the large spirochetes in termite guts. Phylogenetic analysis shows that “ Pillotinaceae ” are not a separate family of spirochetes but represent several distinct lineages in the family Breznakiellaceae . The polyphyletic nature of these lineages suggests that an increased cell size and flagellar multiplication are convergent traits that evolved several times within the family. Comparative analysis of the single-cell genomes of P. corrugata , H. grandis , and Hollandinoides gharagozlouae documents differences in their metabolic potential, indicating that the large spirochetes in termite guts have distinct roles in symbiotic digestion. Methods Sample preparation for FISH Kalotermes flavicollis , Incisitermes aff. schwarzi, and Reticulitermes flavipes were from cultures maintained at the Federal Institute for Materials Research and Testing (BAM), Berlin, Germany. Kalotermes italicus was collected in Tuscany, Italy. Incisitermes tabogae was collected in Guadeloupe, French West Indies. To remove most autofluorescent wood particles from the hindgut, several worker termites were placed on cellulose powder for one week prior to dissection [ 59 ]. Afterwards, the workers were dissected and the entire hindgut was placed in solution U [ 60 ] and opened with fine-tipped tweezers. The gut content was mixed with three volumes of ice-cold 4% formaldehyde, and fixed on ice for 6 h. After fixation, cells were pelleted at three different speeds. The large protist cells were pelleted at 50 × g for 3 min. The supernatant from this centrifugation was transferred to a new tube and centrifuged at 1000 × g for 10 min at 4 °C. The supernatant from the second centrifugation was transferred to a new tube and centrifuged at 6000 × g for 5 min at 4 °C. This technique allows harvesting of most of the intestinal community without breaking the cells. The pellets resulting from the centrifugations were washed three times with solution U. After the final wash, each pellet was resuspended in solution U, mixed with an equal volume of ethanol, and stored at − 20 °C. Samples sedimented by centrifugation at 1000 × g and 6000 × g were used for FISH. Probe design for 16S rRNA FISH The 16S rRNA gene sequences obtained by PCR as well as the homologs identified in our sequenced single-cell genomes were imported into an in-house database of bacterial 16S rRNA genes, which is based on the phylogenetic framework of Silva v.138.1 [ 61 ] and includes sequences extracted from metagenomic libraries and MAGs and previously unpublished clone libraries and long-read amplicon libraries of arthropod gut microbiota obtained in our laboratory [ 62 ] (Additional File 2: Table S8). For probe design, we used ARB v. 7.1 [ 63 ] ( http://www.arb-home.de ). The probes suggested by ARB were checked for accessibility based on the Escherichia coli 16S rRNA gene accessibility map [ 64 ]. The selected probes were synthesized and fluorescently labeled at their 5′ end with either CY3 or various ATTO dyes by Eurofins Genomics (Germany). Probe sequences and their optimal formamide concentrations are listed in Table 1 . Fluorescence in situ hybridization Samples for FISH were prepared according to the protocol described in [ 65 ]. Hybridizations were carried out at 46 °C for 6 h with 30% formamide, unless the probes required lower concentration (Table 1 ). Slides were mounted with Vectashield mounting medium with DAPI (H-1200, Vector Laboratories). Images were acquired using a Leica SP8 confocal microscope, deconvolved using Huygens Essential v17.04 (Scientific Volume Imaging), and further processed using ImageJ 1.53n ( https://imagej.net ). Single-cell picking and whole genome amplification For single-cell picking, the gut of a worker termite was removed and opened in solution U, and aliquots (10 µl) were transferred into the wells of a Teflon-coated microscope slide (1216690, Marienfeld). Large spirochetes were identified by morphology using an inverted phase-contrast microscope (Zeiss AxioVert A1) at 400-fold magnification and isolated with a PatchMan NP2 micromanipulator (Eppendorf) equipped with a 15-µm capillary. Individual cells were washed twice in solution U and then transferred to a 0.2-ml PCR tube containing 0.9 µl of solution U. Whole genome amplification (WGA) was performed using the Repli-G Single Cell Kit (150343, QIAGEN) with 30% of the recommended reaction volume and adding SYBR green to a final concentration of 1 µM. Briefly, 0.9 µl of lysis buffer was added to the picked cells, and the reaction was incubated for 10 min on ice. Then the lysis was stopped by adding 0.9 µl of stop solution. To the isolated DNA, 8.7 µl of reaction buffer, 0.6 µl of polymerase, 1.5 µl of 10 µM SYBR green solution, and 1.2 µl of water were added. The tubes were incubated at 30 °C in a CFX Connect real-time PCR cycler (Bio-Rad), with fluorescence readings every 5 min. After the amplification reactions reached a plateau, the samples were further incubated at 30 °C for 50 min, and then the reactions were stopped by incubating the samples at 65 °C for 10 min. The whole-genome-amplified DNA was purified by ethanol precipitation, and DNA concentration was measured using Qbit dsDNA Quantitation, Broad Range Kit ( Q32853 , ThermoFisher). Amplification of 16S rRNA gene sequences 16S rRNA genes were amplified using the universal bacterial primers 9/27F and 1492R [ 66 ] in 50 µL reactions using PrimeSTAR Max DNA polymerase premix (R045A, Takara Bio). The PCR conditions were set according to the manufacturer’s recommendations, with an annealing temperature of 60 °C for 15 s and extension at 72 °C for 30 s. The amplification products were purified using the Bio-On-Magnetic-Beads (BOMB) platform protocols [ 67 ] and sequenced in both directions at Eurofins Genomics (Germany). Electron microscopy For each species, the guts of 10 worker termites were removed and opened in a fixative containing 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer (pH 7.1). The gut contents were centrifuged at 50 × g for 3 min in a swing-out rotor (Eppendorf) to remove most of the termite gut flagellates. The supernatant was transferred to a new tube and centrifuged at 10,000 × g for 5 min . After removing the supernatant, the pellet was washed three times with 0.1 M cacodylate buffer, postfixed in 1% OsO 4 for 1 h, washed three times with 0.1 M cacodylate buffer, dehydrated in an ethanol series (30%, 50%, 70%, 90%; 4 times 100%; 15 min each), and embedded in Spurr’s resin [ 68 ]. Ultrathin sections were cut with a Reichert Ultracut E ultramicrotome. The sections were stained with saturated uranyl acetate and lead citrate [ 69 ] and examined with a FEI CM120 BioTwin electron microscope (FEI) or a FEI Tecnai Spirit Twin 120 kV (FEI). Genome sequencing, assembly, and binning The WGA products from isolated Pillotina cells were sequenced at Novogene (Germany), using an Illumina NovaSeq 6000 platform with 2 × 150 bp reads. The WGA products from isolated Hollandina cells were sequenced at the Göttingen Genomics Laboratory, Institute of Microbiology and Genetics, Georg August University, Göttingen using an Illumina MiSeq platform with 2 × 300 bp reads. The WGA products from isolated cells from R. flavipes were sequenced at the Biocev Core Facility (OMICS-Genomics, Biocev, Vestec, Czech Republic) using an Illumina MiSeq platform with 2 × 250 bp reads. Raw sequencing reads were adapter-trimmed and quality-trimmed using Fastp [ 70 ] with a quality threshold of 15. Each individual single-cell genome was assembled using SPAdes 3.15.5 [ 71 ] with the –sc parameter. The 16S rRNA gene sequences of each dataset were extracted, and samples with identical 16S rRNA gene sequences were grouped and co-assembled with SPAdes. Scaffolds longer than 2500 bp were binned using tetraESOM [ 72 ]. The resulting bins were checked for contamination using blastn and blastp; sequences with significant hits to other bacteria were removed. The final bins were reassembled using SPAdes by mapping back the Illumina reads using BBMap and discarding any unmapped reads. After reassembly, fragments less than 1000 bp were removed, and the genome was checked again for potential contamination using a combination of blastn and blastp. Genome completeness estimation and annotation Genome completeness was estimated using both CheckM [ 73 ] and CheckM2 [ 74 ]. Genomes were predicted and annotated using Prokka 1.14.6 [ 75 ]. Annotations were further refined using BlastKOALA [ 76 ] and KofamKOALA [ 77 ]. For the annotation of carbohydrate-active enzymes (CAZymes), we used the dbCAN3 server for Hidden Markov model (HMM) searches and DIAMOND blast searches [ 78 ] against the dbCAN3 database [ 79 ]. For all pathways of interest, the annotation was manually curated. Comparative genomics A total of 29 MAGs and SAGs were selected for comparative genomics. The predicted protein sequences from all the genomes were downloaded from NCBI and clustered into orthogroups using OrthoFinder2 [ 80 ]. The obtained hierarchical orthogroups (HOGs) were used for further annotation. The annotated genes from Hollandina and Pillotina were used as seeds to identify the HOGs with specific functions. For the identification of genes involved in nitrogen fixation, we identified each gene by blastp and checked the operon structure to make sure that all genes are present in a functional operon. For the annotation of carbohydrate-active enzymes (CAZymes), we used dbCAN3 with SignalP v4.1 [ 81 ]. Phylogenetic analyses The 16S rRNA gene sequences obtained in this study were imported into the same in-house database as that used for probe design (see above). Sequences were aligned using the SINA aligner [ 82 ] and ARB software package version 7.1 [ 63 ]. After dereplication, alignment, and filtering, the final dataset of Spirochaetota contained 513 sequences with 1,470 alignment positions. It was used to compute a maximum-likelihood (ML) tree with IQ-TREE 3.0.1 [ 83 ] and the GTR + G + F + I model. Branch support was assessed using SH-aLRT and 10,000 ultrafast bootstrap replicates. The dataset for phylogenomic analysis was created using GTDB-Tk [ 84 ] with the GTDB database version 220 [ 85 ]. The phylogenomic tree was inferred using IQ-TREE 3.01 with the Posterior Mean Site Frequency (PMSF) empirical model [ 86 ] and an LG + F + G guide tree. Branch support was estimated using SH-aLRT and 10,000 ultrafast bootstrap replicates. Supplementary Information 12915_2026_2591_MOESM1_ESM.pdf (201.4KB, pdf) Additiopnal file 1. Supplementary figures S1-S2. Fig. S1 – Expanded 16S rRNA gene-based maximum-likelihood (ML) tree of the phylum Spirochatetota . Fig. S2 – Phylogeny of the Kalotermes termites based on cytochrome-c oxidase subunit II. 12915_2026_2591_MOESM2_ESM.xlsx (312.3KB, xlsx) Additional file 2. Supplementary tables S1-S6, S8. Table S1 – Glycoside hydrolase families identified in the genome of Pillotina corrugata . Table S2 – Glycoside hydrolase families identified in the genome of Hollandina grandis . Table S3 – Glycoside hydrolase families identified in the genome of Hollandinoides gharagozlouae . Table S4 – Gene annotation list for Pillotina corrugata . Table S5 – Gene annotation list for Hollandina grandis . Table S6 – Gene annotation list for Hollandinoides gharagozlouae .  Table S8 – 16S rRNA gene libraries inspected for the presence of Breznakiellaceae , with the accession numbers for the identified Breznakiellaceae sequences . 12915_2026_2591_MOESM3_ESM.pdf (300.7KB, pdf) Additional file 3. Supplementary table S7. Table S7 – Protologues for the new species described under SeqCode. Acknowledgements We thank Anja Poehlein from Göttingen Genomics Laboratory, Institute of Microbiology and Genetics, Georg August University, for sequencing the whole-genome amplification products of Hollandina grandis and Blanka Hamplová and Štěpánka Hrdá from OMICS-Genomics core facility, Biocev for the sequencing of the RfSP5 and RfSP9 SAGs. We would also like to thank Beatrix Fauler from the Max Planck Institute for Molecular Genetics (MPI-MG) for support in electron microscopy. Abbreviations EM Electron microscopy FISH Fluorescence in situ hybridization GH Glycosyl hydrolases SAG Single-cell amplified genome SCA Single-cell amplicon WGA Whole-genome amplification WLP Wood–Ljungdahl pathway Authors’ contributions **SCT** picked single cells, performed whole genome amplification and fluorescence *in situ* hybridization, assembled and annotated the genomes, prepared figures, and wrote the manuscript. **USM** performed the phylogenomic analysis, supervised students, and prepared figures. **RR** prepared and analyzed the electron microscopy samples. **PAZ** picked single cells, performed whole genome amplification and fluorescence *in situ* hybridization. **JMKS** analyzed amplicon sequencing data. **LR** and **NAR** picked single cells and performed whole genome amplification. **KP** picked single cells, performed whole genome amplification, and supervised students. **VH, RP,** and **MM** provided termites. **AB** acquired funding, designed and supervised the study, analyzed data, prepared figures, and wrote the manuscript. All authors have read and approved the submitted version of the manuscript. Funding Open Access funding enabled and organized by Projekt DEAL. This work was supported by the Max Planck Society (MPG). SCT received a Humboldt Research Fellowship from the Alexander von Humboldt Foundation. USM and JMKS received scholarships from the International Max Planck Research School ‘Principles of Microbial Life: From molecules to cells, from cells to interactions’. Data availability The sequence data have been deposited at the National Center for Biotechnology Information (NCBI) in GenBank ( https://www.ncbi.nlm.nih.gov/genbank ) under NCBI BioProject PRJNA1301810. The scaffolds assigned to the draft genomes of Pillotina corrugata , Hollandina grandis , and Hollandinoides gharagozlouae have been deposited at GenBank under the accession nos. JBQMQA000000000 , JBQLJB000000000 , and JBUAPY000000000 , respectively). The genome assembly of the RfSP9 SAG was deposited at GenBank under the accession number JBTZSX000000000 . Newly obtained 16S rRNA gene sequences are available in GenBank under accession numbers PX098795–PX098819 , and PX098832–PX098836 . Declarations Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Competing interests The authors declare no competing interests. Footnotes Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. References 1. Breznak JA, Leadbetter JR. Termite gut spirochetes. In: Dworkin M, Falkow S, Rosenberg E, Schleifer K-H, Stackebrandt E, editors. The Prokaryotes: Volume 7: Proteobacteria: Delta, Epsilon Subclass. New York: Springer; 2006;318–29. 10.1007/0-387-30747-8_11. 2. Brune A, Dietrich C. The gut microbiota of termites: digesting the diversity in the light of ecology and evolution. Annu Rev Microbiol. 2015;69:145–66. 10.1146/annurev-micro-092412-155715. [ DOI ] [ PubMed ] [ Google Scholar ] 3. Ohkuma M. Symbioses of flagellates and prokaryotes in the gut of lower termites. Trends Microbiol. 2008;16:345–52. 10.1016/j.tim.2008.04.004. [ DOI ] [ PubMed ] [ Google Scholar ] 4. Brune A. Symbiotic digestion of lignocellulose in termite guts. Nat Rev Microbiol. 2014;12:168–80. 10.1038/nrmicro3182. [ DOI ] [ PubMed ] [ Google Scholar ] 5. Hervé V, Liu P, Dietrich C, Sillam-Dussès D, Stiblik P, Šobotník J, et al. Phylogenomic analysis of 589 metagenome-assembled genomes encompassing all major prokaryotic lineages from the gut of higher termites. PeerJ. 2020;2020:e8614. 10.7717/PEERJ.8614/SUPP-20. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 6. Tokuda G, Mikaelyan A, Fukui C, Matsuura Y, Watanabe H, Fujishima M, et al. Fiber-associated spirochetes are major agents of hemicellulose degradation in the hindgut of wood-feeding higher termites. Proc Natl Acad Sci U S A. 2018;115:E11996. 10.1073/pnas.1810550115. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 7. Bermudes D, Chase D, Margulis L. Morphology as a basis for taxonomy of large spirochetes symbiotic in wood-eating cockroaches and termites: Pillotina gen. nov., nom. rev.; Pillotina calotermitidis sp. nov., nom. rev.; Diplocalyx gen. nov., nom. rev.; Diplocalyx calotermitidis sp. nov., nom. rev.; Hollandina gen. nov., nom. rev.; Hollandina pterotermitidis sp. nov., nom. rev.; and Clevelandina reticulitermitidis gen. nov., sp. nov. Int J Syst Evol Microbiol. 1988;38:291–302. 10.1099/00207713-38-3-291. [ DOI ] [ PubMed ] [ Google Scholar ] 8. Hollande A, Gharagozlou I. Morphologie infrastructurale de Pillotina calotermitidis nov. gen., nov. sp., Spirochaetale de l’intestin de Calotermes praecox . Comptes Rendus Hebd Seances Acad Sci Ser Sci Nat. 1967;265:1309–12. [ PubMed ] [ Google Scholar ] 9. Paster BJ, Breznak JA. Hindgut spirochetes of termites and Cryptocercus punctulatus . In: Trujillo ME, Dedysh S, DeVos P, Hedlund B, Kämpfer K, Rainey FA, editors. Bergey’s manual of systematics of Archaea and Bacteria. John Wiley & Sons, Ltd; 2015. p. 1–5. 10.1002/9781118960608.fbm00242. 10. Lilburn TG, Schmidt TM, Breznak JA. Phylogenetic diversity of termite gut spirochaetes. Environ Microbiol. 1999;1:331–45. 10.1046/j.1462-2920.1999.00043.x. [ DOI ] [ PubMed ] [ Google Scholar ] 11. Ohkuma M, Iida T, Kudo T. Phylogenetic relationships of symbiotic spirochetes in the gut of diverse termites. FEMS Microbiol Lett. 1999;181:123–9. 10.1111/j.1574-6968.1999.tb08834.x. [ DOI ] [ PubMed ] [ Google Scholar ] 12. Brune A, Song Y, Oren A, Paster BJ. A new family for ‘termite gut treponemes’: description of Breznakiellaceae fam. nov., Gracilinema caldarium gen. nov., comb. nov., Leadbettera azotonutricia gen. nov., comb. nov., Helmutkoenigia isoptericolens gen. nov., comb. nov., and Zuelzera stenostrepta gen. nov., comb. nov., and proposal of Rectinemataceae fam. nov. Int J Syst Evol Microbiol. 2022;72:005439. 10.1099/ijsem.0.005439. [ DOI ] [ PubMed ] [ Google Scholar ] 13. Noda S, Shimizu D, Yuki M, Kitade O, Ohkuma M. Host-symbiont cospeciation of termite-gut cellulolytic protists of the genera Teranympha and Eucomonympha and their Treponema endosymbionts. Microbes Environ. 2018;33:26–33. 10.1264/jsme2.ME17096. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 14. Ohkuma M, Noda S, Hattori S, Iida T, Yuki M, Starns D, et al. Acetogenesis from H 2 plus CO 2 and nitrogen fixation by an endosymbiotic spirochete of a termite-gut cellulolytic protist. Proc Natl Acad Sci U S A. 2015;112:10224–30. 10.1073/pnas.1423979112. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 15. Mies US, Hervé V, Kropp T, Platt K, Sillam-Dussès D, Šobotník J, et al. Genome reduction and horizontal gene transfer in the evolution of Endomicrobia —rise and fall of an intracellular symbiosis with termite gut flagellates. mBio. 2024;15:e00826-24. 10.1128/mbio.00826-24. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 16. Dröge S, Fröhlich J, Radek R, König H. Spirochaeta coccoides sp. nov., a novel coccoid spirochete from the hindgut of the termite Neotermes castaneus . Appl Environ Microbiol. 2006;72:392–7. 10.1128/AEM.72.1.392-397.2006. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 17. Sravanthi T, Tushar L, Sasikala C, Ramana C. Alkalispirochaeta cellulosivorans gen. nov., sp. nov., a cellulose-hydrolysing, alkaliphilic, halotolerant bacterium isolated from the gut of a wood-eating cockroach ( Cryptocercus punctulatus ), and reclassification of four species of Spirochaeta as new combinations within Alkalispirochaeta gen. nov. Int J Syst Evol Microbiol. 2016;66:1612–9. 10.1099/ijsem.0.000865. [ DOI ] [ PubMed ] [ Google Scholar ] 18. Leidy J. On intestinal parasites of Termes flavipes . Proc Acad Nat Sci Phila. 1877;29:146–9. [ Google Scholar ] 19. Leidy J. The parasites of the termites. J Acad Nat Sci Phila. 1881;VIII:425–47. [ Google Scholar ] 20. Gharagozlou ID. Aspect infrastructural de Diplocalyx calotermitidis nov. gen. nov. sp., Spirochaetale de l’intestin de Calotermes flavicollis . Comptes Rendus Hebd Seances Acad Sci Ser Sci Nat. 1968;266:494–6. [ PubMed ] [ Google Scholar ] 21. To L, Margulis L, Cheung AT. Pillotinas and hollandinas: distribution and behaviour of large spirochaetes symbiotic in termites. Microbios. 1978;22:103–33. [ PubMed ] [ Google Scholar ] 22. Margulis L, Hinkle G. Large symbiotic spirochetes: Clevelandina , Cristispira , Diplocalyx , Hollandina , and Pillotina . In: Balows A, Trüper HG, Dworkin M, Harder W, Schleifer K-H, editors. The prokaryotes: a handbook on the biology of bacteria: ecophysiology, isolation, identification, applications. New York, NY: Springer; 1992;3965–78. 10.1007/978-1-4757-2191-1_59. 23. Leschine S, Paster BJ, Canale-Parola E. Free-living saccharolytic spirochetes: the genus Spirochaeta . In: Dworkin M, Falkow S, Rosenberg E, Schleifer K-H, Stackebrandt E, editors. The prokaryotes: Volume 7: Proteobacteria: Delta, Epsilon Subclass. New York, NY: Springer; 2006;195–210. 10.1007/0-387-30747-8_7. 24. Nakamura S. Spirochete flagella and motility. Biomolecules. 2020;10:550. 10.3390/biom10040550. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 25. Aoki H, Masahiro Y, Shimizu M, Hongoh Y, Ohkuma M, Yamagata Y. Agarose gel microcapsules enable easy-to-prepare, picolitre-scale, single-cell genomics, yielding high-coverage genome sequences. Sci Rep. 2022;12:17014. 10.1038/s41598-022-20923-z. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 26. Arora J, Kinjo Y, Šobotník J, Buček A, Clitheroe C, Stiblik P, et al. The functional evolution of termite gut microbiota. Microbiome. 2022;10:78. 10.1186/s40168-022-01258-3. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 27. Hedlund BP, Chuvochina M, Hugenholtz P, Konstantinidis KT, Murray AE, Palmer M, et al. SeqCode: a nomenclatural code for prokaryotes described from sequence data. Nat Microbiol. 2022;7:1702–8. 10.1038/s41564-022-01214-9. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 28. Margulis L, To LP, Chase DG. The genera Pillotina , Hollandina , and Diplocalyx . In: Starr MP, Stolp H, Trüper HG, Balows A, Schlegel HG, editors. The prokaryotes: a handbook on habitats, isolation, and identification of Bacteria. Berlin, Heidelberg: Springer Berlin Heidelberg; 1981;548–54. 10.1007/978-3-662-13187-9_47. 29. Grimstone AV. A note on the fine structure of a spirochaete. J Cell Sci. 1963;s3-104:145–53. 10.1242/jcs.s3-104.65.145. [ Google Scholar ] 30. Breznak JA. Hindgut spirochetes of termites and Cryptocercus punctulatus . In: Krieg NR, Holt JG, editors. Bergey’s manual of systematic bacteriology, vol. 1. Baltimore: Williams & Wilkins; 1984. p. 67–70. [ Google Scholar ] 31. Hongoh Y, Deevong P, Hattori S, Inoue T, Noda S, Noparatnaraporn N, et al. Phylogenetic diversity, localization, and cell morphologies of members of the Candidate phylum TG3 and a subphylum in the phylum Fibrobacteres , recently discovered bacterial groups dominant in termite guts. Appl Environ Microbiol. 2006;72:6780–8. 10.1128/AEM.00891-06. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 32. Ochiai A, Itoh T, Kawamata A, Hashimoto W, Murata K. Plant cell wall degradation by saprophytic Bacillus subtilis strains: gene clusters responsible for rhamnogalacturonan depolymerization. Appl Environ Microbiol. 2007;73:3803–13. 10.1128/AEM.00147-07. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 33. Dos Santos PC, Fang Z, Mason SW, Setubal JC, Dixon R. Distribution of nitrogen fixation and nitrogenase-like sequences amongst microbial genomes. BMC Genomics. 2012;13:162. 10.1186/1471-2164-13-162. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 34. Morimoto Y, Uesaka K, Fujita Y, Yamamoto H. A nitrogenase-like enzyme is involved in the novel anaerobic assimilation pathway of a sulfonate, isethionate, in the photosynthetic bacterium Rhodobacter capsulatus . mSphere. 2024;9:e00498-24. 10.1128/msphere.00498-24. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 35. Wier A, Ashen J, Margulis L. Canaleparolina darwiniensis , gen. nov., sp. nov., and other pillotinaceous spirochetes from insects. Int Microbiol. 2000;3:213–23. [ PubMed ] [ Google Scholar ] 36. Ghesini S, Marini M. A dark-necked drywood termite (Isoptera: Kalotermitidae) in Italy: description of Kalotermes italicus sp. nov. Fla Entomol. 2013;96:200–11. 10.1653/024.096.0127. [ Google Scholar ] 37. Velonà A, Luchetti A, Ghesini S, Marini M, Mantovani B. Mitochondrial and nuclear markers highlight the biodiversity of Kalotermes flavicollis (Fabricius, 1793) (Insecta, Isoptera, Kalotermitidae) in the Mediterranean area. Bull Entomol Res. 2011;101:353–64. 10.1017/S000748531000060X. [ DOI ] [ PubMed ] [ Google Scholar ] 38. Cleveland LR, Grimstone AV. The fine structure of the flagellate Mixotricha paradoxa and its associated micro-organisms. Proc R Soc Lond B Biol Sci. 1964;159:668–86. 10.1098/rspb.1964.0025. [ Google Scholar ] 39. Fu J, Liu Y, Yoshioka T, Igai K, Mabuchi T, Kihara K, et al. Functional division of labor in motility, lignocellulose digestion, and nitrogen metabolism revealed for the Mixotricha paradoxa holobiont. ISME J. 2025;wraf178. 10.1093/ismejo/wraf178. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 40. Wenzel M, Radek R, Brugerolle G, König H. Identification of the ectosymbiotic bacteria of Mixotricha paradoxa involved in movement symbiosis. Eur J Protistol. 2003;39:11–23. 10.1078/0932-4739-00893. [ Google Scholar ] 41. Dröge S, Rachel R, Radek R, König H. Treponema isoptericolens sp. nov., a novel spirochaete from the hindgut of the termite Incisitermes tabogae . Int J Syst Evol Microbiol. 2008;58:1079–83. 10.1099/ijs.0.64699-0. [ DOI ] [ PubMed ] [ Google Scholar ] 42. Graber JR, Leadbetter JR, Breznak JA. Description of Treponema azotonutricium sp. nov. and Treponema primitia sp. nov., the first spirochetes isolated from termite guts. Appl Environ Microbiol. 2004;70:1315–20. 10.1128/AEM.70.3.1315-1320.2004. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 43. Graber JR, Breznak JA. Physiology and nutrition of Treponema primitia , an H 2 / CO 2 -acetogenic spirochete from termite hindguts. Appl Environ Microbiol. 2004;70:1307–14. 10.1128/AEM.70.3.1307-1314.2004. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 44. Leadbetter JR, Schmidt TM, Graber JR, Breznak JA. Acetogenesis from H 2 plus CO 2 by spirochetes from termite guts. Science. 1999;283:686–9. 10.1126/science.283.5402.686. [ DOI ] [ PubMed ] [ Google Scholar ] 45. Rosenthal AZ, Zhang X, Lucey KS, Ottesen EA, Trivedi V, Choi HMT, et al. Localizing transcripts to single cells suggests an important role of uncultured deltaproteobacteria in the termite gut hydrogen economy. Proc Natl Acad Sci U S A. 2013;110:16163–8. 10.1073/pnas.1307876110. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 46. Song Y, Hervé V, Radek R, Pfeiffer F, Zheng H, Brune A. Characterization and phylogenomic analysis of Breznakiella homolactica gen. nov. sp. nov. indicate that termite gut treponemes evolved from non-acetogenic spirochetes in cockroaches. Environ Microbiol. 2021;23:4228–45. 10.1111/1462-2920.15600. [ DOI ] [ PubMed ] [ Google Scholar ] 47. Song Y, Pfeiffer F, Radek R, Hearne C, Herv V, Brune A. Comparative analysis of Brucepastera parasyntrophica gen. nov., sp. nov. and Teretinema zuelzerae gen. nov., comb. nov. ( Treponemataceae ) reveals the importance of interspecies hydrogen transfer in the energy metabolism of spirochetes. Appl Environ Microbiol. 2022;88:e00503-22. 10.1128/aem.00503-22. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 48. Buyuktimkin B, Zafar H, Saier MH. Comparative genomics of the transportome of ten Treponema species. Microb Pathog. 2019;132:87–99. 10.1016/j.micpath.2019.04.034. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 49. Chow V, Nong G, Preston JF. Structure, function, and regulation of the aldouronate utilization gene cluster from Paenibacillus sp. strain JDR-2. J Bacteriol. 2007;189:8863–70. 10.1128/jb.01141-07. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 50. StJohn FJ, Rice JD, Preston JF. Paenibacillus sp. strain JDR-2 and XynA1: a novel system for methylglucuronoxylan utilization. Appl Environ Microbiol. 2006;72:1496–506. 10.1128/AEM.72.2.1496-1506.2006. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 51. Itoh T, Ochiai A, Mikami B, Hashimoto W, Murata K. A novel glycoside hydrolase family 105: the structure of family 105 unsaturated rhamnogalacturonyl hydrolase complexed with a disaccharide in comparison with family 88 enzyme complexed with the disaccharide. J Mol Biol. 2006;360:573–85. 10.1016/j.jmb.2006.04.047. [ DOI ] [ PubMed ] [ Google Scholar ] 52. Richardson JS, Oresnik IJ. L-rhamnose transport is sugar kinase (RhaK) dependent in Rhizobium leguminosarum bv. trifolii . J Bacteriol. 2007;189:8437–46. 10.1128/jb.01032-07. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 53. Uehara T, Park JT. The N-acetyl-d-glucosamine kinase of Escherichia coli and its role in murein recycling. J Bacteriol. 2004;186:7273–9. 10.1128/jb.186.21.7273-7279.2004. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 54. Salgado JFM, Hervé V, Vera MAG, Tokuda G, Brune A. Unveiling lignocellulolytic potential: a genomic exploration of bacterial lineages within the termite gut. Microbiome. 2024;12:201. 10.1186/s40168-024-01917-7. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 55. Lilburn TG, Kim KS, Ostrom NE, Byzek KR, Leadbetter JR, Breznak JA. Nitrogen fixation by symbiotic and free-living spirochetes. Science. 2001;292:2495–8. 10.1126/science.1060281. [ DOI ] [ PubMed ] [ Google Scholar ] 56. Skerman VBD, McGowan V, Sneath PHA. Approved lists of bacterial names. Int J Syst Evol Microbiol. 1980;30:225–420. 10.1099/00207713-30-1-225. [ Google Scholar ] 57. Oren A, Arahal DR, Göker M, Moore ERB, Rossello-Mora R, Sutcliffe IC. International code of nomenclature of prokaryotes. Prokaryotic code (2022 revision). Int J Syst Evol Microbiol. 2023;73:005585. 10.1099/ijsem.0.005585. [ DOI ] [ PubMed ] [ Google Scholar ] 58. Gupta RS, Mahmood S, Adeolu M. A phylogenomic and molecular signature based approach for characterization of the phylum Spirochaetes and its major clades: proposal for a taxonomic revision of the phylum. Front Microbiol. 2013. 10.3389/fmicb.2013.00217. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 59. Radek R, Strassert JFH, Krüger J, Meuser K, Scheffrahn RH, Brune A. Phylogeny and ultrastructure of Oxymonas jouteli , a rostellum-free species, and Opisthomitus longiflagellatus sp. nov., oxymonadid flagellates from the gut of Neotermes jouteli . Protist. 2014;165:384–99. 10.1016/j.protis.2014.04.003. [ DOI ] [ PubMed ] [ Google Scholar ] 60. Trager W. The cultivation of a cellulose-digesting flagellate, Trichomonas termopsidis , and of certain other termite protozoa. Biol Bull. 1934;66:182–90. 10.2307/1537331. [ Google Scholar ] 61. Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T, Yarza P, et al. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res. 2013;41:D590–6. 10.1093/NAR/GKS1219. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 62. Mies US, Zheng H, Platt K, Radek R, Paczia N, Treitli SC, et al. Comparative genomics of Elusimicrobiaceae (phylum Elusimicrobiota ) and description of the isolates Elusimicrobium simillimum sp. nov., Elusimicrobium posterum sp. nov., and Parelusimicrobium proximum gen. nov. sp. nov. Syst Appl Microbiol. 2025;48:126606. 10.1016/j.syapm.2025.126606. [ DOI ] [ PubMed ] [ Google Scholar ] 63. Ludwig W, Strunk O, Westram R, Richter L, Meier H, Yadhukumar, et al. ARB: a software environment for sequence data. Nucleic Acids Res. 2004;32:1363–71. 10.1093/nar/gkh293. [ DOI ] [ PMC free article ] [ PubMed ] 64. Behrens S, Fuchs BM, Mueller F, Amann R. Is the in situ accessibility of the 16S rRNA of Escherichia coli for Cy3-labeled oligonucleotide probes predicted by a three-dimensional structure model of the 30S ribosomal subunit? Appl Environ Microbiol. 2003;69:4935–41. 10.1128/AEM.69.8.4935-4941.2003. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 65. Manz W, Amann R, Ludwig W, Wagner M, Schleifer K-H. Phylogenetic oligodeoxynucleotide probes for the major subclasses of Proteobacteria: problems and solutions. Syst Appl Microbiol. 1992;15:593–600. 10.1016/S0723-2020(11)80121-9. [ Google Scholar ] 66. Weisburg WG, Barns SM, Pelletier DA, Lane DJ. 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol. 1991;173:697–703. 10.1128/jb.173.2.697-703.1991. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 67. Oberacker P, Stepper P, Bond DM, Höhn S, Focken J, Meyer V, et al. Bio-On-Magnetic-Beads (BOMB): open platform for high-throughput nucleic acid extraction and manipulation. PLoS Biol. 2019;17:e3000107. 10.1371/journal.pbio.3000107. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 68. Spurr AR. A low-viscosity epoxy resin embedding medium for electron microscopy. J Ultrastruct Res. 1969;26:31–43. 10.1016/S0022-5320(69)90033-1. [ DOI ] [ PubMed ] [ Google Scholar ] 69. Reynolds ES. The use of lead citrate at high pH as an electron-opaque stain in electron microscopy. J Cell Biol. 1963;17:208–12. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 70. Chen S, Zhou Y, Chen Y, Gu J. fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics. 2018;34:i884-90. 10.1093/BIOINFORMATICS/BTY560. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 71. Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, et al. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol. 2012;19:455–77. 10.1089/cmb.2012.0021. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 72. Dick GJ, Andersson AF, Baker BJ, Simmons SL, Thomas BC, Yelton AP, et al. Community-wide analysis of microbial genome sequence signatures. Genome Biol. 2009;10:R85. 10.1186/gb-2009-10-8-r85. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 73. Parks DH, Imelfort M, Skennerton CT, Hugenholtz P, Tyson GW. CheckM: assessing the quality of microbial genomes recovered from isolates, single cells, and metagenomes. Genome Res. 2015;25:1043–55. 10.1101/GR.186072.114. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 74. Chklovski A, Parks DH, Woodcroft BJ, Tyson GW. CheckM2: a rapid, scalable and accurate tool for assessing microbial genome quality using machine learning. Nat Methods. 2023;20:1203–12. 10.1038/s41592-023-01940-w. [ DOI ] [ PubMed ] [ Google Scholar ] 75. Seemann T. Prokka: rapid prokaryotic genome annotation. Bioinformatics. 2014;30:2068–9. 10.1093/bioinformatics/btu153. [ DOI ] [ PubMed ] [ Google Scholar ] 76. Kanehisa M, Sato Y, Morishima K. BlastKOALA and GhostKOALA: KEGG tools for functional characterization of genome and metagenome sequences. J Mol Biol. 2016;428:726–31. 10.1016/j.jmb.2015.11.006. [ DOI ] [ PubMed ] [ Google Scholar ] 77. Aramaki T, Blanc-Mathieu R, Endo H, Ohkubo K, Kanehisa M, Goto S, et al. KofamKOALA: KEGG ortholog assignment based on profile HMM and adaptive score threshold. Bioinformatics. 2020;36:2251–2. 10.1093/bioinformatics/btz859. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 78. Buchfink B, Reuter K, Drost H-G. Sensitive protein alignments at tree-of-life scale using DIAMOND. Nat Methods. 2021;18:366–8. 10.1038/s41592-021-01101-x. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 79. Zheng J, Ge Q, Yan Y, Zhang X, Huang L, Yin Y. dbCAN3: automated carbohydrate-active enzyme and substrate annotation. Nucleic Acids Res. 2023;51:W115-21. 10.1093/nar/gkad328. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 80. Emms DM, Kelly S. OrthoFinder: phylogenetic orthology inference for comparative genomics. Genome Biol. 2019;20:238. 10.1186/s13059-019-1832-y. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 81. Nielsen H. Predicting secretory proteins with SignalP. In: Kihara D, editor. Protein function prediction: methods and protocols. New York, NY: Springer; 2017:59–73. 10.1007/978-1-4939-7015-5_6. [ DOI ] [ PubMed ] 82. Pruesse E, Peplies J, Glöckner FO. SINA: accurate high-throughput multiple sequence alignment of ribosomal RNA genes. Bioinformatics. 2012;28:1823–9. 10.1093/bioinformatics/bts252. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 83. Wong TKF, Ly-Trong N, Ren H, Baños H, Roger AJ, Susko E, et al. IQ-TREE 3: phylogenomic inference software using complex evolutionary models. EcoEvoRxiv. 2025. 10.32942/X2P62N. https://ecoevorxiv.org/repository/view/8916/ . 84. Chaumeil PA, Mussig AJ, Hugenholtz P, Parks DH. GTDB-Tk: a toolkit to classify genomes with the Genome Taxonomy Database. Bioinformatics. 2020;36:1925–7. 10.1093/BIOINFORMATICS/BTZ848. [ DOI ] [ PMC free article ] [ PubMed ] [ Google Scholar ] 85. Parks DH, Chuvochina M, Chaumeil PA, Rinke C, Mussig AJ, Hugenholtz P. A complete domain-to-species taxonomy for Bacteria and Archaea. Nat Biotechnol. 2020;38:1079–86. 10.1038/s41587-020-0501-8. [ DOI ] [ PubMed ] [ Google Scholar ] 86. Wang H-C, Minh BQ, Susko E, Roger AJ. Modeling site heterogeneity with posterior mean site frequency profiles accelerates accurate phylogenomic estimation. Syst Biol. 2018;67:216–35. 10.1093/sysbio/syx068. [ DOI ] [ PubMed ] [ Google Scholar ] Associated Data This section collects any data citations, data availability statements, or supplementary materials included in this article. Supplementary Materials 12915_2026_2591_MOESM1_ESM.pdf (201.4KB, pdf) Additiopnal file 1. Supplementary figures S1-S2. Fig. S1 – Expanded 16S rRNA gene-based maximum-likelihood (ML) tree of the phylum Spirochatetota . Fig. S2 – Phylogeny of the Kalotermes termites based on cytochrome-c oxidase subunit II. 12915_2026_2591_MOESM2_ESM.xlsx (312.3KB, xlsx) Additional file 2. Supplementary tables S1-S6, S8. Table S1 – Glycoside hydrolase families identified in the genome of Pillotina corrugata . Table S2 – Glycoside hydrolase families identified in the genome of Hollandina grandis . Table S3 – Glycoside hydrolase families identified in the genome of Hollandinoides gharagozlouae . Table S4 – Gene annotation list for Pillotina corrugata . Table S5 – Gene annotation list for Hollandina grandis . Table S6 – Gene annotation list for Hollandinoides gharagozlouae .  Table S8 – 16S rRNA gene libraries inspected for the presence of Breznakiellaceae , with the accession numbers for the identified Breznakiellaceae sequences . 12915_2026_2591_MOESM3_ESM.pdf (300.7KB, pdf) Additional file 3. Supplementary table S7. Table S7 – Protologues for the new species described under SeqCode. Data Availability Statement The sequence data have been deposited at the National Center for Biotechnology Information (NCBI) in GenBank ( https://www.ncbi.nlm.nih.gov/genbank ) under NCBI BioProject PRJNA1301810. The scaffolds assigned to the draft genomes of Pillotina corrugata , Hollandina grandis , and Hollandinoides gharagozlouae have been deposited at GenBank under the accession nos. JBQMQA000000000 , JBQLJB000000000 , and JBUAPY000000000 , respectively). The genome assembly of the RfSP9 SAG was deposited at GenBank under the accession number JBTZSX000000000 . Newly obtained 16S rRNA gene sequences are available in GenBank under accession numbers PX098795–PX098819 , and PX098832–PX098836 . Articles from BMC Biology are provided here courtesy of BMC ACTIONS View on publisher site PDF (4.8 MB) Cite Collections Permalink PERMALINK Copy RESOURCES Similar articles Cited by other articles Links to NCBI Databases Cite Copy Download .nbib .nbib Format: AMA APA MLA NLM Add to Collections Create a new collection Add to an existing collection Name your collection * Choose a collection Unable to load your collection due to an error Please try again Add Cancel Follow NCBI NCBI on X (formerly known as Twitter) NCBI on Facebook NCBI on LinkedIn NCBI on GitHub NCBI RSS feed Connect with NLM NLM on X (formerly known as Twitter) NLM on Facebook NLM on YouTube National Library of Medicine 8600 Rockville Pike Bethesda, MD 20894 Web Policies FOIA HHS Vulnerability Disclosure Help Accessibility Careers NLM NIH HHS USA.gov Back to Top

Record · ID 715 · SHA-256 0f466ed985506686
Conceptio Open Knowledge Archive — every document is proof-bundled with source, license, and retrieval metadata.